First Report of Paraphoma chrysanthemicola Causing Crown and Leaf Rot of Atractylodes lancea in China

Atractylodes lancea is an important traditional Chinese medicinal plant whose rhizome is used for treating complaints such as rheumatic diseases, digestive disorders, night blindness and influenza. Jiangsu Province is the optimal cultivation location for high-quality A. lancea rhizome. Since June 2019, symptoms of crown rot and leaf rot were observed in about 10-20% of the A. lancea in a plantation (31° 36' 1" N, 119° 6' 40" W) in Lishui, Jiangsu, China. Lesions occurred on the stem near the soil line and on the leaves (Fig. 1A). Disease incidence reached approximately 80-90% by September, 2021 (Fig. 1B) and resulted in severe loss of rhizome and seed yields. For pathogen isolation, ten samples of symptomatic stem segments and ten diseased leaves were collected, surface-sterilized using 5% NaClO solution, rinsed with sterile water, cut into 0.5-2 cm segments, and plated to potato dextrose agar (PDA), and then incubated at 30°C in darkness. Pure cultures of four isolates showing morphological characteristics of Paraphoma spp. were obtained, identified as a single P. chrysanthemicola strain, and named LSL3f2. Newly formed colonies initially consisted of white mycelia; the five-day-old colonies developed a layer of whitish grey mycelia with a grey underside. 20-day-old colonies had white mycelium along the margin and with a faint yellow inner circular part with irregular radial furrows, and the reverse side looking caramel and russet (Fig. 1C). Pycnidia were subglobose (diameter: 5 to 15 μm; Fig. 1D). Unicellular, bicellular or strings of globose or subglobose chlamydospores developed from hyphal cells (Fig. 1E and 1F). The internal transcribed spacer (ITS) region and large subulin-28S of LSL3f2 were cloned using primers ITS1/ITS4 and LR0R/LR7 (Aveskamp et al. 2010, Li et al. 2013), and deposited in GenBank (OK559658 and OK598973, respectively). BLASTn search and phylogenetic analysis showed the highest identity between LSL3f2 and P. chrysanthemicola sequences (Fig. 1G) and confirmed LSL3f2 as P. chrysanthemicola. Koch’s postulates were completed using one-month-old vegetatively propagated A. lancea plantlets growing on autoclaved vermiculite/peat mixture at 26°C with a light/dark cycle of 12/12 hours. Each plantlet was inoculated with 5 ml of conidial suspension in water (1 × 108 cfu/ml) by applying to soil close to the plantlet, with sterile water used as a mock control (n = 10). By 20 days post-inoculation, inoculated plantlets showed a range of disease symptoms consistent to those observed in infested fields (Fig. 1H). Pathogenicity was additionally confirmed using detached leaves inoculated with a colonized agar plug of LSL3f2 or an uninoculated control comparison (diameter = 5 mm) and incubated at 26℃ in the dark. Five to seven days post-inoculation, detached leaves showed leaf rot symptoms including lesions, yellowing and withering consistent with those in infested fields, while control leaves remained healthy (n = 10, Fig. 1I). The pathogen was reisolated from the diseased plantlets and detached leaves, in both cases demonstrating the micromorphological characteristics of LSL3f2. P. chrysanthemicola has been reported to cause leaf and crown rot on other plants such as Tanacetum cinerariifolium (Moslemi et al. 2018), and leaf spot on A. japonicain (Ge et al. 2016). However, this is the first report of P. chrysanthemicola causing crown and leaf rot on A. lancea in China.

Download Full-text

First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽

10.1094/pdis-01-21-0219-pdn ◽

2021 ◽

Author(s):

Nooreen Mamode Ally ◽

Hudaa Neetoo ◽

Mala Ranghoo-Sanmukhiya ◽

Shane Hardowar ◽

Vivian Vally ◽

...

Keyword(s):

Botrytis Cinerea ◽

Single Cells ◽

Disease Incidence ◽

Gray Mold ◽

Post Inoculation ◽

Conidial Suspension ◽

Sterile Water ◽

Susceptible Host ◽

Tomato Plants ◽

First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

Download Full-text

First Report on Ovate-leaf Atractylodes Damping-off Caused by Fusarium oxysporum species Complex in South Korea

Plant Disease ◽

10.1094/pdis-05-21-1107-pdn ◽

2021 ◽

Author(s):

Oliul Hassan ◽

Taehyun Chang

Keyword(s):

