scholarly journals First Report of Bacterial Leaf Spot of Coriander Caused by Pseudomonas syringae pv. coriandricola in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Lei Li ◽  
Yishuo Huang ◽  
Yanxia Shi ◽  
A LI CHAI ◽  
Xuewen Xie ◽  
...  
Keyword(s):  
Pseudomonas Syringae ◽  
Leaf Spot ◽  
Citrate Synthase ◽  
Morphological Characteristics ◽  
Likelihood Method ◽  
Bacterial Suspension ◽  
Leaf Spot Disease ◽  
Distilled Water ◽  
Bacterial Leaf Spot ◽  
First Report

Coriander (Coriandrum sativum L.) or Chinese parsley is a culinary herb with multiple medicinal effects that are widely used in cooking and traditional medicine. From September to November 2019, symptoms were observed in 2-month-old coriander plants from coriander fields in Lanzhou and Wenzhou, China. The disease developed rapidly under cold and wet climatic conditions, and the infection rate was almost 80% in open coriander fields. Typical symptoms on leaves included small, water-soaked blotches and irregular brown spots surrounding haloes; as the disease progressed, the spots coalesced into necrotic areas. Symptomatic leaf tissue was surface sterilized, macerated in sterile distilled water, and cultured on nutrient agar plates at 28 °C for 48 h (Koike and Bull, 2006). After incubation, six bacterial colonies, which were individually isolated from collected samples from two different areas, were selected for further study. Colonies on NA plate were small, round, raised, white to cream-colored, and had smooth margins. All bacterial isolates were gram-negative, rod-shaped and nonfluorescent on King's B medium. The bacteria were positive for levan production, Tween 80 hydrolysis, and tobacco hypersensitivity but negative for oxidase, potato slice rot test, arginine dihydrolase, ice nucleation activity, indole production and H2S production. The suspension of representative isolate for inoculating of plants was obtained from single colony on King's B medium for 2-3 days at 28 °C. DNA was extracted from bacterial suspensions of YS2003200102 cultured in 20 ml of King’s B medium broth at 28 °C for 1 day. Extraction was performed with a TIANamp Bacterial DNA Kit (TIANGEN, China) according to the manufacturer’s recommendations. The pathogen was confirmed by amplification and sequencing of the glyceraldehyde-3-phosphate dehydrogenase A (gapA) gene, the citrate synthase (gltA) gene, the DNA gyrase B (gyrB) gene and the RNA polymerase sigma factor 70 (rpoD) gene using gapA-For/gapA-Rev, gltA-For/gltA-Rev, gyrB-For/gryB-Rev, rpoD-For/rpoD-Rev primers, respectively (Popović et al., 2019). The sequences of the PCR products were deposited in GenBank with accession numbers MZ681931 (gapA), MZ681932 (gltA), MZ681933 (gyrB), and MZ681934 (rpoD). Phylogenetic analysis of multiple genes (Xu and Miller, 2013) was conducted with the maximum likelihood method using MEGA7. The sequences of our isolates and ten published sequences of P. syringae pv. coriandricola were clustered into one clade with a 100% confidence level. To confirm the pathogenicity of isolate YS2003200102, 2-month-old healthy coriander plants were inoculated by spraying the leaves with a bacterial suspension (108 CFU ml−1) at 28 °C incubation temperature and 70% relative humidity condition, and sterile distilled water was applied as a negative control treatment (Cazorla et al. 2005). Three replicates were conducted for every isolate, and each replicate included 6 coriander plants. After twelve days, only the inoculated leaves with bacterial suspension showed bacterial leaf spot resembling those observed on naturally infected coriander leaves. Cultures re-isolated from symptomatic leaves showed the same morphological characteristics and molecular traits as those initially isolated from infected leaves in the field. This bacterium was previously reported causing leaf spot of coriander in India and Spain (Gupta et al. 2013; Cazorla et al. 2005). To our knowledge, this is the first report of P. syringae pv. coriandricola causing leaf spot disease on coriander in China. Studies are needed on strategies to manage P. syringae pv. coriandricola in crops, because its prevalence may cause yield loss on coriander in China.

scholarly journals First Report of Pseudomonas syringae pv. coriandricola Causing Bacterial Leaf Spot on Carrot, Parsley, and Parsnip in Serbia

Plant Disease ◽  
2015 ◽  
Vol 99 (3) ◽  
pp. 416-416 ◽  
Author(s):  
T. Popović ◽  
Ž. Ivanović ◽  
M. Ignjatov ◽  
D. Milošević
Keyword(s):  
Pseudomonas Syringae ◽  
Leaf Spot ◽  
Bacterial Suspension ◽  
Pathogenicity Test ◽  
Distilled Water ◽  
Bacterial Leaf Spot ◽  
Koch’S Postulates ◽  
First Report ◽  
Vegetable Farm ◽  
Koch's Postulates

