scholarly journals First Report of Longidorus breviannulatus Associated with Damage on Creeping Bentgrass Golf Greens in Québec, Canada

Plant Disease ◽  
2009 ◽  
Vol 93 (8) ◽  
pp. 846-846 ◽  
Author(s):  
L. Simard ◽  
G. Bélair ◽  
S. Miller
Keyword(s):  
Management Practices ◽  
Creeping Bentgrass ◽  
Soil Samples ◽  
Parasitic Nematodes ◽  
Morphological Examination ◽  
Oral Aperture ◽  
Golf Greens ◽  
First Report ◽  
Dry Soil ◽  
Plant Parasitic

Creeping bentgrass, Agrostis stolonifera L., is the most important turfgrass species cultivated on golf greens in Canada. The needle nematode, Longidorus breviannulatus Norton & Hoffman, has several plant hosts including Gramineae such as corn, Zea mays L. (3), and creeping bentgrass (1). This large, plant-parasitic nematode is found most frequently in sandy soils and is encouraged by irrigation (2). In 2006, irregular, yellowish/chlorotic, and dead turfgrass patches were observed for the first time on several sand-based creeping bentgrass cv. Penncross greens on a golf course in Bromont, Québec (45°19′N, 72°39′W). Furthermore, a noticeable decline of the turfgrass root system was observed. Creeping bentgrass was grown with the following management practices: mowing height 3.18 mm, fertilization 2.27 kg N/0.45 kg P2O5/3.18 kg K2O/92.9 m2/year, aeration two times per year with 9.53-mm-diameter hollow core. On 5 July 2006, soil (0.5 kg) was sampled from two damaged areas of green no. 11. Three plugs (5-cm diameter × 15 cm deep) were taken from each area with a soil probe and pooled to form two separate samples. Another set of soil samples was collected on 12 July from three golf greens (nos. 10, 11, and 16). One sample was taken from each of three damaged areas and two healthy areas of each green. Plant-parasitic nematodes were extracted from 100-ml volumes of each soil sample by the Baermann pan and funnel extraction methods. Numbers of L. breviannulatus from the soil sampled on 5 July were counted with a stereo-microscope after 4 days of extraction, while numbers of L. breviannulatus in the rest of the samples were counted after 7 days of extraction. Identification was determined by morphological examination of a small number of adult female nematodes (n = 7). Characteristics distinguishing these specimens as L. breviannulatus include: amphidial pouches (bilobed and extending to the guiding ring), length 5,115 μm (4,780 to 6,230 μm), distance of the guiding ring from the oral aperture 26 μm (24 to 30 μm), odontostyle length 83 μm (78 to 90 μm), and tail length 42 μm (37 to 50 μm). In the two soil samples collected on 5 July, 0 and 183 juveniles per kilogram of dry soil were recovered with the Baermann pan method. In samples collected on 12 July from damaged areas of three greens, averages of 16 (min 0 and max 60) and 22 (min 0 and max 80) juveniles per kilogram of dry soil were obtained with the Baermann pan and funnel methods, respectively. No L. breviannulatus was found in any sample from healthy areas. Although no damage threshold has been established for L. breviannulatus in creeping bentgrass, low numbers of needle nematodes can be damaging in other crops such as corn. In our study, the occurrence of the damage was related to populations of the needle nematode, and therefore, the nematode was the likely cause of the damage. In Canada, L. breviannulatus is reported from Ontario (4). To our knowledge, this is the first report of the occurrence of L. breviannulatus in Québec. References: (1) L. B. Forer. Plant Dis. Rep. 61:712, 1977. (2) R. B. Malek et al. Plant Dis. 64:1110, 1980. (3) D. C. Norton and J. K. Hoffmann. J. Nematol. 7:168, 1975. (4) W. Ye and R. T. Robbins. J. Nematol. 36:220, 2004.

scholarly journals First Report of Trichodorus obtusus on Turfgrass in North Carolina, U.S.A.

