A molecular identification of medicinal Rheum Species cultivated germplasm from the northwest of China using DNA barcoding

2021 ◽  
Author(s):  
Dawei Chen ◽  
Hui Zhang ◽  
Libo Chang ◽  
Lingyun Jia ◽  
Kun Sun
Keyword(s):  
Dna Barcoding ◽  
Molecular Identification

Research Paper DNA barcode identification of fish products from Guiyang markets in southwest China

2022 ◽  
Author(s):  
Qian Tang ◽  
Qi Luo ◽  
Qian Duan ◽  
Lei Deng ◽  
Renyi Zhang
Keyword(s):  
Dna Barcoding ◽  
Molecular Identification ◽  
Fish Consumption ◽  
Southwest China ◽  
Dna Barcode ◽  
Guizhou Province ◽  
Accurate Identification ◽  
Continuous Growth ◽  
Fish Products ◽  
Fresh Frozen

Nowadays, the global fish consumption continues to rise along with the continuous growth of the population, which has led to the dilemma of overfishing of fishery resources. Especially high-value fish that are overfished are often replaced by other fish. Therefore, the accurate identification of fish products in the market is a problem worthy of attention. In this study, full-DNA barcoding (FDB) and mini-DNA barcoding (MDB) used to detect the fraud of fish products in Guiyang, Guizhou province in China. The molecular identification results showed that 39 of the 191 samples were not consistent with the labels. The mislabelling of fish products for fresh, frozen, cooked and canned were 11.70%, 20.00%, 34.09% and 50.00%, respectively. The average kimura 2 parameter distances of MDB within species and genera were 0.27% and 5.41%, respectively; while average distances of FDB were 0.17% within species and 6.17% within genera. In this study, commercial fraud is noticeable, most of the high-priced fish were replaced of low-priced fish with a similar feature. Our study indicated that DNA barcoding is a valid tool for the identification of fish products and that it allows an idea of conservation and monitoring efforts, while confirming the MDB as a reliable tool for fish products.

Molecular Identification of Reptiles from Tabuk Region of Saudi Arabia Through DNA Barcoding: A Case Study

2020 ◽  
pp. 253-264
Author(s):  
Bishal Dhar ◽  
Mohua Chakraborty ◽  
Madhurima Chakraborty ◽  
Sorokhaibam Malvika ◽  
N. Neelima Devi ◽  
...  
Keyword(s):  
Saudi Arabia ◽  
Dna Barcoding ◽  
Molecular Identification

Molecular identification of dried squid products sold in China using DNA barcoding and SYBR green real time PCR

2020 ◽  
Vol 37 (7) ◽  
pp. 1061-1074
Author(s):  
Rongzhen Shi ◽  
Manhong Huang ◽  
Jing Wang ◽  
Chuhan He ◽  
Xiaoguo Ying ◽  
...  
Keyword(s):  
Real Time ◽  
Dna Barcoding ◽  
Molecular Identification ◽  
Real Time Pcr ◽  
Sybr Green

scholarly journals Molecular identification of Uncaria (Gouteng) through DNA barcoding

2016 ◽  
Vol 11 (1) ◽  
Author(s):  
Yin-lin Tang ◽  
Yao-sheng Wu ◽  
Rui-song Huang ◽  
Nai-xia Chao ◽  
Yong Liu ◽  
...  
Keyword(s):  
Dna Barcoding ◽  
Molecular Identification

scholarly journals Identifikasi Molekuler Kapang Asosiasi Spons menggunakan Metode DNA Barcoding

2021 ◽  
Vol 10 (1) ◽  
pp. 48-54
Author(s):  
Stefanie Jessica Henny Larasati ◽  
Agus Sabdono ◽  
Mada Triandala Sibero
Keyword(s):  
Dna Barcoding ◽  
Trichoderma Reesei ◽  
Molecular Identification ◽  
Fusarium Solani ◽  
Dna Amplification ◽  
The Body ◽  
Universal Primers ◽  
Fruiting Body Formation ◽  
Marine Biotechnology ◽  
Filter Feeders