During the spring of 2014, a severe leaf spot disease was observed on carrot (Daucus carota), parsley (Petroselinum crispum), and parsnip (Pastinaca sativa) on a 0.5-ha vegetable farm in Vojvodina Province, Serbia. The disease appeared under wet and cool conditions with 5 to 25% of plants infected for each of the three crops. Symptoms were characterized as brown angular leaf spots, ~2 mm in diameter, often limited by veins. Collected symptomatic leaves were rinsed and dried at room temperature, and leaf sections taken from the margin of necrotic tissue were macerated in sterile phosphate buffer and streaked onto nutrient agar with 5% (w/v) sucrose (NAS). After isolation, whitish, circular, dome-shaped, Levan-positive colonies consistently formed. Five strains from each host (carrot, parsley, and parsnip) were used for further study. Strains were gram-negative, aerobic, and positive for catalase and tobacco hypersensitive reaction but negative for oxidase, rot of potato slices, and arginine dihydrolase. These reactions corresponded to LOPAT group Ia, which includes Pseudomonas syringae pathovars (3). Repetitive extragenic palindromic sequence (Rep)-PCR fingerprint profiles using the REP, ERIC, and BOX primers (4) were identical for all strains. Sequence typing of the housekeeping genes gyrB and rpoD (1) was performed for three representative strains (one from each host). Sequences were deposited in the NCBI GenBank database as accessions KM979434 to KM979436 (strains from carrot, parsnip, and parsley, respectively) for the gyrB gene and KM979437 to KM979439 (strains from parsnip, parsley and carrot, respectively) for the rpoD gene. Sequences were compared with pathotype strain Pseudomonas syringae pv. coriandricola ICMP12471 deposited in the Plant Associated and Environmental Microbes Database ( http://genome.ppws.vt.edu/cgi-bin/MLST/home.pl ). BLAST analysis revealed 100% homology for gyrB and 99% homology for rpoD. Pathogenicity was tested with five representative strains from each host on four-week-old plants of carrot (cv. Nantes), parsley (cv. NS Molski), and parsnip (cv. Dugi beli glatki) using two methods: spraying the bacterial suspension (108 CFU ml−1) on the leaves until runoff (5) and injecting the bacterial suspension into leaves with a hypodermic syringe (2). Four plants were used per strain and method. Sterile distilled water was applied as a negative control treatment for each plant species. All plants were kept in a mist room with 100% humidity for 4 h, then transferred to a greenhouse at 25°C and 80% relative humidity and examined for symptom development over a period of three weeks. For all strains, inoculated leaves first developed water-soaked lesions on the leaves 5 to 7 days after inoculation (DAI); 14 DAI lesions became dark brown, often surrounded by haloes. No symptoms were observed on control plants inoculated with sterile distilled water. For fulfillment of Koch's postulates, re-isolations were done onto NAS. Re-isolated bacteria were obtained from each inoculated host and confirmed to be identical to the original isolates using the LOPAT tests and Rep-PCR fingerprinting profiles. Based on the pathogenicity test accompanied by completion of Koch's postulates, sequence analysis, and bacteriological tests, the strains were identified as P. s. pv. coriandricola. To our knowledge, this is the first report of bacterial leaf spot of carrot, parsley, and parsnip in Serbia. It may present a threat to production due to quality requirements for fresh market. References: (1) P. Ferrente and M. Scortichini. Plant Pathol. 59:954, 2010. (2) M. Gupta et al. Plant Dis. 97:418, 2013. (3) R. A. Lelliott et al. J. Appl. Bacteriol. 29:470, 1966. (4) F. J. Louws et al. Appl. Environ. Microb. 60:2286, 1994. (5) X. Xu and S. A. Miller. Plant Dis. 97:988, 2013.

scholarly journals First Report of Bipolaris oryzae Causing Leaf Spot on Cultivated Wild Rice (Oryza rufipogon) in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Yue Lian Liu ◽  
Jian Rong Tang ◽  
Ya Li ◽  
Hong Kai Zhou
Keyword(s):  
Leaf Spot ◽  
Wild Rice ◽  
Morphological Characteristics ◽  
Oryza Rufipogon ◽  
Likelihood Method ◽  
Leaf Spot Disease ◽  
Pathogenicity Test ◽  
Sterile Water ◽  
Bipolaris Oryzae ◽  
First Report

Wild rice (Oryza rufipogon) has been widely studied and cultivated in China in recent years due to its antioxidant activities and health-promoting effects. In December 2018, leaf spot disease on wild rice (O. rufipogon cv. Haihong-12) was observed in Zhanjiang (20.93 N, 109.79 E), China. The early symptom was small purple-brown lesions on the leaves. Then, the once-localized lesions coalesced into a larger lesion with a tan to brown necrotic center surrounded by a chlorotic halo. The diseased leaves eventually died. Disease incidence was higher than 30%. Twenty diseased leaves were collected from the fields. The margin of diseased tissues was cut into 2 × 2 mm2 pieces, surface-disinfected with 75% ethanol for 30 s and 2% sodium hypochlorite for 60 s, and then rinsed three times with sterile water before isolation. The tissues were plated on potato dextrose agar (PDA) medium and incubated at 28 °C in the dark for 4 days. Pure cultures were produced by transferring hyphal tips to new PDA plates. Fifteen isolates were obtained. Two isolates (OrL-1 and OrL-2) were subjected to further morphological and molecular studies. The colonies of OrL-1 and OrL-1 on PDA were initially light gray, but it became dark gray with age. Conidiophores were single, straight to flexuous, multiseptate, and brown. Conidia were oblong, slightly curved, and light brown with four to nine septa, and measured 35.2–120.3 µm × 10.3–22.5 µm (n = 30). The morphological characteristics of OrL-1 and OrL-2 were consistent with the description on Bipolaris oryzae (Breda de Haan) Shoemaker (Manamgoda et al. 2014). The ITS region, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and translation elongation factor (EF-1α) were amplified using primers ITS1/ITS4, GDF1gpp1/GDR1 gdp2 (Berbee et al. 1999), and EF-1α-F/EF-1α-R EF-1/EF-2 (O’Donnell 2000), respectively. Amplicons of OrL-1 and OrL-2 were sequenced and submitted to GenBank (accession nos. MN880261 and MN880262, MT027091 and MT027092, and MT027093 and MT027094). The sequences of the two isolates were 99.83%–100% identical to that of B. oryzae (accession nos. MF490854，MF490831，MF490810) in accordance with BLAST analysis. A phylogenetic tree was generated on the basis of concatenated data from the sequences of ITS, GAPDH, and EF-1α via Maximum Likelihood method, which clustered OrL-1 and OrL-2 with B. oryzae. The two isolates were determined as B. oryzae by combining morphological and molecular characteristics. Pathogenicity test was performed on OrL-1 in a greenhouse at 24 °C to 30 °C with 80% relative humidity. Rice (cv. Haihong-12) with 3 leaves was grown in 10 pots, with approximately 50 plants per pot. Five pots were inoculated by spraying a spore suspension (105 spores/mL) onto leaves until runoff occurred, and five pots were sprayed with sterile water and used as controls. The test was conducted three times. Disease symptoms were observed on leaves after 10 days, but the controls remained healthy. The morphological characteristics and ITS sequences of the fungal isolates re-isolated from the diseased leaves were identical to those of B. oryzae. B. oryzae has been confirmed to cause leaf spot on Oryza sativa (Barnwal et al. 2013), but as an endophyte has been reported in O. rufipogon (Wang et al. 2015).. Thus, this study is the first report of B. oryzae causing leaf spot in O. rufipogon in China. This disease has become a risk for cultivated wild rice with the expansion of cultivation areas. Thus, vigilance is required.