Plant Disease ◽  
2015 ◽  
Vol 99 (2) ◽  
pp. 291-291 ◽  
Author(s):  
W. Ye ◽  
Y. Zeng ◽  
J. Kerns
Keyword(s):  
North Carolina ◽  
South Carolina ◽  
Sequence Data ◽  
Soil Samples ◽  
Parasitic Nematodes ◽  
Plant Parasitic Nematodes ◽  
Body Width ◽  
Cervical Papilla ◽  
Stubby Root Nematode ◽  
Plant Parasitic

In May 2014, 11 sandy soil samples were collected at a depth of about 5 to 15 cm from a golf course community in Wilmington, NC, composed of Bermudagrass (Cynodon dactylon) from the fairway, St. Augustinegrass (Stenotaphrum secundatum) from the lawn, and Zoysiagrass (Zoysia japonica) from the tee, all of which showed spotted yellowing and necrosis. Plant-parasitic nematodes were extracted from soil samples by a combination of elutriation and sugar centrifugal-flotation methods at the North Carolina Department of Agriculture and Consumer Services, Nematode Assay Lab, Raleigh, NC. The results revealed the presence of several plant-parasitic nematodes, with a stubby-root nematode (Trichodoridae) present. Population densities of stubby-root nematodes were 10 to 90 (average 50) nematodes per 500 cm3 of soil. This species was clearly different from the parthenogenetic stubby-root nematode Nanidorus minor (Colbran, 1956) Siddiqi, 1974 commonly found in North Carolina because of the presence of males and larger body size. Morphological and molecular analyses of this nematode identified the species as Trichodorus obtusus Cobb, 1913. Morphological features of T. obtusus specimens were examined in glycerol permanent mounts. Males (n = 5) had a ventrally curved spicule, three ventromedian precloacal papillae (one ventromedian cervical papilla anterior to the excretory pore, one pair of lateral cervical pores at the level of the ventromedian cervical papilla), and a tail with a non-thickened terminal cuticle. Males were 860 to 1,120 (average 1,018) μm long, body width 38 to 48 (42) μm, onchiostyle 53 to 60 (56) μm, and spicule 54 to 62 (59) μm. Females (n = 5) had a pore-like vulva, a barrel-shaped vagina, and one or two postadvulvar lateral body pores on each side. Females were 990 to 1,330 (1,148) μm long, body width 43 to 56 (48) μm, onchiostyle 50 to 64 (58) μm, and V 49.0 to 57.5% (53.0%). The morphology agreed with the description of T. obtusus (2). DNA was prepared by squashing a single nematode (n = 3) on a microscope slide and collecting in 50 μl of AE buffer (10 mM Tris-Cl, 0.5 mM EDTA; pH 9.0). The 18S rDNA region was amplified with the forward primers 18S-G18S4 (5′ GCTTGTCTCAAAGATTAAGCC 3′), SSUF07 (AAAGATTAAGCCATGCATG), and 18S965 (GGCGATCAGATACCGCCCTAGTT) and reverse primers 18S-18P (TGATCCWKCYGCAGGTTCAC), SSUR26 (CATTCTTGGCAAATGCTTTCG), and 18S1573R (TACAAAGGGCAGGGACGTAAT). The 28S D2/D3 region was amplified with the forward primer 28S391a (AGCGGAGGAAAAGAAACTAA) and reverse primer 28S501 (TCGGAAGGAACCAGCTACTA) (4). The resulting 18S (1,547-bp) and 28S D2/D3 (925-bp) sequences were deposited in GenBank under the accession numbers KM276665 and KM276666. The 18S sequence data was 100% homologous with two populations of T. obtusus (JX279930, 898 bp, and JX289834, 897 bp) from South Carolina and one (AY146460, 634 bp) from an unknown source, each with a 1-bp difference in a Blastn search. The 28S D2/D3 sequence data was less than 90% homologous with many Trichodorus species, but no T. obtusus sequence data was available. T. obtusus is known to occur only in the United States and to damage turfgrasses. It is reported in the states of Virginia, Florida, South Carolina, Texas, Iowa, Kansas, Michigan, New York, and South Dakota. This nematode has been reported as a pathogen of bermudagrass in Florida (1) and South Carolina (3), but pathogenicity to St. Augustinegrass and Zoysiagrass is unknown. To our knowledge, this is the first report of T. obtusus on turfgrasses in North Carolina. References: (1) W. T. Crow and J. K. Welch. Nematropica 34:31, 2004. (2) W. Decraemer. The Family Trichodoridae: Stubby Root and Virus Vector Nematodes. Kluwer Academic Publishers, Dordrecht, The Netherlands, 1995. (3) J. B. Shaver et al. Plant Dis. 97:852, 2013. (4) G. R. Stirling et al. Nematology 15:401, 2013.

