scholarly journals Primer biases in the molecular assessment of diet in multiple insectivorous mammals

2021 ◽  
Author(s):  
Samuel S. Browett ◽  
Thomas G. Curran ◽  
Denise B. O’Meara ◽  
Andrew P. Harrington ◽  
Naiara Guimarães Sales ◽  
...  
Keyword(s):  
Trophic Ecology ◽  
Pilot Studies ◽  
Wide Range ◽  
Dna Metabarcoding ◽  
Detection Capabilities ◽  
Molecular Assessment ◽  
Primer Sets ◽  
Horseshoe Bat ◽  
Sorex Minutus ◽  
Pygmy Shrew

AbstractOur understanding of trophic interactions of small insectivorous mammals has been drastically improved with the advent of DNA metabarcoding. The technique has continued to be optimised over the years, with primer choice repeatedly being a vital factor for dietary inferences. However, the majority of dietary studies examining the effect of primer choice often rely on in silico analyses or comparing single-niche species. Here we apply DNA metabarcoding to empirically compare the prey detection capabilities of two widely used primer sets when assessing the diets of a flying (lesser horseshoe bat; Rhinolophus hipposideros) and two ground dwelling insectivores (greater white-toothed shrew; Crocidura russula and pygmy shrew; Sorex minutus). Although R. hipposideros primarily rely on two prey orders (Lepidoptera and Diptera), the unique taxa detected by each primer shows that a combination of primers may be the best approach to fully describe bat trophic ecology. However, random forest classifier analysis suggest that one highly degenerate primer set detected the majority of both shrews’ diet despite higher levels of host amplification. The wide range of prey consumed by ground-dwelling insectivores can therefore be accurately documented from using a single broad-range primer set, which can decrease cost and labour. The results presented here show that dietary inferences will differ depending on the primer or primer combination used for insectivores occupying different niches (i.e. hunting in the air or ground) and demonstrate the importance of performing empirical pilot studies for novel study systems.

scholarly journals Primer biases in the molecular assessment of diet in multiple insectivorous mammals

2021 ◽  
Author(s):  
Samuel S. Browett ◽  
Thomas G. Curran ◽  
Denise B. O’Meara ◽  
Andrew P. Harrington ◽  
Naiara Guimarães Sales ◽  
...  
Keyword(s):  
Trophic Ecology ◽  
Pilot Studies ◽  
Wide Range ◽  
Dna Metabarcoding ◽  
Detection Capabilities ◽  
Primer Sets ◽  
Horseshoe Bat ◽  
Sorex Minutus ◽  
Pygmy Shrew ◽  
In Silico Analyses

AbstractOur understanding of trophic interactions of small insectivorous mammals has been drastically improved with the advent of DNA metabarcoding. The technique has continued to be optimised over the years, with primer choice repeatedly being a vital factor for dietary inferences. However, the majority of dietary studies examining the effect of primer choice often rely on in silico analyses or comparing between species that occupy an identical niche type. Here, we apply DNA metabarcoding to empirically compare the prey detection capabilities of two widely used primer sets when assessing the diets of a flying (lesser horseshoe bat; Rhinolophus hipposideros) and two ground-dwelling insectivores (greater white-toothed shrew; Crocidura russula and pygmy shrew; Sorex minutus). Although R. hipposideros primarily rely on two prey orders (Lepidoptera and Diptera), the unique taxa detected by each primer shows that a combination of primers may be the best approach to fully describe bat trophic ecology. However, random forest classifier analysis suggests that one highly degenerate primer set detected the majority of both shrews’ diet despite higher levels of host amplification. The wide range of prey consumed by ground-dwelling insectivores can therefore be accurately documented from using a single broad-range primer set, which can decrease cost and labour. The results presented here show that dietary inferences will differ depending on the primer or primer combination used for insectivores occupying different niches (i.e., hunting in the air or ground) and demonstrate the importance of performing empirical pilot studies for novel study systems.

scholarly journals Small-mammal assemblages inhabiting Sphagnum peat bogs in various regions of Poland

2012 ◽  
Vol 49 (2) ◽  
pp. 115-133
Author(s):  
Mateusz Ciechanowski ◽  
Jan Cichocki ◽  
Agnieszka Ważna ◽  
Barbara Piłacińska
Keyword(s):  
Small Mammal ◽  
Western Europe ◽  
Habitat Degradation ◽  
Myodes Glareolus ◽  
Peat Bogs ◽  
Trophic Conditions ◽  
Characteristic Features ◽  
Mammal Assemblages ◽  
Sorex Minutus ◽  
Pygmy Shrew