scholarly journals First Report of Bacterial Leaf Spot Caused by Pseudomonas syringae pv. aptata on Swiss Chard, Beta vulgaris subsp. vulgaris, in Arizona

Plant Disease ◽  
2021 ◽  
Author(s):  
Marilen Nampijja ◽  
Mike Derie ◽  
Lindsey J. du Toit
Keyword(s):  
Beta Vulgaris ◽  
Pseudomonas Syringae ◽  
Leaf Spot ◽  
Phosphate Buffer ◽  
Negative Control ◽  
Bacterial Suspension ◽  
Bacterial Leaf Spot ◽  
First Report ◽  
Leaf Spots ◽  
Swiss Chard

Arizona is an important region of the USA for winter production of baby leaf crops such as spinach (Spinacia oleracea), table beet (Beta vulgaris subsp. vulgaris Condivita Group), and Swiss chard (B. vulgaris subsp. vulgaris Cicla Group). In the winter of 2019, severe leaf spots were observed at 80% incidence and 40% severity per plant in a 1-ha baby leaf Swiss chard crop of an (unknown cultivar) in Arizona. The lesions were circular to irregular, necrotic, water-soaked, and 1 to 5 mm in diameter. Symptomatic leaf sections (1-cm2) were surface-sterilized with 0.6% NaOCl, rinsed, and macerated in sterilized, deionized water. An aliquot of each macerate was streaked onto King’s B (KB) agar medium. Cream-colored, non-fluorescent colonies typical of Pseudomonas were isolated consistently, and all were non-fluorescent. A dozen isolates selected randomly were all negative for potato soft rot, oxidase, and arginine dihydrolase, and positive for levan production and tobacco hypersensitivity, which is typical of fluorescent P. syringae isolates, but can also include non-fluorescent strains (Lelliot et al. 1966). Three isolates were tested for pathogenicity on the table beet cv. Red Ace and Swiss chard cv. Silverado. Strain Pap009 of P. syringae pv. aptata (Psa), demonstrated previously to be pathogenic on Swiss chard and table beet, served as a positive control strain (Derie et al. 2016; Safni et al. 2016). Each isolate was grown inoculated into medium 523 broth and incubated on a shaker at 175 rpm overnight at 25°C. Each bacterial suspension was adjusted to an optical density (OD) of 0.3 at 600 nm (108 CFU/ml), and diluted in 0.0125M phosphate buffer to 107 CFU/ml. Thirty-day-old seedlings grown in Redi-Earth Plug and Seedling Mix in a greenhouse at 22 to 26°C were inoculated by rubbing the abaxial and adaxial leaf surfaces of each plant with a cotton swab dipped in inoculum to which Carborundum had been added (0.06 g/10 ml). The negative control plants were treated similarly with phosphate buffer with Carborundum. The experiment was set up as a randomized complete block design with 4 replications per treatment and 6 seedlings per experimental unit. In both trials, leaf spots resembling those on the original plants developed on all table beet and Swiss chard plants inoculated with the Arizona isolates and Pap009, but not on negative control plants. Disease severity was greater on Swiss chard (average 39% leaf area with spots) than on table beet (14%). Re-isolates obtained from inoculated seedlings using the same method as the original isolations resembled Psa. Multilocus sequence analysis (MLSA) was carried out for the original three Arizona isolates and the re-isolates using DNA amplified from the housekeeping genes gyrB, rpoD, gapA, and gltA (Hwang et al. 2005; Sarkar and Guttman 2004). Sequence identities of these genes of the Arizona isolates (GenBank accession numbers MW291615 to MW291618 for strain Pap089; MW291619 to MW291622 for Pap095; and MW291623 to MW291626 for Pap096 for gltA, gyrB, rpoD, and gapA, respectively) and the re-isolates ranged from 98 to 100% with those of Psa pathotype strain CFBP 1617 in the PAMDB database (Almeida et al. 2010; Altschul et al. 1997). Based on Koch’s postulates, colony characteristics, and MLSA, Psa was the causal agent of leaf spots in the Arizona Swiss chard crop. To our knowledge, this is the first report of bacterial leaf spot on chard in Arizona. The pathogen could have been introduced on infected seed as Psa is readily seedborne and seed transmitted.

