Earthworm (Pheretima guillelmi)-mycorrhizal fungi (Funneliformis mosseae) association mediates rhizosphere responses in white clover

2022 ◽  
Vol 172 ◽  
pp. 104371
Author(s):  
Lu-Lu Meng ◽  
A.K. Srivastava ◽  
Kamil Kuča ◽  
Qiang-Sheng Wu
Keyword(s):  
White Clover ◽  
Mycorrhizal Fungi ◽  
Funneliformis Mosseae

scholarly journals Single or dual inoculation of arbuscular mycorrhizal fungi and rhizobia regulates plant growth and nitrogen acquisition in white clover

2020 ◽  
Vol 66 (No. 6) ◽  
pp. 287-294
Author(s):  
Miao-Miao Xie ◽  
Ying-Ning Zou ◽  
Qiang-Sheng Wu ◽  
Ze-Zhi Zhang ◽  
Kamil Kuča
Keyword(s):  
Plant Growth ◽  
Arbuscular Mycorrhizal Fungi ◽  
White Clover ◽  
Mycorrhizal Fungi ◽  
Nitrogenase Activity ◽  
Arbuscular Mycorrhizal ◽  
Total Soluble Protein ◽  
Nitrogen Acquisition ◽  
Dual Inoculation ◽  
N Acquisition

The present work aimed to analyse whether and how single or dual inoculation with arbuscular mycorrhizal fungi (Funneliformis mosseae, Paraglomus occultum, and Rhizophagus intraradices) and rhizobia (Rhizobium trifolii) improved plant growth and stimulated nitrogen (N) acquisition of white clover. AMF inoculation significantly (P < 0.05) increased root nodule number by 117‒173%, and additional Rh considerably stimulated mycorrhizal growth. Single AMF or Rh treatment dramatically increased shoot by 36‒281% and root biomass by 16‒36% than non-inoculated control, and dual inoculation of Rh and P. occultum or R. intraradices further magnified the positive effect. Leaf and root N content, root total soluble protein content, root nitrogenase activity, and amino acid (e.g., alanine, arginine, asparagine, aspartate, phenylalanine, proline, and tryptophan) concentrations were significantly increased by single or dual inoculation, while dual inoculation of AMF and Rh had significantly superior roles than single corresponding AMF or Rh inoculation. These results suggested that AMF and Rh represented synergetic effects on accelerating N acquisition of white clover to some extent, while the combination of P. occultum and Rh was the best.  

scholarly journals Arbuscular Mycorrhizal Fungi Effectively Enhances the Growth of Gleditsia sinensis Lam. Seedlings under Greenhouse Conditions

Forests ◽  
2019 ◽  
Vol 10 (7) ◽  
pp. 567 ◽  
Author(s):  
Jinping Wang ◽  
Huini Zhong ◽  
Lingjun Zhu ◽  
Yingdan Yuan ◽  
Linhao Xu ◽  
...  
Keyword(s):  
Arbuscular Mycorrhizal Fungi ◽  
Mycorrhizal Fungi ◽  
Growth Parameters ◽  
Arbuscular Mycorrhizal ◽  
Nutrient Content ◽  
N Content ◽  
Basal Diameter ◽  
Funneliformis Mosseae ◽  
Positive Effects ◽  
Gleditsia Sinensis

The Chinese honey locust tree Gleditsia sinensis Lam. (Fabaceae) is a precious ecological and economic tree species that has wide-ranging usage. However, knowledge regarding seedling cultivation (especially the use of arbuscular mycorrhizal fungi (AMF)) is scarce, which limits the developent of Gleditsia plantations. A pot experiment was carried out under greenhouse conditions to estimate the effects of three AMF strains (Funneliformis mosseae 1, Funneliformis mosseae 2, and Diversispora tortuosa) on the growth, photosynthetic rate, and nutrient content of G. sinensis seedlings. Results showed that the growth parameters (seedling height, basal diameter, dry biomass) of the seedlings were significantly increased by each of the three AMF strains, associated with high root colonization rates (greater than 75%). Chlorophyll concentrations and photosynthetic rates were also increased by AMF, and phosphorus (P), and potassium (K) content in the three organs (leaf, stem, and root), and nitrogen (N) content in the leaf and stem of arbuscular mycorrhizal (AM) seedlings were significantly higher than in non-AM seedlings. Mycorrhizal dependency of the AM seedlings was greater than 350%, and significantly correlated with the increased P and K content in all three organs and increased N content in the leaf and stem. Positive effects of F. mosseae on growth and the nutrient content of seedlings were higher than those of D. tortuosa, but no significant different effects on G. sinensis seedlings were observed between the two strains of F. mosseae. Hence, growth of G. sinensis seedlings was effectively enhanced by AMF, with F. mosseae being more suitable for the inoculation of G. sinensis seedlings. These results indicate that arbuscular mycorrhization is beneficial for the growth of young G. sinensis plants. Further research is needed to determine whether the effects can be reproduced in a forest situation.