South Korea ◽

Fusarium Oxysporum ◽

Species Complex ◽

Disease Incidence ◽

Fusarium Species ◽

Morphological Characteristics ◽

Conidial Suspension ◽

Sterile Water ◽

Damping Off ◽

First Report

In South Korea, ovate-leaf atractylodes (OLA) (Atractylodes ovata) is cultivated for herbal medicine. During May to June 2019, a disease with damping off symptoms on OLA seedlings were observed at three farmer fields in Mungyeong, South Korea. Disease incidence was estimated as approximately 20% based on calculating the proportion of symptomatic seedlings in three randomly selected fields. Six randomly selected seedlings (two from each field) showing damping off symptoms were collected. Small pieces (1 cm2) were cut from infected roots, surface-sterilized (1 minute in 0.5% sodium hypochlorite), rinsed twice with sterile water, air-dried and then plated on potato dextrose agar (PDA, Difco, and Becton Dickinson). Hyphal tips were excised and transferred to fresh PDA. Six morphologically similar isolates were obtained from six samples. Seven-day-old colonies, incubated at 25 °C in the dark on PDA, were whitish with light purple mycelia on the upper side and white with light purple at the center on the reverse side. Macroconidia were 3–5 septate, curved, both ends were pointed, and were 19.8–36.62 × 3.3–4.7 µm (n= 30). Microconidia were cylindrical or ellipsoid and 5.5–11.6 × 2.5–3.8 µm (n=30). Chlamydospores were globose and 9.6 –16.3 × 9.4 – 15.0 µm (n=30). The morphological characteristics of present isolates were comparable with that of Fusarium species (Maryani et al. 2019). Genomic DNA was extracted from 4 days old cultures of each isolate of SRRM 4.2, SRRH3, and SRRH5, EF-1α and rpb2 region were amplified using EF792 + EF829, and RPB2-5f2 + RPB2-7cr primer sets, respectively (Carbone and Kohn, 1999; O'Donnell et al. 2010) and sequenced (GenBank accession number: LC569791- LC569793 and LC600806- LC600808). BLAST query against Fusarium loci sampled and multilocus sequence typing database revealed that 99–100% identity to corresponding sequences of the F. oxysporum species complex (strain NRRL 28395 and 26379). Maximum likelihood phylogenetic analysis with MEGA v. 6.0 using the concatenated sequencing data for EF-1α and rpb2 showed that the isolates belonged to F. oxysporum species complex. Each three healthy seedlings with similar sized (big flower sabju) were grown for 20 days in a plastic pot containing autoclaved peat soil was used for pathogenicity tests. Conidial suspensions (106 conidia mL−1) of 20 days old colonies per isolate (two isolates) were prepared in sterile water. Three pots per strain were inoculated either by pouring 50 ml of the conidial suspension or by the same quantity of sterile distilled water as control. After inoculation, all pots were incubated at 25 °C with a 16-hour light/8-hour dark cycle in a growth chamber. This experiment repeated twice. Inoculated seedlings were watered twice a week. Approximately 60% of the inoculated seedlings per strain wilted after 15 days of inoculation and control seedlings remained asymptomatic. Fusarium oxysporum was successfully isolated from infected seedling and identified based on morphology and EF-1α sequences data to confirm Koch’s postulates. Fusarium oxysporum is responsible for damping-off of many plant species, including larch, tomato, melon, bean, banana, cotton, chickpea, and Arabidopsis thaliana (Fourie et al. 2011; Hassan et al.2019). To the best of our knowledge, this is the first report on damping-off of ovate-leaf atractylodes caused by F. oxysporum in South Korea. This finding provides a basis for studying the epidemic and management of the disease.

Download Full-text

First Report of Crown Rot of Banana Caused by Fusarium porliferatum in Georgia, USA

Plant Disease ◽

10.1094/pdis-08-21-1809-pdn ◽

2021 ◽

Author(s):

Sumyya Waliullah ◽

Greg E. Fonsah ◽

Jason Brock ◽

Yonggang Li ◽

Emran Ali

Keyword(s):