scholarly journals First Report of Leaf Spot of Weigela florida Caused by Epicoccum layuense in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Yue Tian ◽  
Yingying Zhang ◽  
Chaodong Qiu ◽  
Zhenyu Liu
Keyword(s):  
Leaf Spot ◽  
Large Subunit ◽  
Morphological Characteristics ◽  
Likelihood Method ◽  
Pathogenicity Test ◽  
Distilled Water ◽  
Beta Tubulin ◽  
First Report ◽  
Leaf Spots ◽  
Weigela Florida

Weigela florida (Bunge) A. DC. is a dense, rounded, deciduous shrub commonly planted in landscapes. It is also used in Chinese medicine to treat sore throat, erysipelas, cold, and fever (Zheng et al. 2019). In May 2019, leaf spots were observed on approximately 50% of W. florida plants grown in the Wisdom Plaza Park of Anhui Agricultural University in Hefei, Anhui Province, China. Leaf spots begun as small light brown and irregular lesions, enlarged, turned reddish brown, coalesced to form large blighted areas, and eventually covered the entire leaf surface. Five pieces of tissues were removed from the lesion margins of each diseased leaf (five leaves from five different plants), chopped into several 3-4 mm2 pieces, disinfected with 1.5% NaOCl for 2 min, rinsed 3 times with sterile distilled water for 1 min, plated onto Potato Dextrose Agar (PDA) medium containing 50 μg/ml of ampicillin and kanamycin, and incubated at 25°C with a 12-hour photoperiod for 5 days. One segment of the fungal growth from the growing edge of the colony was transferred onto a fresh PDA plate for purification and incubated under the same conditions for another 5 days. The colony morphology of one representative isolate (AAU0519) was characterized by a pale orange cushion in the center surrounded by irregular pink margin, diffusing red orange pigments into the PDA medium. Isolate AAU0519 was cultured on PDA medium for 7 days at 25°C in the dark to induce sporulation. The produced conidia were globose, subglobose to pyriform, golden brown to brown, and with a diameter of 7.7 - 23.8 μm. Both cultural and morphological characteristics suggested that isolate AAU0519 was an Epicoccum species, according to the description by Chen et al. 2017. Amplification and sequencing of the internal transcribed spacer (ITS), beta-tubulin, and 28S large subunit ribosomal RNA (LSU) gene fragments from the extracted genomic DNA of AAU0519 were performed using primer sets ITS1/ITS4 (White et al. 1990), Bt2a/Bt2b (Glass and Donaldson 1995), and LSU1Fd/LR5 (Crous et al. 2009; Vilgalys and Hester 1990), respectively. A phylogenetic tree was constructed by the maximum-likelihood method with 1,000 bootstrapping replications based on the concatenated ITS, beta-tubulin, and LSU sequences from isolate AAU0519 and representative strains of 22 species of the genus Epicoccum (Chen et al. 2017). Isolate AAU0519 clustered with ex-holotype CGMCC 3.18362 of Epicoccum layuense Qian Chen, Crous & L. Cai (Chen et al. 2017). All obtained sequences were deposited into GenBank under accession numbers MK983497 (ITS), MN328723 (beta-tubulin), and MN328724 (LSU). A pathogenicity test was conducted on leaves of five 3-year-old W. florida cultivar “Red Prince” planted in the field (five leaves for each treatment and control per plant) by spraying 30 ml of a spore suspension (106 spores/ml) of isolate AAU0519 as treatment or sterilized distilled water as control. Before the inoculation, the leaves were disinfected with 70% ethanol. After inoculation, the leaves were wrapped with a plastic bag to keep high relative humidity. The average air temperature was about 28°C during the period of pathogenicity test. The experiment was repeated once. Ten days after inoculation, the fungal-inoculated leaves developed light brown lesions resembling those of naturally infected leaves, control leaves did not develop any symptoms. E. layuense was recovered from leaf lesions and its identity was confirmed by morphological and sequence analyses as described above. To our knowledge, E. layuense has been previously reported as a pathogen of Perilla sp. (Chen et al. 2017), oat (Avena sativa) (Chen et al. 2019), and tea (Camellia sinensis) plants (Chen et al. 2020), but this is the first report of E. layuense causing leaf spot on W. florida in China. This pathogen could pose a threat to the ornamental value of W. florida plants. Thus, it is necessary to adopt effective management strategies against leaf spot on W. florida.

scholarly journals First report of leaf spot disease caused by Stemphylium eturmiunum on American sweetgum (Liquidambar styraciflua L.) in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Yun-fei Mao ◽  
Li Jin ◽  
Huiyue Chen ◽  
Xiang-rong Zheng ◽  
Minjia Wang ◽  
...  
Keyword(s):  
Leaf Spot ◽  
Disease Incidence ◽  
Morphological Characteristics ◽  
Liquidambar Styraciflua ◽  
Leaf Spot Disease ◽  
Distilled Water ◽  
Conidial Suspension ◽  
First Report ◽  
Wood Processing ◽  
Light Yellow