scholarly journals First Report of the Spiral Nematode Scutellonema brachyurum on Lilyturf in the United States

Plant Disease ◽  
2011 ◽  
Vol 95 (1) ◽  
pp. 74-74 ◽  
Author(s):  
P. Agudelo ◽  
D. Harshman
Keyword(s):  
United States ◽  
Population Density ◽  
The United States ◽  
Parasitic Nematodes ◽  
Initial Population ◽  
Herbaceous Plant ◽  
Plant Parasitic Nematodes ◽  
Essential Information ◽  
First Report ◽  
Plant Parasitic

Lilyturf (Liriope muscari (Decne.) L.H. Bailey), an herbaceous plant, is commonly used in landscaping including borders (along sidewalks, driveways, and trees) and mass plantings as groundcover in the southeastern United States. In December of 2009, a soil sample was submitted to our lab for diagnosis of plant-parasitic nematodes from an area planted with lilyturf located on the Clemson University main campus. A high population density (1,220 individuals/100 cm3 of soil) of spiral nematodes (Scutellonema brachyurum (Steiner, 1938) Andrássy, 1958) was found by routine extraction by sugar centrifugal flotation (3). Other plant-parasitic nematodes, mainly ring nematodes (10 individuals/100 cm3) and stubby root nematodes (10 individuals/100 cm3), were present. To verify if high numbers of spiral nematodes were consistently associated with lilyturf, 20 additional soil and root samples were collected from different places on the campus. In all cases, S. brachyurum was found in densities ranging from 680 to 1,600 individuals/100 cm3 of soil (average of 1,210 individuals/100 cm3). The species was identified by morphological characters of females, including well developed stylet (26 to 30 μm long), no spermatheca, no sperm in uterus, tail broadly rounded with 8 to 12 annules between anus and tail, and scutella at anus level. As is commonly the case for this species, no males were found in any of the samples collected. Examination of the roots revealed numerous, small, reddish brown, necrotic lesions, apparently caused by the feeding and penetration of S. brachyurum. Host plant suitability and pathogenicity of the nematode were tested in the greenhouse. Ten nematode-free lilyturf plants grown individually in 15-cm-diameter plastic pots with pasteurized soil were inoculated with 1,000 spiral nematodes each. Ten uninoculated plants were kept under identical conditions as controls. Three months after inoculation, soil population densities were measured and reproduction factors were calculated to be between 2.8 and 5.4 (final population density divided by initial population density) for the 10 plants. Characteristic lesions previously described were observed in the roots of all inoculated plants, along with slight chlorosis of foliage. These symptoms were not observed on control plants. Spiral nematodes may attack the roots and stolons of lilyturf as ectoparasites or they may enter them and feed in the cortex as endoparasites. Although root lesions were common on affected plants, root injury in general was not severe and generalized root decay was not observed on either the collected plants or those from the greenhouse study. Reports on the pathogenicity of S. brachyurum are variable. Moderate damage was recorded on amaryllis and other ornamentals (4), while measurable damage was observed on tobacco (2), with approximately 100 individuals/100 cm3 of soil, and severe damage on Aloe vera ((L.) Burm. f.), with approximately 500 individuals/100 cm3 (1). To our knowledge, this is the first report of S. brachyurum causing visible symptoms on lilyturf. As the interstate and international movement of perennial plants continues to grow, awareness of the host status of potentially harmful nematodes becomes essential information. References: (1) R. P. Esser et al. Nematropica 16:65, 1986. (2) T. W. Graham. Phytopathology (Abstr.) 45:347, 1955. (3) W. R. Jenkins. Plant Dis. Rep. 48:692, 1964. (4) L. Nong and G. F. Weber. (Abstr.) Phytopathology 54:902, 1964.