Sequence Similarity ◽

Morphological Characteristics ◽

Fusarium Proliferatum ◽

Crown Rot ◽

Post Inoculation ◽

Conidial Suspension ◽

Banana Fruit ◽

Single Spore ◽

First Report ◽

Initial Symptoms

Crown rot is one of the most damaging disease of banana fruit characterized by rot and necrosis of crown tissues. In severe cases, the disease can spread to the pedicel and banana pulp. Crown rot can be infected by several common fungi, including Lasiodiplodia theobromae, Musicillium theobromae, Colletotrichum musae, and a complex of Fusarium spp. and lead to softening and blackening of tissues (Lassois et al., 2010; Kamel et al., 2016; Triest et al., 2016; Snowdon, 1990). In November 2020, typical crown rot of banana fruits (cv. Pisang Awak, belonging to the tetraploid AABB genome) were observed from UGA Banana Research 12 Plots, Tifton, GA, with incidence rates of 15%. Initial symptoms appeared in the infected crown of green banana fruits. As the infection progressed, the crown tissues became blackened and softened, followed by an internal development of infection affecting the peduncle and the fruit, triggered early ripening of bananas. At last, the development of necrosis on the pedicels and fruits appeared and caused the fingers to fall off. To identify the pathogen, tissue pieces (~0.25 cm2) from the infected crown and pedicles were surface-sterilized in a 10% bleach solution for 1 min, followed by 30 s in 70% EtOH. The disinfected tissues were rinsed in sterile water 3 times and cultured on potato dextrose agar (PDA) amended with 50 µg/ml streptomycin at 25°C in the dark for 5–10 days. Isolates of the pathogen were purified using the single-spore isolation method (Leslie and Summerell 2006). Colonies on PDA produced fluffy aerial mycelium and developed an intense purple pigment when viewed from the underside. A range of colony pigmentation and growth rates were observed among the isolates. The microconidia were ovoid, hyaline, or ellipse in shape. The morphological features of the isolates were identified as Fusarium proliferatum (Leslie and Summerell, 2006). To further identify the isolates, genomic DNA was extracted from a representative isolate. And the internal transcribed spacer (ITS) region, the partial elongation factor (TEF1-α) gene and the β-tubulin gene (TUB2)were amplified and sequenced using the primers ITS1/ITS4 (Yin et al. 2012), EF-1 /EF-2 (O’Donnell et al. 1998) and B-tub1 /B-tub2 (O’Donnell and Cigelnik, 1997), respectively. The amplicons were sequenced and deposited in NCBI (accessions no. MZ292989, MZ293071 for ITS: MZ346602, MZ346603 for TEF1-α and MZ346600 and MZ346601 for B-tub). The ITS, TEF1-α, and B-tub sequences of the isolates showed 100% sequence similarity with Fusarium proliferatum isolates (accessions no. MT560212, LS42312, and LT575130, respectively) using BLASTn in Genbank. For pathogenicity testing, three whole bunched bananas sterilized with 10% bleach solutions and washed by sterilized water, were cut into 5 bananas per brunch. The cut surface of the banana crown was inoculated with conidial suspension (1.0 × 107 cfu/ml) of the pathogen with pipette tips. Equal number of bananas were treated with sterilized water in the same volume as a control. All bananas were sealed in a plastic bag and incubated at 25°C. After 7 days post inoculation, all inoculated bananas showed initial crown rot symptoms while no symptoms were observed on the control bananas. The fungus was re-isolated from the symptomatic tissues of infected bananas and confirmed to be genetically identical to F. proliferatum of the original inoculated strains according to morphological characteristics and molecular identification, fulfilling Koch’s postulates. To the best of our knowledge, this is the first report of F. proliferatum causing crown rot on bananas in Georgia, USA.

Download Full-text

First Report of Foliar and Stem Blight on Sunflower Caused by Alternaria helianthiinficiens in Croatia

Plant Disease ◽

10.1094/pdis-05-12-0512-pdn ◽

2012 ◽

Vol 96 (11) ◽

pp. 1698-1698 ◽

Cited By ~ 1

Author(s):

K. Vrandečić ◽

D. Jurković ◽

J. Ćosić ◽

I. Stanković ◽

A. Vučurović ◽

...

Keyword(s):

Disease Incidence ◽

Pathogenic Fungus ◽

Morphological Characteristics ◽

Its Region ◽

Nucleotide Identity ◽

Oilseed Crop ◽

Conidial Suspension ◽

First Report ◽

Stem Blight ◽

Detached Leaves

Sunflower (Helianthus annus L.) is the most important oilseed crop in Croatia. In August 2009, in six localities of eastern Croatia, severe foliar and stem blight symptoms were observed on several genotypes with disease incidence ranging from 10 to 50%. At the initial stage of the infection, irregular to oval, brown spots different in size, surrounded by a chlorotic halo, appeared on the leaves that gradually became enlarged and coalesced, and whole leaves turned yellow and necrotic, followed by defoliation. Lesions on the stems were light to dark brown, randomly distributed, rounded and tapered on the ends; later becoming large and elongated causing stem breakage. Tissue within the lesion was reddish on the cross section. To determine the causal agent, small pieces of symptomatic leaves and stem tissue of sunflower were surface disinfested and placed on potato dextrose agar. A total of 17 isolates from leaves as well as six from stems were obtained and all formed cottony, dark olivaceous to black colonies under 12 h of fluorescent light per day. All isolates formed uniform solitary, pale brown to brown, long ovoid conidia with five to eight transverse and one to two longitudinal septa. The conidia of all isolates were slightly constricted at the transverse septa, measuring 55 to 90 × 14 to 20 μm. Based on the morphological characteristics, the pathogen was identified as Alternaria helianthiinficiens E.G. Simmons, Walcz & R.G. Roberts (4). The pathogenicity was tested with one representative isolate (Alt5) by injection of a conidial suspension (106 conidia/ml) into stems of 20 healthy sunflower seedlings and by spraying 20 non-wounded detached leaves with a suspension of spores. Small necrotic spots on all inoculated seedlings and leaves formed 5 and 9 days after inoculation, respectively. The control sunflower seedlings and detached leaves, inoculated with sterile water, showed no reactions. The identity of isolate Alt5 was futher confirmed by amplification and sequencing of the internal transcribed spacer (ITS) region of rDNA. Because there are no available corresponding ITS sequences of A. helianthiinficiens in the GenBank, reference type strain CBS 208.86 (publicly purchased, CBS, Utrecht, Netherlands) was also sequenced in this study. Total DNA was extracted directly from fungal mycelium and PCR amplification and sequencing were performed with primers ITS1F/ITS4. Sequence analysis of ITS region revealed 100% nucleotide identity between isolate Alt5 (GenBank Accession No. JX101648) and isolate CBS 208.86 (GenBank Accession No. JX101649). The nucleotide identity of both isolates compared with A. helianthi (HM449991), another sunflower pathogenic fungus, was only 80%. A. helianthiinficiens has previously been reported on sunflower in Hungary and the USA (3), Serbia (1), and Korea (2). However, to our knowledge, this is the first report of A. helianthiinficiens occurrence in Croatia as a new and harmful parasite of sunflower, illustrating an expansion of its geographical range and underscoring the need for phytosanitary control because it is a seedborne fungus. References: (3) M. Aćimović and N. Lačok. Helia 14:129, 1991. (4) H. S. Cho and S. H. Yu. Plant Pathol. J. 16:331, 2000. (2) E. G. Simmons. Mycotaxon 25:203, 1986. (1) E. G. Simmons. Alternaria: An Identification Manual. CBS Fungal Biodiversity Centre, Utrecht, the Netherlands, 2007.