American sweetgum (Liquidambar styraciflua L.) is an important tree for landscaping and wood processing. In recent years, leaf spots on American sweetgum with disease incidence of about 53% were observed in about 1200 full grown plants in a field (about 8 ha) located in Pizhou, Jiangsu Province, China. Initially, dense reddish-brown spots appeared on both old and new leaves. Later, the spots expanded into dark brown lesions with yellow halos. Symptomatic leaf samples from different trees were collected and processed in the laboratory. For pathogen isolation, leaf sections (4×4mm) removed from the lesion margin were surface sterilized with 75% ethanol for 20s and then sterilized in 2% NaOCl for 30s, rinsed three times in sterile distilled water, incubated on potato dextrose agar (PDA) at 25 °C in the darkness. After 5 days of cultivation, the pure culture was obtained by single spore separation. 6 isolate samples from different leaves named FXA1 to FXA6 shared nearly identical morphological features. The isolate FXA1 (codes CFCC 54675) was deposited in the China Center for Type Culture Collection. On the PDA, the colonies were light yellow with dense mycelium, rough margin, and reverse brownish yellow. Conidiophores (23–35 × 6–10 µm) (n=60) were solitary, straight to flexuous. Conidia (19–34 × 10–21 µm) (n=60) were single, muriform, oblong, mid to deep brown, with 1 to 6 transverse septa. These morphological characteristics resemble Stemphylium eturmiunum (Simmons 2001). Genomic DNA was extracted from mycelium following the CTAB method. The ITS region, gapdh, and cmdA genes were amplified and sequenced with the primers ITS5/ITS4 (Woudenberg et al. 2017), gpd1/gpd2 (Berbee et al. 1999), and CALDF1/CALDR2 (Lawrence et al. 2013), respectively. A maximum likelihood phylogenetic analysis based on ITS, gapdh and cmdA (accession nos. MT898502-MT898507, MT902342-MT902347, MT902336-MT902341) sequences using MEGA 7.0 revealed that the isolates were placed in the same clade as S. eturmiunum with 98% bootstrap support. All seedlings for pathogenicity tests were enclosed in plastic transparent incubators to maintain high relative humidity (90%-100%) and incubated in a greenhouse at 25°C with a 12-h photoperiod. For pathogenicity, the conidial suspension (105 spores/ml) of each isolate was sprayed respectively onto healthy leaves of L. styraciflua potted seedlings (2-year-old, 3 replicate plants per isolate). As a control, 3 seedlings were sprayed with sterile distilled water. After 7 days, dense reddish-brown spots were observed on all inoculated leaves. In another set of tests, healthy plants (3 leaves per plant, 3 replicate plants per isolate) were wound-inoculated with mycelial plugs (4×4mm) and inoculated with sterile PDA plugs as a control. After 7 days, brown lesions with light yellow halo were observed on all inoculation sites with the mycelial plugs. Controls remained asymptomatic in the entire experiment. The pathogen was reisolated from symptomatic tissues and identified as S. eturmiunum but was not recovered from the control. The experiment was repeated twice with the similar results, fulfilling Koch’s postulates. S. eturmiunum had been reported on tomato (Andersen et al. 2004), wheat (Poursafar et al. 2016), garlic (L. Fu et al. 2019) but not on woody plant leaves. To our knowledge, this is the first report of S. eturmiunum causing leaf spot on L. styraciflua in the world. This disease poses a potential threat to American sweetgum and wheat in Pizhou.

scholarly journals First Report of Alternaria spp. Causing Leaf Spot on Sweet Viburnum in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Chaodong Qiu ◽  
Yingying Zhang ◽  
Zhenyu Liu
Keyword(s):  
Leaf Spot ◽  
Genomic Dna ◽  
Morphological Characteristics ◽  
Leaf Spot Disease ◽  
Molecular Characteristics ◽  
Pathogenicity Test ◽  
Distilled Water ◽  
Single Spore ◽  
First Report ◽  
Sweet Viburnum

Sweet viburnum [Viburnum odoratissimum (L.) Ker Gawl] is an evergreen shrub mainly cultivated along roadsides in urban landscapes and also in parks and residential areas. A foliar disease occurred on about 40% of sweet viburnum plants near Anhui Grand Theatre, Anhui Province of China in June 2019. In early stages of sweet viburnum infection, the symptoms appeared as small brown spots ranged in length from 2 to 3 millimeters on the leaves. The spots developed on the upper, middle, and lower leaves of the plant, however, the upper leaves got more severely affected. As the disease develops, the spots enlarged and became rectangular or oval, brown to dark-brown, and their centers became ashen gray. In later stages of infection, the diseased leaves became wilting. Diseased leaves were surface disinfested and three small sections (2-3 mm2) were cut from the margin of the lesions. Sections were placed in 1.5% NaClO for 2 min, submerged in three changes of sterilized distilled water for 1 min each, placed onto potato dextrose agar (PDA) medium amended with 50 μg/ml of ampicillin and kanamycin, and incubated at 25℃ for 3 days. The mycelium from the leading edge of colonies growing from the tissue was sub-cultured onto a PDA plate for 3 days, followed by spore induction (Simmons 2007) and single spore isolation to obtain a pure culture of the putative pathogen. Colonies of one single spore isolate HF0719 were rounded, grayish white with dense aerial mycelium viewed from above and dark brown viewed from below. On potato carrot agar (PCA) medium, conidiophores were branched or occasionally unbranched. On branched conidiophores, conidia were in dwarf tree-like branched chains of 2-5 conidia. On unbranched conidiophores, conidia were simple or in chains of 2-8 conidia. Conidia were light brown or dark brown, ovoid, ellipsoidal to fusiform, and ranged in size from 7 to 26.5 × 4.5 to 11 μm with an average size of 16 × 7 µm based on 500 spore observations, with one beak and 1-7 transverse, 0-3 longitudinal, and 0-3 oblique septa. Beaks were ranged in (1.5-)2-10(-16) μm long. Based on cultural and morphological characteristics, isolate HF0719 was identified as Alternaria spp. (Simmons 2007). For molecular identification, total genomic DNA was isolated from mycelia collected from 7 day-old colonies of isolate HF0719 using the fungal genomic DNA extraction kit (Solarbio, Beijing, China). Fragments of five genes, including those encoding glyceraldehyde-3-phosphate dehydrogenase (gpd), plasma membrane ATPase, actin, calmodulin, and the Alternaria major allergen (Alt a1) regions of isolate HF0719 were amplified and sequenced using primer pairs gpd1/gpd2 (Berbee et al. 1999), ATPDF1/ATPDR1, ACTDF1/ACTDR1, CALDF1/CALDR1 (Lawrence et al. 2013), and Alt-for/Alt-rev (Hong et al. 2005), respectively. The obtained nucleotide sequences were deposited into GenBank as accession numbers: gpd, MT614365; ATPase, MT614364; actin, MT614363; calmodulin, MN706159; and Alt a1, MN304720. Phylogenetic tree using a maximum likelihood bootstrapping method based on the five-gene combined dataset in the following order: gpd, ATPase, actin, calmodulin, Alt a1 of HF0719 and standard strains representing 120 Alternaria species (Lawrence et al. 2013) was constructed. Isolate HF0719 formed a separate branch. On the basis of morphological characteristics and phylogenetic pattern, isolate HF0719 was identified as Alternaria spp.. A pathogenicity test was performed by rubbing 32 healthy leaves of six 5-year-old sweet viburnum plants with a cotton swab dipped in spore suspension containing 2.6 × 106 spores/ml, following leaf surface disinfection with 70% ethanol in the open field. Sterilized distilled water was used as control. The average air temperature was about 28℃ during the period of pathogenicity test. Eleven days after inoculation, 100% of inoculated leaves showed the leaf spot symptom identical to symptoms observed in the field. Control leaves were symptomless. The experiment was done three times. The re-isolated pathogen from the leaf lesion had the same morphological and molecular characteristics as isolate HF0719, thus satisfying Koch’s postulates. The genus Alternaria has been reported to cause leaf spot on sweet viburnum in Florida, USA (Alfieri et al. 1984). To our knowledge, this is the first report of Alternaria spp. causing leaf spot on sweet viburnum in China, a highly valued ornamental plant. Our findings will contribute to monitoring and adopting strategies for manage leaf spot disease on sweet viburnum.