THE INOCULATION OF WHITE CLOVER WITH MYCORRHIZAL FUNGI IN UNSTERILE HILL SOILS

1982 ◽  
Vol 92 (1) ◽  
pp. 89-102 ◽  
Author(s):  
A. RANGELEY ◽  
M. J. DAFT ◽  
P. NEWBOULD
Keyword(s):  
White Clover ◽  
Mycorrhizal Fungi ◽  
Hill Soils

scholarly journals First Report of an Arbuscular Mycorrhizal Fungus Funneliformis mosseae Associated with Thuja plicata in an Ectomycorrhizal Forest in Greece

2016 ◽  
Vol 5 (1) ◽  
pp. 53-53
Author(s):  
Antonios Zambounis ◽  
Aliki Xanthopoulou ◽  
Filippos A. Aravanopoulos ◽  
Athanasios Tsaftaris ◽  
Evaggelos Barbas
Keyword(s):  
Mycorrhizal Fungi ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
First Record ◽  
Thuja Plicata ◽  
Allium Porrum ◽  
Northern Greece ◽  
Funneliformis Mosseae ◽  
Mycorrhizal Association

The ability of trees forming arbuscular mycorrhizal (AM) associations to get established in ectomycorrhizal forests is still unknown (Weber et al., 2005). The success of both establishment and adaptation depends on the type of interactions between the plants introduced and the type of indigenous soil microbiota (Fahey et al., 2012). Thuja plicata is an AM forest tree successfully established (since 1962) in an artificial trial plantation in the region of Chalkidiki (northern Greece). The successful adaptation of an AM tree in an ectomycorrhizal forest raises questions about the feasibility, if any of the mycorrhizal association under these conditions, as well as on the kind of this association and the species of mycorrhizal fungi putatively involved. During a survey, roots fragments were excised from three Thuja plicata trees and were co-cultured with leek roots (Allium porrum, var. bleu de solaise) in the greenhouse. The successful colonization of the leeks by AM fungi was confirmed by the presence of arbuscular and vesicular structures in the roots after microscopic examination. Colonized Allium porrum roots have then been harvested, surface disinfected (90% ethanol for 10 seconds, 6% sodium hypochlorite for 5 min) and plated on agar solidified medium in Petri dishes. Molecular identification of the mycorrhizal fungal species involved in this symbiosis, was performed after total nucleic acids were extracted using the DNeasy Plant Mini Kit (Qiagen, Crawley, UK). A portion of the 18S ribosomal RNA region was amplified using the primers AML1 (5’ AACTTTCGATGGTAGGATAGA 3’), AML2 (5’ CCAAACACTTTGGTTTCC 3’). The PCR amplicon was cloned using TOPO TA Cloning Kit (Invitrogen, Paisley, U.K.) and sequenced (GenBank accession Nos. KU365383 - KU365385). All partial sequences revealed 99% nucleotide homology with the 18S rRNA sequence of a Funneliformis mosseae fungus isolate (KP144312). To our knowledge, this is the first record of Thuja plicata associated with Glomeromycetes AM fungal communities in an ectomycorrhizal forest in Greece

scholarly journals Physiological responses of mycorrhizal symbiosis to drought stress in white clover

2021 ◽  
Vol 49 (1) ◽  
pp. 12209
Author(s):  
Sheng-Min LIANG ◽  
Dao-Ju JIANG ◽  
Miao-Miao XIE ◽  
Ying-Ning ZOU ◽  
Qiang-Sheng WU ◽  
...  
Keyword(s):  
Drought Stress ◽  
Arbuscular Mycorrhizal Fungi ◽  
White Clover ◽  
Root Morphology ◽  
Mycorrhizal Fungi ◽  
Arbuscular Mycorrhizal ◽  
Soil Drought ◽  
Sugar Accumulation ◽  
Antioxidant Defense Systems ◽  
Mycorrhizal Plants

The aim of the present study was to analyze the effects of two arbuscular mycorrhizal fungi (AMF), Funneliformis mosseae and Paraglomus occultum, on leaf water status, root morphology, root sugar accumulation, root abscisic acid (ABA) levels, root malondialdehyde (MDA) content, and root antioxidant enzyme activities in white clover (Trifolium repens L.) exposed to well-watered (WW) and drought stress (DS) conditions. The results showed that root colonization by F. mosseae and P. occultum was significantly decreased by 7-week soil drought treatment. Under drought stress conditions, mycorrhizal fungal treatment considerably stimulated root total length, surface area and volume, as compared with non-mycorrhizal controls. In addition, inoculation with arbuscular mycorrhizal fungi also increased leaf relative water content and accelerated the accumulation of root glucose and fructose under drought stress. Mycorrhizal plants under drought stress registered higher activities of superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD) and ABA levels in roots, while lower MDA contents, relative to non-mycorrhizal plants. As a result, mycorrhiza-inoculated plants represented better physiological activities (e.g. antioxidant defense systems, root morphology, and sugar accumulation) than non-inoculated plants in response to soil drought, whilst P. occultum had superior effects than F. mosseae.

Sign in / Sign up

Export Citation Format

Share Document