Download Full-text

First Report of Crown Rot of Grafted Cucumber Caused by Fusarium solani in China

Plant Disease ◽

10.1094/pdis-03-10-0217 ◽

2010 ◽

Vol 94 (11) ◽

pp. 1377-1377 ◽

Cited By ~ 2

Author(s):

B.-J. Li ◽

Y. Liu ◽

Y.-X. Shi ◽

X.-W. Xie ◽

Y.-L. Guo

Keyword(s):

Disease Incidence ◽

Apical Cell ◽

Morphological Characteristics ◽

Crown Rot ◽

Liaoning Province ◽

Economic Losses ◽

Peat Moss ◽

Conidial Suspension ◽

Internal Transcribed Spacer Region ◽

First Report

Grafting has been widely and effectively used in cucumber (Cucumis sativus) cultivation for approximately 30 years in China to avoid Fusarium wilt caused by Fusarium oxysporum Schl. f. sp. cucumerinum Owen. In greenhouses, 90% of cucumbers are grafted onto pumpkin (Cucurbita moschata) rootstock. However, in March 2009, a severe crown rot causing yellowing and wilting of the leaves was observed on grafted cucumber in a large number of greenhouses in Lingyuan, western Liaoning Province in China. Symptoms consisted of dark brown, water-soaked lesions and a dense, white mycelial mat at the base of the stem. Lingyuan is the largest district for cucumber cultivation using grafting techniques in solar greenhouses in China. In 30 surveyed greenhouses in Sanshijiazi Village in the city of Lingyuan, the incidence of affected plants ranged from 10 to 40%, which caused serious economic losses. Fusarium spp. were isolated from the surface-sterilized basal stems of symptomatic plants on potato dextrose agar and incubated on potato sucrose agar for 4 days at 25°C. Colonies of the isolates produced a brown pigmentation and sparse, aerial mycelia, with a cream color on the underside. Conidiophores were elongated and branched or unbranched. Microconidia were abundant, hyaline, ellipsoid to ovoid, and 6 to 14 × 2.5 to 3.5 μm. Macroconidia were cylindrical, abundant, mostly two to six septate, 22 to 63 × 3.2 to 5.0 μm, with the apical cell rounded and blunt, and the basal cell rounded. On the basis of morphological characteristics, the fungus was identified as F. solani (C. Booth). For confirmation, the internal transcribed spacer region of rDNA was amplified and sequenced. A 449-bp sequence shared 99% homology with that of a F. solani GenBank accession previously reported from Japan (No. AF150473.1). The new sequence was deposited in GenBank (Accession No. HM015882). Pathogenicity of three isolates was determined in two experiments using different methods of inoculation. In one, 30 seedlings of pumpkin (C. moschata) with one true leaf each were inoculated by dipping their roots in a suspension of 106 spores ml–1, while control plants were mock inoculated with sterile water. Plants were then potted in a sterile mix of peat moss and vermiculite (2:1 vol/vol). In the other, pregerminated pumpkin seeds were sown in the same medium with a conidial suspension added at a rate of 106 spores ml–1, while other seeds were sown in sterile soil as controls. Plants for both experiments were maintained in a greenhouse at 25°C. Twelve days after inoculation, inoculated plants in both experiments showed a cortical rot on the crown and stem base with a brown, water-soaked appearance. Twenty-one days later, inoculated plants developed wilting and yellowed leaves. Disease incidence was 100%. No symptoms occurred on the control plants. Both experiments were repeated once with the same results. The pathogen was recovered from symptomatic tissue, confirming Koch's postulates. F. solani has been previously reported to cause root rot on cucurbit in California (2) and crown rot on grafted cucumber in the Netherlands (1). To our knowledge, this is the first report of crown rot of grafted cucumber caused by F. solani in China. References: (1) L. C. P. Kerling and L. Bravenboer. Neth. J. Plant Pathol. 73:15, 1967. (2) T. A. Tousson and W. C. Snyder. Phytopathology 51:17, 1961.