scholarly journals Surveying for Virus-vectoring Nematodes in Container-grown Blueberry Plants in Oregon

2016 ◽  
Vol 17 (3) ◽  
pp. 175-176 ◽  
Author(s):  
D. Sharma-Poudyal ◽  
C. Fraley ◽  
N. K. Osterbauer
Keyword(s):  
Soil Surface ◽  
Soil Samples ◽  
Parasitic Nematodes ◽  
Plant Parasitic Nematodes ◽  
Plastic Sheet ◽  
Gravel Bed ◽  
Effective Barrier ◽  
Gravel Layer ◽  
Potting Media ◽  
Plant Parasitic

The goal of this study was to determine the risk of finding virus-vectoring nematodes in containerized blueberry plants placed on gravel. To detect dagger nematode, soil, and potting media samples were collected from blueberry nurseries growing plants in containers using soilless potting media, with the containers placed on a gravel bed or, for one nursery, on a plastic sheet placed on the soil surface. Potting media samples were collected from containers holding plants and soil samples were collected from beneath the gravel or plastic barrier. Nematodes were extracted from all of the samples using sucrose centrifugation. No dagger or other plant parasitic nematodes were detected in any of the samples tested. These results suggest no treatment of soilless potting media is necessary before planting blueberries into containers. Similarly, the gravel layer seems to be an effective barrier for suppressing dagger and other plant parasitic nematodes. Accepted for publication 25 July 2016. Published 8 August 2016.

The distribution of Tylenchulus semipenetrans and other parasitic nematodes associated with citrus in northern Victoria

1978 ◽  
Vol 18 (90) ◽  
pp. 148 ◽  
Author(s):  
RH Brown
Keyword(s):  
Soil Samples ◽  
Parasitic Nematodes ◽  
Plant Parasitic Nematodes ◽  
Tylenchulus Semipenetrans ◽  
Citrus Orchards ◽  
Citrus Nematode ◽  
Plant Parasitic

Citrus orchards in the Cobram district of northern Victoria were surveyed in 1976 for the presence of plant parasitic nematodes; in particular for the citrus nematode Tylenchulus semipenetrans. One hundred and forty-six soil samples were collected from 38 orchards. Nine genera were recorded, the most prevalant being Tylenchulus and Paratrichodorus (95 per cent and 37 per cent respectively, of all samples). T. semipenetrans was present in all orchards sampled. Population levels of T. semipenetrans larvae exceeded 1000 per 500 g of soil in 60 per cent of samples.

Two new species of Aphelenchoides (Nematoda: Aphelenchida: Aphelenchoidea: Aphelenchidae) from Manipur, India

Biologia ◽  
2012 ◽  
Vol 67 (3) ◽  
Author(s):  
Loukrakpam Bina Chanu ◽  
Naorem Mohilal ◽  
Mohammad Shah
Keyword(s):  
New Species ◽  
Soil Samples ◽  
Cephalic Region ◽  
Parasitic Nematodes ◽  
Plant Parasitic Nematodes ◽  
Lateral Field ◽  
Short Tail ◽  
Tamarind Seed ◽  
Two New Species ◽  
Plant Parasitic