Spons merupakan organisme yang memiliki pori-pori dan termasuk kedalam filum Porifera. Hewan ini merupakan filter feeders dimana spons menyaring makanannya masuk kedalam rongga tubuhnya, sehingga spons dapan memakan partikel organik algae, dan mikroba, termasuk kapang. Kapang merupakan mikroorganisme eukariotik dari kingdom fungi, multiseluler, menghasilkan miselium tanpa pembentukan badan buah. Kapang dapat berfungsi sebagai penjaga keseimbangan ekosistem di perairan. Tujuan dari penelitian ini adalah mengidentifikasi dua isolat kapang yang telah diisolasi dari inang spons di ekosistem mangrove dengan menggunakan DNA barcoding. Metode dalam penelitian ini yaitu peremajaan isolat, karakterisasi morfologi yaitu warna koloni, tekstur, reverse, exudates, sclerotia, bentuk konidia, konidiofor, spora, dan septa. Identifikasi molekuler dari ekstraksi DNA, amplifikasi, elektroforesis, visualisasi DNA, sekuens dan BLAST. Optimasi suhu annealing dilakukan pada amplifikasi DNA. Berdasarkan identifikasi molekuler dengan menggunakan primer universal ITS1 5' TCCGTAGGTGAACCTGCGG 3' dan ITS4 5' TCCTCCGCTTATTGATATGC 3' dan persamaan homologi, isolat MKMS 2.1 merupakan Trichoderma reesei (100%) dan PKMS 2.2 merupakan spesies Fusarium solani (99,81%). A sponge is an organism that has pores and belongs to the Porifera phylum. These animals are filter feeders where the sponge filters its food into the body cavity, so the sponge can eat organic algae particles, and microbes, including fungi. Mold is a eukaryotic microorganism from Fungi kingdom, multicellular, that forms mycelium without fruiting body formation. Mold has an important role in balancing the environmental quality in an ecosystem. The purpose of this study was to identify two molds that had been isolated from sponge in the mangrove ecosystem using DNA barcoding. The study was conducted in April-October 2019 in Laboratory of Tropical Marine Biotechnology using the experimental laboratory method. The methods in this research were isolation refreshment, morphological characterization which were consisted of colony color, texture, reverse, exudates, sclerotia, conidia, conidiophores, spores, and septa. Molecular identification consisted of DNA extraction, amplification, electrophoresis, DNA visualization, sequences and BLAST. Annealing temperature optimization is carried out on DNA amplification. Based on molecular identification using universal primers ITS1 5 'TCCGTAGGTGAACCTGCGG 3' and ITS4 5 'TCCTCCGCTTATTGATATGC 3' and homological equations, MKMS 2.1 isolates were identified as Trichoderma reesei (100%) and PKMS 2.2 were identified as Fusarium solani (99.81%).

scholarly journals KERAGAMAN GENETIK IKAN TIGER FISH (Datnioides sp.) ASAL KALIMANTAN DAN SUMATERA

2018 ◽  
Vol 13 (3) ◽  
pp. 191
Author(s):  
Melta Rini Fahmi ◽  
Erma Primanita Hayuningtyas ◽  
Mochammad Zamroni ◽  
Bastiar Nur ◽  
Shofihar Sinansari
Keyword(s):  
Genetic Diversity ◽  
Genetic Distance ◽  
Cytochrome Oxidase ◽  
Dna Barcoding ◽  
Cytochrome B ◽  
Molecular Identification ◽  
Coi Gene ◽  
Cyt B ◽  
Cytochrome Oxidase 1 ◽  
Rag2 Gene