Download Full-text

First Report of Leaf Spot caused by Bipolaris oryzae on Switchgrass in Tennessee

Plant Disease ◽

10.1094/pdis-01-13-0070-pdn ◽

2013 ◽

Vol 97 (12) ◽

pp. 1654-1654 ◽

Cited By ~ 3

Author(s):

A. L. Vu ◽

M. M. Dee ◽

J. Zale ◽

K. D. Gwinn ◽

B. H. Ownley

Keyword(s):

Leaf Spot ◽

Panicum Virgatum ◽

Morphological Characteristics ◽

Its Region ◽

Spore Production ◽

Post Inoculation ◽

Sterile Water ◽

Bipolaris Oryzae ◽

First Report ◽

Symptomatic Leaf

Knowledge of pathogens in switchgrass, a potential biofuels crop, is limited. In December 2007, dark brown to black irregularly shaped foliar spots were observed on ‘Alamo’ switchgrass (Panicum virgatum L.) on the campus of the University of Tennessee. Symptomatic leaf samples were surface-sterilized (95% ethanol, 1 min; 20% commercial bleach, 3 min; 95% ethanol, 1 min), rinsed in sterile water, air-dried, and plated on 2% water agar amended with 3.45 mg fenpropathrin/liter (Danitol 2.4 EC, Valent Chemical, Walnut Creek, CA) and 10 mg/liter rifampicin (Sigma-Aldrich, St. Louis, MO). A sparsely sporulating, dematiaceous mitosporic fungus was observed. Fungal plugs were transferred to surface-sterilized detached ‘Alamo’ leaves on sterile filter paper in a moist chamber to increase spore production. Conidia were ovate, oblong, mostly straight to slightly curved, and light to olive-brown with 3 to 10 septa. Conidial dimensions were 12.5 to 17 × 27.5 to 95 (average 14.5 × 72) μm. Conidiophores were light brown, single, multiseptate, and geniculate. Conidial production was polytretic. Morphological characteristics and disease symptoms were similar to those described for Bipolaris oryzae (Breda de Haan) Shoemaker (2). Disease assays were done with 6-week-old ‘Alamo’ switchgrass grown from seed scarified with 60% sulfuric acid and surface-sterilized in 50% bleach. Nine 9 × 9-cm square pots with approximately 20 plants per pot were inoculated with a mycelial slurry (due to low spore production) prepared from cultures grown on potato dextrose agar for 7 days. Cultures were flooded with sterile water and rubbed gently to loosen mycelium. Two additional pots were inoculated with sterile water and subjected to the same conditions to serve as controls. Plants were exposed to high humidity by enclosure in a plastic bag for 72 h. Bags were removed, and plants were incubated at 25/20°C with 50 to 60% relative humidity. During the disease assay, plants were kept in a growth chamber with a 12-h photoperiod of fluorescent and incandescent lighting. Foliar leaf spot symptoms appeared 5 to 14 days post-inoculation for eight of nine replicates. Control plants had no symptoms. Symptomatic leaf tissue was processed and plated as described above. The original fungal isolate and the pathogen recovered in the disease assay were identified using internal transcribed spacer (ITS) region sequences. The ITS region of rDNA was amplified with PCR and primer pairs ITS4 and ITS5 (4). PCR amplicons of 553 bp were sequenced, and sequences from the original isolate and the reisolated pathogen were identical (GenBank Accession No. JQ237248). The sequence had 100% nucleotide identity to B. oryzae from switchgrass in Mississippi (GU222690, GU222691, GU222692, and GU222693) and New York (JF693908). Leaf spot caused by B. oryzae on switchgrass has also been described in North Dakota (1) and was seedborne in Mississippi (3). To our knowledge, this is the first report of B. oryzae from switchgrass in Tennessee. References: (1) D. F. Farr and A. Y. Rossman. Fungal Databases. Systematic Mycology and Microbiology Laboratory, ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/, 28 June 2012. (2) J. M. Krupinsky et al. Can. J. Plant Pathol. 26:371, 2004. (3) M. Tomaso-Peterson and C. J. Balbalian. Plant Dis. 94:643, 2010. (4) T. J. White et al. Pages 315-322 in: PCR Protocols: a Guide to Methods and Applications. M. A. Innis et al. (eds), Acad. Press, San Diego, 1990.

Download Full-text

First report of banana (Musa acuminate L. AAA Cavendish, cv. Formosana) leaf spot disease caused by Curvularia geniculata in China

Plant Disease ◽

10.1094/pdis-09-21-2001-pdn ◽

2021 ◽

Author(s):

Yanxiang Qi ◽

Yanping Fu ◽

Jun Peng ◽

Fanyun Zeng ◽

Yanwei Wang ◽

...

Keyword(s):