scholarly journals First Report of Corynespora Leaf Spot Caused by Corynespora cassiicola on Gynura in China

Plant Disease ◽  
2014 ◽  
Vol 98 (7) ◽  
pp. 1007-1007 ◽  
Author(s):  
B. J. Li ◽  
J. X. Chuan ◽  
M. Yang ◽  
G. F. Du
Keyword(s):  
Leaf Spot ◽  
Disease Incidence ◽  
Morphological Characteristics ◽  
Its Region ◽  
Leaf Spot Disease ◽  
Herbaceous Plant ◽  
Distilled Water ◽  
Corynespora Cassiicola ◽  
Single Spore ◽  
First Report

Gynura (Gynura bicolor DC.) is a perennial herbaceous plant in the family Compositae. It is an important Chinese vegetable, and is commonly used as a Chinese herbal medicine. In 2010, a severe leaf spot disease was observed on gynura grown in the main production areas in Tong Nan County, Chongqing City, China. Some farms experienced 60% disease incidence. Symptoms usually began on the lower leaves, as circular to elliptical or irregular spots with concentric rings. Individual spots were dark brown with grayish centers, sometimes coalescing and leading to extensive necrosis. The fungus associated with lesions was characterized as follows: Conidiophores were single or in clusters, straight or flexuous, unbranched, percurrent, cylindrical, pale to dark brown, 87.5 to 375.0 μm long and 5.0 to 10.5 μm wide. Conidia were solitary or catenate, straight to slightly curved, obclavate to cylindrical, 3 to 14 pseudoseptate, 82.8 to 237.5 μm long and 7.0 to 7.8 μm wide, and pale brown. The morphological characteristics of the conidia and conidiophores agreed with the descriptions for Corynespora cassiicola (1). To isolate the causal pathogen, surface-sterilized tissue at the margin of lesions was immersed in 75% ethanol for 30 s, rinsed in sterile water, dried in a laminar flow bench, transferred to PDA, and incubated at 28°C. Four single-spore cultures of the isolates were obtained and named from ZBTK10110637 to ZBTK10110640. All strains were identified as C. cassiicola. The isolate ZBTK10110637 was selected as representative for molecular identification. Genomic DNA was extracted by CTAB (2). The internal transcribed spacer (ITS) region of the rDNA was amplified using primers with ITS1 (5′-TCCGATGGTGAACCTGCGG-3′) and ITS4 (5′-TCCTCCGCTTATTGATATGC-3′). Amplicons were 433 bp (GenBank Accession No. JX867272) and shared 100% similarity with that of C. cassiicola (NRC2-1 No. AB539285.1). To confirm pathogenicity, four isolates were used to inoculate 12 gynura plants (6 weeks old) by mist spray-inoculation with 108 spores/ml suspension in sterile distilled water on the leaves. Control plants were misted with sterile distilled water. After inoculation, all plants were incubated in a greenhouse maintained at 20 to 28°C with relative humidity of 80 to 85%. Five days after inoculation, dark brown spots with a grayish center typical of field symptoms were observed on all inoculated plants. No symptoms were seen on water-treated control plants. The fungus was re-isolated from inoculated plants. The morphological characteristics of isolates were identical with the pathogen recovered originally. This is the first report of C. cassiicola on gynura. References: (1) M. B. Ellis. CMI Mycological Papers 65(9):1-15, 1957. (2) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

scholarly journals First Report of Bacterial Leaf Spot on Snow Lotus Caused by Pseudomonas syringae in China