AbstractAnalysis of the soil samples collected from around rhizospheric region of mulberry plants grown in Yurembam Rose Garden, Yurembam, Imphal West, Manipur yielded several soil and plant parasitic nematodes. Among them four species of Aphelenchoides were recorded. Upon detailed study, two species of Aphelenchoides were found to be new to science. Aphelenchoides dhanachandi sp. n. is characterized by ventrally curved body, clearly set off cephalic region and tail ending into a sharp pointed terminus, and stylet slender, 13.6–15.3 (14 ± 0.7) μm long with indistinct basal swellings and tamarind seed-shaped median bulb. Aphelenchoides neoechinocaudatus sp. n. is characterized by straight body with four incisures in the lateral field, flatten cephalic region, slender stylet with indistinct basal swellings, 11.9 μm long, elongated pear-shaped median bulb and short tail with pointed mucro. The two species are illustrated here.

scholarly journals Research Note. New data on plant parasitic nematode Longidorus distinctus Lamberti, Choleva & Agostinelli, 1983 (Nematoda: Longidoridae) from Poland

2017 ◽  
Vol 54 (2) ◽  
pp. 179-182
Author(s):  
F. W. Kornobis ◽  
U. Sobczyńska
Keyword(s):  
Parasitic Nematode ◽  
Sequence Data ◽  
Soil Samples ◽  
Research Note ◽  
Parasitic Nematodes ◽  
Distribution Map ◽  
Plant Parasitic Nematodes ◽  
Its1 Sequence ◽  
The Family ◽  
Plant Parasitic

SummaryDuring a survey on the occurrence of the plant parasitic nematodes of the family Longidoridae in Poland, 925 soil samples were taken. Longidorus distinctus was present in 10 (1.08 %) of these samples. In this Research Note we provide: 1) distribution map of these populations, 2) morphometric data, 3) sequence data for D2-D3 28S rDNA and (partial)18S-ITS1 -5.8S(partial) markers and 4) LdistFOR primer (5′-GGCTGTAAAGATATATGCGT-3’) effective in obtaining ITS1 sequence for the species. Morphometric similarities and dissimilarities with data on other published populations are discussed.

scholarly journals First report on four species of predatorynematodes, mononchids (Nematoda : Mononchida) from Nepal

2018 ◽  
Vol 3 (5) ◽  
pp. 139
Author(s):  
Arvind K. Keshari ◽  
M.M. Shah ◽  
R. Gupta
Keyword(s):  
Parasitic Nematodes ◽  
Vegetable Crops ◽  
Plant Parasitic Nematodes ◽  
First Report ◽  
Plant Parasitic

A nematological survey was conducted for free and plant nematodes affecting economically important vegetable crops grown in Bhaktapur and Kavre, hilly districts of Nepal with altitudes ranging between 1315m to 1500m which revealed various plant parasitic nematodes along with four species of predatory nematodes belonging to the order Mononchida. These species were Mononchus aquaticus Coetzee, 1968, Iotonchus indicus Jairajpuri 1969, Mylonchulus contractus Jairajpuri, 1970 and Parahandronchus shakili (Jairajpuri, 1969) Mulvey, 1978. The measurements, descriptions, remarks and illustrations along with habitat and locality of these predatory nematodes are provided. These species are the first report from Nepal.

Molecular biodiversity assessment of plant-parasitic nematodes in Dokdo Island, Korea

Nematology ◽  
2019 ◽  
Vol 21 (3) ◽  
pp. 275-292 ◽  
Author(s):  
Dongwoo Kim ◽  
Hwal-Su Hwang ◽  
Jae-Kyoung Shim ◽  
JiYoung Yang ◽  
Jae Hong Pak ◽  
...  
Keyword(s):  
Parasitic Nematode ◽  
Rhizosphere Soil ◽  
Soil Samples ◽  
Parasitic Nematodes ◽  
Biodiversity Assessment ◽  
Plant Parasitic Nematodes ◽  
Species Diagnosis ◽  
Molecular Biodiversity ◽  
Natural Monument ◽  
Plant Parasitic