Leaf Spot ◽

Disease Incidence ◽

Morphological Characteristics ◽

Universal Primers ◽

Leaf Spot Disease ◽

Leaf Margin ◽

Conidial Suspension ◽

Tropical Fruit ◽

First Report ◽

Spot Disease

Banana (Musa acuminate L.) is an important tropical fruit in China. During 2019-2020, a new leaf spot disease was observed on banana (M. acuminate L. AAA Cavendish, cv. Formosana) at two orchards of Chengmai county (19°48ʹ41.79″ N, 109°58ʹ44.95″ E), Hainan province, China. In total, the disease incidence was about 5% of banana trees (6 000 trees). The leaf spots occurred sporadically and were mostly confined to the leaf margin, and the percentage of the leaf area covered by lesions was less than 1%. Symptoms on the leaves were initially reddish brown spots that gradually expanded to ovoid-shaped lesions and eventually become necrotic, dry, and gray with a yellow halo. The conidia obtained from leaf lesions were brown, erect or curved, fusiform or elliptical, 3 to 4 septa with dimensions of 13.75 to 31.39 µm × 5.91 to 13.35 µm (avg. 22.39 × 8.83 µm). The cells of both ends were small and hyaline while the middle cells were larger and darker (Zhang et al. 2010). Morphological characteristics of the conidia matched the description of Curvularia geniculata (Tracy & Earle) Boedijn. To acquire the pathogen, tissue pieces (15 mm2) of symptomatic leaves were surface disinfected in 70% ethanol (10 s) and 0.8% NaClO (2 min), rinsed in sterile water three times, and transferred to potato dextrose agar (PDA) for three days at 28°C. Grayish green fungal colonies appeared, and then turned fluffy with grey and white aerial mycelium with age. Two representative isolates (CATAS-CG01 and CATAS-CG92) of single-spore cultures were selected for molecular identification. Genomic DNA was extracted from the two isolates, the internal transcribed spacer (ITS), large subunit ribosomal DNA (LSU rDNA), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), translation elongation factor 1-alpha (TEF1-α) and RNA polymerase II second largest subunit (RPB2) were amplified and sequenced with universal primers ITS1/ITS4, LROR/LR5, GPD1/GPD2, EF1-983F/EF1-2218R and 5F2/7cR, respectively (Huang et al. 2017; Raza et al. 2019). The sequences were deposited in GenBank (MW186196, MW186197, OK091651, OK721009 and OK491081 for CATAS-CG01; MZ734453, MZ734465, OK091652, OK721100 and OK642748 for CATAS-CG92, respectively). For phylogenetic analysis, MEGA7.0 (Kumar et al. 2016) was used to construct a Maximum Likelihood (ML) tree with 1 000 bootstrap replicates, based on a concatenation alignment of five gene sequences of the two isolates in this study as well as sequences of other Curvularia species obtained from GenBank. The cluster analysis revealed that isolates CATAS-CG01 and CATAS-CG92 were C. geniculata. Pathogenicity assays were conducted on 7-leaf-old banana seedlings. Two leaves from potted plants were stab inoculated by puncturing into 1-mm using a sterilized needle and placing 10 μl conidial suspension (2×106 conidia/ml) on the surface of wounded leaves and equal number of leaves were inoculated with sterile distilled water serving as control (three replicates). Inoculated plants were grown in the greenhouse (12 h/12 h light/dark, 28°C, 90% relative humidity). Necrotic lesions on inoculated leaves appeared seven days after inoculation, whereas control leaves remained healthy. The fungus was recovered from inoculated leaves, and its taxonomy was confirmed morphologically and molecularly, fulfilling Koch’s postulates. C. geniculata has been reported to cause leaf spot on banana in Jamaica (Meredith, 1963). To our knowledge, this is the first report of C. geniculata on banana in China.

Download Full-text

First Report of Fruit Rot of Melon Caused by Fusarium asiaticum in China

Plant Disease ◽

10.1094/pdis-08-20-1857-pdn ◽

2020 ◽

Author(s):

Fangmin Hao ◽

Quanyu Zang ◽

Weihong Ding ◽

Erlei Ma ◽

Yunping Huang ◽

...

Keyword(s):