Ikan tiger fish (Datnioides sp.) merupakan ikan hias air tawar yang memiliki nilai ekonomis penting. Distribusi populasi ikan ini meliputi Papua, Kalimantan, dan Sumatera, dengan tingkat eksploitasi yang cukup tinggi di dua lokasi terakhir. Penelitian ini dilakukan untuk mendapatkan informasi keragaman genetik ikan tiger fish yang mendiami perairan Kalimantan dan Sumatera. Sebanyak 24 sampel ikan uji dikoleksi dari Sungai Kapuas, Kalimantan Barat dan Sungai Musi, Sumatera Selatan. Penelitian dilakukan dalam dua tahap, tahap pertama yaitu identifikasi molekuler dengan menggunakan DNA barcoding gen cytochrome oxidase 1 (COI), tahap kedua adalah analisis keragaman genetik dengan menggunakan marka DNA mitokondria gen cytochrome b (Cyt b), dan DNA inti gen recombination activating gene (RAG2). Hasil identifikasi secara molekuler menunjukkan bahwa ikan hasil koleksi memiliki kesamaan genetik sebesar 100% dengan spesies D. undecimradiatus. Keragaman genetik ikan tiger fish antar populasi berkisar pada nilai 0,023 (standar deviasi 0,001) sedangkan keragaman intra populasi adalah sebesar 0,002 dan 0,003 masing-masing untuk populasi Kalimantan dan Sumatera. Jarak genetik sampel baik yang berasal dari Sumatera maupun Kalimantan dengan spesies D. undeciumradiatus masing-masing 0,003 dan 0,006; sedangkan dengan spesies D. microlepis yaitu 0,142. Analisis menggunakan gen RAG2 menunjukkan sampel yang diuji memiliki struktur populasi yang terpisah ditandai dengan terjadinya mutasi pada enam nukleotida dan tiga asam amino.The Tiger fish (Datnioides sp.) is a freshwater ornamental fish that has important economic value. The distribution of this fish included Papua, Kalimantan, and Sumatra, but intensive exploitation occurs in the last two population. This research was conducted to obtain the genetic diversity of tiger fish that inhabited in Kalimantan and Sumatra. A total of 24 fish were collected from Kapuas River, West Kalimantan and Musi River, at Sumatra. The study was conducted in two stages, the first stage is molecular identification of sample by using DNA barcoding cytochrome oxidase 1 (COI) gene, the second stage is analyses of genetic diversity of tiger fish within and between population by using the mitochondrial DNA cytochrome b (Cyt b) gene, and nucleus DNA recombination (RAG2) gene. The molecular identification has shown that the collected fish has a genetic similarity of 100% with D. undecimradiatus. The genetic diversity of tiger fish between populations is 0.023 (standard deviation of 0.001) whereas intra-population is 0.002 and 0.003 for Kalimantan and Sumatra, respectively. The genetic distance of samples with species D. undeciumradiatus were 0.003 and 0.006 for Kalimantan and Sumatera, respectively, whereas the genetic distance with D. microlepis was 0.142. The analysis of mutation on RAG2 gene shows there are six nucleotides and three amino acids have mutation.

scholarly journals The molecular identification of Zanthoxylum armatum DC of Pakistan based on DNA barcoding

2020 ◽  
Vol 27 (2) ◽  
pp. 323-333
Author(s):  
Shakila Umer ◽  
Nayab Safdar ◽  
Khushi Muhammad
Keyword(s):  
Dna Barcoding ◽  
Molecular Identification ◽  
Sequence Similarity ◽  
Pcr Analysis ◽  
Dna Barcodes ◽  
Zanthoxylum Armatum ◽  
The Family ◽  
Plant Taxon ◽  
Identification Of Species ◽  
Zanthoxylum Bungeanum

Zanthoxylum armatum DC., belonged to the family Ruteacea, is a medicinal plant used to cure many diseases. DNA barcoding was used as a tool for molecular identification of Zanthoxylum armatum DC. species from Balakot Pakistan. In the present study four DNA barcodes including matk, rbcl, ITS and trnH-psbA were used. The sequenced data were analyzed by using BLASTn at NCBI, FASTA and Mega 7.0 software. During PCR analysis, 3 DNA barcodes ITS, rbcl and trnh-psbA were successfully amplified and showed the 100% sequencing success. Furthermore, these barcode markers showed 99-100% sequence similarity with the reference sequences at the BLASTn. The further analysis revealed the sequence similarity of investigating marker with Zanthoxylum armatum (MH016484.1), Zanthoxylum nitidum (FN599471.1) and Zanthoxylum bungeanum (MF097123.1) respectively. The current finding provides the basis for sequenced data of Z. armatum to be used in future for molecular discrimination among the plant species from Pakistan and it is concluded that combination of diverse kind of barcoding markers could be helpful in proper identification of species at lower taxonomic level. Bangladesh J. Plant Taxon. 27(2): 323-333, 2020 (December)

Sign in / Sign up

Export Citation Format

Share Document