Summary Dokdo Island has a unique biodiversity that has been preserved as a natural monument. Although the biodiversity of Dokdo has been investigated, little information is available regarding the nematodes. The diversity of plant-parasitic nematodes was investigated using both ITS and D2-D3 sequences. Nematodes extracted from 59 rhizosphere soil samples were morphologically identified as belonging to eight genera: Geocenamus, Helicotylenchus, Rotylenchulus, Heterodera, Paratylenchus, Pratylenchus, Pratylenchoides and Xiphinema. Further, nucleotide sequences were determined from 85 individuals of different genera for species diagnosis. We identified 13 species, including three species of the genus Pratylenchus (P. crenatus, P. kumamotoensis and P. neglectus), Helicotylenchus sp. 1, Rotylenchulus sp. 1, Paratylenchus nanus, Heterodera trifolii, Heterodera spp., Pratylenchoides ritteri, Geocenamus sp. 1, Geocenamus sp. 2, Xiphinema brevicollum and Xiphinema sp. 1. The dominant plant-parasitic nematode on Dokdo was P. crenatus, which was found in 25.4% of the samples. Our study provides important information about the biodiversity of plant-parasitic nematodes on Dokdo Island.

scholarly journals Plant-Parasitic Nematodes Are Potential Pathogens of Miscanthus × giganteus and Panicum virgatum Used for Biofuels

Plant Disease ◽  
2011 ◽  
Vol 95 (4) ◽  
pp. 413-418 ◽  
Author(s):  
Tesfamariam Mekete ◽  
Kimberly Reynolds ◽  
Horacio D. Lopez-Nicora ◽  
Michael E. Gray ◽  
Terry L. Niblack
Keyword(s):  
Panicum Virgatum ◽  
Damage Threshold ◽  
Threshold Value ◽  
Nematode Species ◽  
Soil Samples ◽  
Parasitic Nematodes ◽  
Plant Parasitic Nematodes ◽  
Population Densities ◽  
Miscanthus Giganteus ◽  
Plant Parasitic

A survey of Miscanthus × giganteus and switchgrass plots throughout the midwestern and southeastern United States was conducted to determine the occurrence and distribution of plant-parasitic nematodes associated with these biofuel crops. During 2008, rhizosphere soil samples were collected from 24 Miscanthus × giganteus and 38 switchgrass plots in South Dakota, Iowa, and Illinois. Additional samples were collected from 11 Miscanthus × giganteus and 10 switchgrass plots in Illinois, Kentucky, Georgia, and Tennessee the following year. The 11 dominant genera recovered from the samples were Pratylenchus, Helicotylenchus, Xiphinema, Longidorus, Heterodera, Hoplolaimus, Tylenchorhynchus, Criconemella, Paratrichodorus, Hemicriconemoides, and Paratylenchus. Populations of Helicotylenchus, Xiphinema, and Pratylenchus were common and recorded in 90.5, 83.8, and 91.9% of the soil samples from Miscanthus × giganteus, respectively, and in 91.6, 75, and 83.3% of the soil samples from switchgrass, respectively. Prominence value (PV) (PV = population density × √frequency of occurrence/10) was calculated for the nematodes identified. Helicotylenchus had the highest PV (PV = 384) and was followed by Xiphinema (PV = 152) and Pratylenchus (PV = 72). Several of the nematode species associated with the two biofuels crops were plant parasites. Of these, Pratylenchus penetrans, P. scribneri, P. crenatus, Helicotylenchus pseudorobustus, Hoplolaimus galeatus, X. americanum, and X. rivesi are potentially the most damaging pests to Miscanthus × giganteus and switchgrass. Due to a lack of information, the damaging population thresholds of plant-parasitic nematodes to Miscanthus × giganteus and switchgrass are currently unknown. However, damage threshold value ranges have been reported for other monocotyledon hosts. If these damage threshold value ranges are any indication of the population densities required to impact Miscanthus × giganteus and switchgrass, then every state surveyed has potential for yield losses due to plant-parasitic nematodes. Specifically, Helicotylenchus, Xiphinema, Pratylenchus, Hoplolaimus, Tylenchorhynchus, Criconemella, and Longidorus spp. were all found to have population densities within or above the threshold value ranges reported for other monocotyledon hosts.

Sign in / Sign up

Export Citation Format

Share Document