Disease Incidence ◽

Elongation Factor ◽

Morphological Characteristics ◽

Its Region ◽

Fruit Rot ◽

Post Inoculation ◽

Basal Cells ◽

First Report ◽

Fusarium Asiaticum ◽

Sterile Needle

Melon (Cucumis melo L.) is a member of the Cucurbitaceae family, an important economical and horticultural crop, which is widely grown in China. In May 2020, fruit rot disease with water-soaked lesions and pink molds on cantaloupe melons was observed in several greenhouses with 50% disease incidence in Ningbo, Zhejiang Province in China. In order to know the causal agent, diseased fruits were cut into pieces, surface sterilized for 1 min with 1% sodium hypochlorite (NaClO), 2 min with 75% ethyl alcohol, rinsed in sterile distilled water three times (Zhou et al. 2018), and then placed on potato dextrose agar (PDA) medium amended with streptomycin sulfate (100 μg/ml) plates at 25°C for 4 days. The growing hyphae were transferred to new PDA plates using the hyphal tip method, putative Fusarium colonies were purified by single-sporing. Twenty-five fungal isolates were obtained and formed red colonies with white aerial mycelia at 25°C for 7 days, which were identified as Fusarium isolates based on the morphological characteristics and microscopic examination. The average radial mycelial growth rate of Fusarium isolate Fa-25 was 11.44 mm/day at 25°C in the dark on PDA. Macroconidia were stout with curved apical and basal cells, usually with 4 to 6 septa, and 29.5 to 44.2 × 3.7 to 5.2 μm on Spezieller Nährstoffarmer agar (SNA) medium at 25°C for 10 days (Leslie and Summerell 2006). To identify the species, the internal transcribed spacer (ITS) region and translational elongation factor 1-alpha (TEF1-α) gene of the isolates were amplified and cloned. ITS and TEF1-α was amplified using primers ITS1/ITS4 and EF1/EF2 (O’Donnell et al. 1998), respectively. Sequences of ITS (545 bp, GenBank Accession No. MT811812) and TEF1-α (707 bp, GenBank Acc. No. MT856659) for isolate Fa-25 were 100% and 99.72% identical to those of F. asiaticum strains MSBL-4 (ITS, GenBank Acc. MT322117.1) and Daya350-3 (TEF1-α, GenBank Acc. KT380124.1) in GenBank, respectively. A phylogenetic tree was established based on the TEF1-α sequences of Fa-25 and other Fusarium spp., and Fa-25 was clustered with F. asiaticum. Thus, both morphological and molecular characterizations supported the isolate as F. asiaticum. To confirm the pathogenicity, mycelium agar plugs (6 mm in diameter) removed from the colony margin of a 2-day-old culture of strain Fa-25 were used to inoculate melon fruits. Before inoculation, healthy melon fruits were selected, soaked in 2% NaClO solution for 2 min, and washed in sterile water. After wounding the melon fruits with a sterile needle, the fruits were inoculated by placing mycelium agar plugs on the wounds, and mock inoculation with mycelium-free PDA plugs was used as control. Five fruits were used in each treatment. The inoculated and mock-inoculated fruits were incubated at 25°C with high relative humidity. Symptoms were observed on all inoculated melon fruits 10 days post inoculation, which were similar to those naturally infected fruits, whereas the mock-inoculated fruits remained symptomless. The fungus re-isolated from the diseased fruits resembled colony morphology of the original isolate. The experiment was conducted three times and produced the same results. To our knowledge, this is the first report of fruit rot of melon caused by F. asiaticum in China.

Download Full-text

First report of Alternaria alternata causing leaf blight on little millet (Panicum sumatrense) in India.

Plant Disease ◽

10.1094/pdis-06-20-1373-pdn ◽

2020 ◽

Author(s):

Boda Praveen ◽

A. Nagaraja ◽

M. K. Prasanna Kumar ◽

Devanna Pramesh ◽

K. B. Palanna ◽

...

Keyword(s):

Crop Yields ◽

Disease Incidence ◽

Leaf Blight ◽

Post Inoculation ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Pcr Assay ◽

Causal Organism ◽

First Report ◽

Little Millet

Little millet (LM) is a minor cereal crop grown in the Indian sub-continent. During October 2018, dark brown, circular to oval necrotic spots surrounded by concentric rings were observed on the upper leaf surface of the LM (cv. VS-13) grown in the fields of the University of Agricultural Sciences, Bengaluru, India (13.0784oN, 77.5793oE). As the disease progressed, infected leaves became blighted. Disease incidence up to 53% was recorded in 3 fields of 0.4-hectare area each. Thirty symptomatic leaves were collected to isolate the associated causal organism. The margins of diseased tissue were cut into 5 × 5-mm pieces, surface-sterilized in 75% ethanol for 45 seconds followed by 1% sodium hypochlorite for 1 min, finally rinsed in sterile distilled water five times and placed on PDA. After 7 days of incubation at 25°C, greyish fungal colonies appeared on PDA. Single-spore isolations were performed to obtain ten isolates. Pure cultures of the fungus initially produced light gray aerial mycelia that later turned to dark grey. All isolates formed obclavate to pyriform conidia measured 22.66-48.97μm long and 6.55-13.79µm wide with 1-3 longitudinal and 2-7 transverse septa with a short beak (2.55-13.26µm) (n=50). Based on the conidial morphology, the fungus was identified as Alternaria sp. Further, the taxonomic identity of all ten isolates was confirmed as A. alternata using species-specific primers (AAF2/AAR3, Konstantinova et al. 2002) in a PCR assay. Later, one of the isolate UASB1 was selected, and its internal transcribed spacer (ITS) region, glyceraldehyde-3-phosphate dehydrogenase (gapdh), major allergen Alt a 1 (Alt a 1), major endo-polygalacturonase (endoPG), OPA10-2, and KOG1058 genes were amplified in PCR (White et al. 1990; Berbee et al. 1999; Woudenberg et al. 2015), and the resultant products were sequenced and deposited in the NCBI GenBank (ITS, MN919390; gapdh, MT637185; Alt a 1, MT882339; endoPG, MT882340; OPA10-2, MT882341; KOG1058, MT882342). Blastn analysis of ITS, gapdh, Alt a 1, endoPG, OPA10-2, KOG1058 gene sequences showed 99.62% (with AF347031), 97.36% (with AY278808), 99.58% (with AY563301), 99.10% (with JQ811978), 99.05% (with KP124632) and 99.23% (with KP125233) respectively, identity with reference strain CBS916.96 of A. alternata, confirming UASB1 isolate to be A. alternata. For pathogenicity assay, conidial suspension of UASB1 isolate was spray inoculated to ten healthy LM (cv. VS-13) plants (45 days old) maintained under protected conditions. The spore suspension was sprayed until runoff on healthy leaves, and ten healthy plants sprayed with sterile water served as controls. Later, all inoculated and control plants were covered with transparent polyethylene bags and were maintained in a greenhouse at 28±2 ◦C and 90% RH. The pathogenicity test was repeated three times. After 8 days post-inoculation, inoculated plants showed leaf blight symptoms as observed in the field, whereas no disease symptoms were observed on non-inoculated plants. Re-isolations were performed from inoculated plants, and the re-isolated pathogen was confirmed as A. alternata based on morphological and PCR assay (Konstantinova et al. 2002). No pathogens were isolated from control plants. There is an increasing acreage of LM crop in India, and this first report indicates the need for further studies on leaf blight management and the disease impacts on crop yields.