Plant Disease ◽  
2009 ◽  
Vol 93 (2) ◽  
pp. 204-204 ◽  
Author(s):  
S. F. Zhao ◽  
Y. N. Luo ◽  
H. Y. Zhao ◽  
J. Du ◽  
X. Y. Fang
Keyword(s):  
Pseudomonas Syringae ◽  
Leaf Spot ◽  
Unknown Etiology ◽  
Leaf Spot Disease ◽  
Sterile Water ◽  
Bacterial Leaf Spot ◽  
Saussurea Involucrata ◽  
First Report ◽  
Initial Symptoms ◽  
Snow Lotus

Snow lotus (Saussurea involucrata (Kar. & Kir.) Sch. Bip.) is an economically important medicinal herb increasingly grown in China in recent years. During the summer and autumn of 2005, 2006, and 2007, a necrosis of unknown etiology was observed on leaves in commercial production areas in Xinjiang Province of China. Disease incidence was approximately 40 to 50% of the plants during the 2005 and 2007 growing seasons. Initial symptoms consisted of pronounced water-soaked, dark brown-to-black spots that were 1 to 2 mm in diameter on young, expanding leaves. Later, some leaf spots on older leaves enlarged and coalesced, causing leaf desiccation. Leaf samples were collected in 2005, 2006, and 2007 from the affected hosts. Bacterial streaming was evident from these samples, and 28 strains were isolated on nutrient agar or King's medium B (KMB). All strains were gram negative and fluoresced bluegreen under UV light after 48 h of growth at 28°C on KMB. On the basis of LOPAT tests, the strains were identified as Pseudomonas syringae (1). The identity of two strains was confirmed by sequencing the 16S rDNA gene, which revealed 98% similarity to P. syringae strains in NCBI (Accession Nos. FJ001817 and FJ001818 for XJSNL 111 and 107, respectively). Infiltration of tobacco leaves with bacterial suspensions resulted in typical hypersensitivity reactions within 24 h. Pathogenicity of the strains was confirmed by spray inoculating five snow lotus leaves of a six-leaf stage plant with 108 CFU ml–1 bacterial suspensions in sterile water and five plants sprayed with sterile distilled water served as controls. Inoculated and sterile water-sprayed controls were maintained in the growth chamber with 90% relative humidity for 15 days at 15 ± 2°C. Symptoms similar to the original symptoms were observed on inoculated plants after 2 weeks. No symptoms developed on controls. Bacteria reisolated from inoculated plants were identified as strains of P. syringae. Isolates were deposited at the Key Laboratory for Oasis Crop Disease Prevention and Cure, Shihezi University. Rust caused by Puccinia carthami and leaf spot disease caused by Alternaria carthami of snow lotus have been reported (2,3). To our knowledge, this is the first report of P. syringae as the cause of bacterial leaf spot on snow lotus in China. References: (1) A. Braun-Kiewnick and D. C. Sands. Pseudomonas. Page 84 in: Laboratory Guide for the Identification of Plant Pathogenic Bacteria. 3rd ed. N. W. Schaad et al., eds. The American Phytopathological Society, St. Paul, MN, 2001. (2) S. Zhao et al. Plant Dis. 91:772, 2007. (3) S. Zhao et al. Plant Dis. 92:318, 2008.

scholarly journals First report of Epicoccum sorghinum causing leaf spot on Hemerocallis citrina in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Ya-ming Ma ◽  
Jin Lian Zhou ◽  
Zhao Hu ◽  
Jie Zhong ◽  
Jun Zi Zhu
Keyword(s):  
Leaf Spot ◽  
Morphological Characteristics ◽  
Molecular Techniques ◽  
Leaf Spot Disease ◽  
Pathogenicity Test ◽  
Distilled Water ◽  
First Report ◽  
Small Water ◽  
Ctab Method ◽  
Hemerocallis Citrina