Download Full-text

First Report of Colletotrichum siamense Causing Anthracnose of Monstera deliciosa in Zhanjiang, China

Plant Disease ◽

10.1094/pdis-08-20-1839-pdn ◽

2020 ◽

Author(s):

Yue Lian Liu ◽

Jian Rong Tang ◽

Yu Han Zhou

Keyword(s):

Disease Incidence ◽

Morphological Characteristics ◽

Pathogenicity Test ◽

Sterile Water ◽

Single Spore ◽

First Report ◽

Rdna Its ◽

Colletotrichum Siamense ◽

Monstera Deliciosa ◽

Pure Cultures

Monstera deliciosa Liebm is an ornamental foliage plant (Zhen et al. 2020De Lojo and De Benedetto 2014). In July of 2019, anthracnose lesions were observed on leaves of M. deliciosa cv. Duokong with 20% disease incidence of 100 plants at Guangdong Ocean University campus (21.17N,110.18E), Guangdong Province, China. Initially affected leaves showed chlorotic spots, which coalesced into larger irregular or circular lesions. The centers of spots were gray with a brown border surrounded by a yellow halo (Supplementary figure 1). Twenty diseased leaves were collected for pathogen isolation. Margins of diseased tissue was cut into 2 × 2 mm pieces, surface-disinfected with 75% ethanol for 30 s and 2% sodium hypochlorite (NaOCl) for 60 s, rinsed three times with sterile water before isolation. Potato dextrose agar (PDA) was used to culture pathogens at 28℃ in dark. Successively, pure cultures were obtained by transferring hyphal tips to new PDA plates. Fourteen isolates were obtained from 20 leaves. Three single-spore isolates (PSC-1, PSC-2, and PSC-3) were obtained ,obtained, which were identical in morphology and molecular analysis (ITS). Therefore, the representative isolate PSC-1 was used for further study. The culture of isolate PSC-1 on PDA was initially white and later became cottony, light gray in 4 days, at 28 °C. Conidia were single celled, hyaline, cylindrical, clavate, and measured 13.2 to 18.3 µm × 3.3 to 6.5 µm (n = 30). Appressoria were elliptical or subglobose, dark brown, and ranged from 6.3 to 9.5 µm × 5.7 to 6.5 µm (n = 30). Morphological characteristics of isolate PSC-1 were consistent with the description of Colletotrichum siamense (Prihastuti et al. 2009; Sharma et al. 2013). DNA of the isolate PSC-1 was extracted for PCR sequencing using primers for the rDNA ITS (ITS1/ITS4), GAPDH (GDF1/GDR1), ACT (ACT-512F/ACT-783R), CAL (CL1C/CL2C), and TUB2 (βT2a/βT2b) (Weir et al. 2012). Analysis of the ITS (accession no. MN243535), GAPDH (MN243538), ACT (MN512640), CAL (MT163731), and TUB2 (MN512643) sequences revealed a 97-100% identity with the corresponding ITS (JX010161), GAPDH (JX010002), ACT (FJ907423), CAL (JX009714) and TUB2 (KP703502) sequences of C. siamense in GenBank. A phylogenetic tree was generated based on the concatenated sequences of ITS, GAPDH, ACT, CAL, and TUB2 which clustered the isolate PSC-1 with C. siamense the type strain ICMP 18578 (Supplementary figure 2). Based on morphological characteristics and phylogenetic analysis, the isolate PSC-1 associated with anthracnose of M. deliciosa was identified as C. siamense. Pathogenicity test was performed in a greenhouse at 24 to 30oC with 80% relative humidity. Ten healthy plants of cv. Duokong (3-month-old) were grown in pots with one plant in each pot. Five plants were inoculated by spraying a spore suspension (105 spores ml-1) of the isolate PSC-1 onto leaves until runoff, and five plants were sprayed with sterile water as controls. The test was conducted three times. Anthracnose lesions as earlier were observed on the leaves after two weeks, whereas control plants remained symptomless. The pathogen re-isolated from all inoculated leaves was identical to the isolate PSC-1 by morphology and ITS analysis, but not from control plants. C. gloeosporioides has been reported to cause anthracnose of M. deliciosa (Katakam, et al. 2017). To the best of our knowledge, this is the first report of C. siamense causing anthracnose on M. deliciosa in ChinaC. siamense causes anthracnose on a variety of plant hosts, but not including M. deliciosa (Yanan, et al. 2019). To the best of our knowledge, this is the first report of C. siamense causing anthracnose on M. deliciosa, which provides a basis for focusing on the management of the disease in future.

Download Full-text