Hemerocallis citrina Baroni, also called yellow flower vegetable (huang hua cai in Chinese), is belonging to the family Xanthorrhoeaceae and is widely planted in China, the Korea Peninsula and Japan for ornamental purposes and vegetable value. In addition, they could also be used as a traditional Chinese medicinal and modern medicinal plant (Du et al. 2014). In August 2019, a leaf spot disease was observed on H. citrina plants in Zhejiang Province of China, with approximately 85% incidence in almost 700 ha. Symptoms were firstly displayed as small, water-soaked, pale chlorotic spots, with yellow halos enlarged into large fusiform spots with brown edge and gray centers. Later, infected leaves were badly damaged and became wilted. Small pieces of infected tissue were excised from the margin of necrotic lesions, surface disinfected with 70% ethanol for 8s, 0.1% HgCl2 for 1 min, rinsed with sterile distilled water for three times, and incubated on potato dextrose agar (PDA, amended with 100 mg/L streptomycin sulfate) at 26°C in the dark. Fungal colonies with similar cultural morphology were consistently obtained from repeated isolations. When cultured on PDA, colonies were villose, regular, grayish-green, and turned gray-brown, with the reverse side became reddish-brown. Chlamydospores were gray, unicellular or multicellular, nearly spherical, 11 to 27 × 10 to 23 μm. Pycnidia and conidia were produced on PDA when the fungal colonies were exposed to ultraviolet light for 12 h with a distance of 40 cm to the late source. Pycnidia were brown, mostly spheroid, and measured 90 to 138 × 120 to 210 μm. Conidia were hyaline, ellipsoidal, unicellular, aseptate, 4.3 to 5.5 × 1.8 to 2.4 μm. These morphological characteristics agreed with the descriptions of Epicoccum sorghinum (Zhou et al. 2018). The DNA of a representative strain HHC6-2 was extracted using CTAB method and the rDNA internal transcribed spacer (ITS), actin (ACT) and β-tubulin (TUB) genes were amplified and sequenced, using the primers ITS4/ITS5 (White et al. 1990), ACT512F/ACT783R (Carbone and Kohn 1999) and Bt-1/Bt-2 (Glass and Donaldson 1995), respectively. BLASTn searches of the resulting ITS, ACT and TUB sequences (accession nos. MW073403, MW080522, MW080521) revealed 98.58 to 100% identity to the E. sorghinum sequences (MT125854, MN956831 and MF987525). The pathogenicity test was carried out by inoculation of potted H. citrina plants using conidial suspensions. H. citrina seedlings were planted in pots with sterilized soil. Before inoculation, leaves were surface-disinfected with 70% ethanol and sterile distilled water. Leaves were inoculated by placing small droplets of conidial suspensions (105 conidia/ml) on one side of the midvein, and 3 to 5 drops were used per leaf. Sterile water was used as control. All the inoculated plants were placed in humid chambers at 25°C for 48h, and then maintained in a greenhouse at 25°C with a 16 h day-8 h night cycle. The pathogenicity assays were performed twice with three replications. Four days after inoculation, yellow to brown spots resembling those observed in the fields developed on the inoculated leaves. However, no symptoms were observed on the controls. E. sorghinum was re-isolated and identified based on morphological and molecular techniques as described above. To our knowledge, this is the first report of E. sorghinum causing leaf spot on H. citrina. It seems to be a threat for H. citrina planting in China and should be considered in order to reduce losses caused by this disease. This study might provide the basis for diagnosis and control of the disease.

scholarly journals First Report of Bacterial Leaf Spot of Coriander Caused by Pseudomonas syringae pv. coriandricola in India

Plant Disease ◽  
2013 ◽  
Vol 97 (3) ◽  
pp. 418-418 ◽  
Author(s):  
M. Gupta ◽  
N. Bharat ◽  
A. Chauhan ◽  
A. Vikram
Keyword(s):  
Host Range ◽  
Pseudomonas Syringae ◽  
Leaf Spot ◽  
Molecular Techniques ◽  
Bacterial Suspension ◽  
Leaf Spot Disease ◽  
Rrna Gene ◽  
First Report ◽  
Leaf Spots ◽  
Initial Symptoms

A new disease was observed during the early spring of 2011 and 2012 on coriander (Coriandrum sativum L.) in the Himachal Pradesh state of India. Disease incidence was estimated as 10% in approximately 5 ha. Symptoms were observed as brown leaf spots (1 to 2 × 3 to 5 mm) surrounded by a water soaked area. The leaf spots were often angular, being limited by veins. Leaf spots merged to cause a more extensive blight. Symptomatic leaf tissues were surface sterilized in 0.1% HgCl2 for 30 sec followed by three successive rinses in sterilized water. Small sections of tissue were excised aseptically from leaf spot margins and transferred to several drops of sterile distilled water in a petri dish for 30 min. The diffusate was streaked onto King's B medium and incubated at 25°C for 24 to 48 h. Six representative strains of bacteria were isolated from five infected leaves. The bacteria were characterized as Gram negative, rod shaped, with few polar flagella and nonfluorescent on KB, and positive for levan production and tobacco hypersensitivity reaction but negative for oxidase reaction, rot of potato slices, and arginine dihydrolase. Preliminary identification of bacterial isolates was made on the basis of morphological and biochemical characters (3) and confirmed for one isolate by partial 16S rRNA gene sequencing. Using primers PF:5′AACTGAAGAGTTTGATCCTGGCTC3′ and PR:5′TACGGTTACCTTGTTACGACTT3′, a 1,265-bp DNA fragment of the 16S rDNA region was amplified. A BLAST search of this sequence (JX 156334) in the NCBI database placed the isolate in the genus Pseudomonas, with 99% similarity to accession P. syringae GRFHYTP52 (GQ160904). The sequence also showed 97% similarity to P. syringae pv. apii and P. syringae pv. coriandricola isolates from California (1). Identification of the bacterium to pathovar was based on host symptoms, fulfillment of Koch's postulates, cultural characteristics, physiological and determinative tests, and specificity of host range (2). Host range studies were conducted on celery, carrot, fennel, parsley, and parsnip, and no symptoms developed on any of these hosts. Pathogenicity was confirmed by artificial inoculation of five 1-month-old coriander plants with all isolates. A bacterial suspension (108 CFU ml–1) was injected into four leaves for each isolate with a hypodermic syringe and inoculated plants were placed in growth chamber at 25°C and 80% relative humidity. Initial symptoms were observed on leaves within 5 days of inoculation. No symptoms were observed on control plants inoculated with sterile water. Reisolation was performed on dark brown lesions surrounded by yellow haloes on the inoculated leaves and the identity of isolated bacteria was confirmed using the biochemical, pathogenicity, and molecular techniques stated above. All tests were performed three times. To our knowledge, this is the first report of P. syringae pv. coriandricola causing leaf spot disease on coriander in India. References: (1) Bull et al., Phytopathology 101:847, 2011. (2) Cerkauskas, Can. J. Plant Pathol. 31:16, 2009. (3) R. A. Lelliott and D. E. Stead, Methods for the Diagnosis of Bacterial Diseases of Plants, Blackwell Scientific, Sussex, UK, 1988.

Sign in / Sign up

Export Citation Format

Share Document