Abstract We studied species composition of assemblages of small mammals (rodents and shrews) inhabiting Polish 25 ombrotrophic mires and quaking bogs in several regions in order to reveal characteristic features of their quantitative structure and compare them between regions, internal zones of the bog habitats, and different levels of anthropogenic degradation. We reviewed also all published results of small-mammal trapping in such habitats. Mammals were captured in pitfalls, snap traps and live traps on 12 bogs of the Pomerania region, 4 bogs of the Orawa-Nowy Targ Basin (Kotlina Orawsko-Nowotarska), 3 bogs in the Świętokrzyskie Mts, and 6 bogs in Wielkopolska and the Lubusz Land. Additionally, we included materials collected from Barber traps (pitfalls) used during studies of epigeic invertebrates on 4 bogs. In total, 598 individuals of 12 species were collected. The number of pitfall captures per 100 trapnights was very low (7.0-7.8), suggesting low population density. Shrews predominated among mammals captured in pitfalls, and the assemblage structure appeared to be similar to impoverished forest fauna, slightly enriched with ubiquitous species from meadows and agroecosystems, with a very small percentage of typical wetland species (Neomys fodiens, Neomys anomalus, Microtus oeconomus). Rodents (mostly Myodes glareolus) predominated only in samples obtained by live and snap traps. Pygmy shrew Sorex minutus was the most numerous species at most sites, sometimes being the only small mammal in that habitat, especially in well-preserved, treeless parts of bogs, dominated by Sphagnum peatmoss. The dominance and high constancy of S. minutus appear to be a characteristic feature of small-mammal assemblages inhabiting ombrotrophic mires, at least in some regions of Central and Western Europe. Enrichment of the fauna with other species might be related to either improved trophic conditions (by contact with mineralized ground waters) or habitat degradation (by peat mining, drainage, and subsequent secondary succession).

scholarly journals MEDITERATRI project - assessing the trophic ecology of predatory arthropods in Mediterranean agriculture via DNA metabarcoding diet analyses

2019 ◽  
Vol 2 ◽  
Author(s):  
Lucija Šerić Jelaska ◽  
Barbara Anđelić ◽  
Mišel Jelić ◽  
Tomislav Kos
Keyword(s):  
Pest Management ◽  
Trophic Ecology ◽  
Arable Land ◽  
Carabid Beetles ◽  
Diet Analysis ◽  
Gut Contents ◽  
Dna Metabarcoding ◽  
Potential Benefits ◽  
Diet Analyses ◽  
Predatory Arthropods

A type of management and the use of pesticides in arable land may negatively affect a range of soil biota and thus their food webs important for ecosystem functioning. By analysing trophic interactions we could reveal the extent of potential benefits that certain organisms can provide in biocontrol and maintaining healthy ecosystems. To evaluate the role of predatory arthropods within olive orchards and vineyards under Integrated Pest Management (IPM) and Ecological Pest Management (EPM) we collected carabid beetles together with other dominant predatory arthropods in the field (e.g. ladybugs, antlions, spiders, centipedes) and subdued the individuals to molecular gut content analyses using NGS. DNA metabarcoding diet analysis approach allowed detecting a wide variety of taxa from gut contents of the predators. In addition, using ICP-MS and LC-MS/MS we quantified Cu, pesticides and its residues in soil and animals representing different trophic guilds. Since concentrations of some toxic compounds detected in carabids body were negatively correlated with those in the soil, we aim to identify a potential vector for possible transfer of toxicants to general predators via predation. The results contribute to the risk assessment of proliferation of detected chemical compounds including copper in the ecosystem and to the knowledge on the overall field sustainability of predatory invertebrates to maximize their role in pest control. The study was conducted under the project activity of HRZZ – Mediteratri.

scholarly journals Ichthyoplankton metabarcoding as a tool for studying fish reproductive dynamics

2021 ◽  
Vol 4 ◽  
Author(s):  
Daniel Teixeira ◽  
Heron Hilário ◽  
Gustavo Rosa ◽  
Guilherme Santos ◽  
Gilmar Santos ◽  
...  
Keyword(s):  
Fish Assemblages ◽  
Fish Larvae ◽  
Reference Sequence ◽  
12S Rrna ◽  
Morphological Identification ◽  
Rrna Gene ◽  
Fish Eggs ◽  
Migration Routes ◽  
Dna Metabarcoding ◽  
Primer Sets

The study of ichthyoplankton composition, abundance and distribution is paramount to understand the reproductive dynamics of local fish assemblages. The analysis of these parameters allows the identification of spawning sites, nursery areas and migration routes. However, due to the lack of characters in early life stages, the morphological identification of ichthyoplankton is often impractical and many studies identify only fish larvae. Additionally, its accuracy shows great variation between taxonomists and laboratories according to their experience and specialty. DNA barcoding emerged as an alternative to provide assertive identification of fish eggs and larvae, but it becomes too expensive and laborious when the study demands the processing of huge amounts of organisms. DNA metabarcoding can overcome these limitations as a rapid, cost-effective, broad and accurate taxonomy tool, allowing the identification of multiple individuals simultaneously. Here, we present the identification of a sample containing 68 fish eggs and another containing 293 fish larvae from a single site in the São Francisco River Basin, Eastern Brazil, through DNA metabarcoding. We used a low-cost saline DNA extraction followed by PCR amplification with three primer sets targeting the 12S rRNA gene: MiFish (~170bp), Teleo_1 (~60bp), and NeoFish (~190bp). The latter was recently developed by our research group specifically for the identification of Neotropical fishes. All the amplified samples were sequenced in a single multiplexed Illumina MiniSeq run. We performed the filtering steps and assigned Amplicon Sequence Variants (ASVs) using a DADA2/Phyloseq based pipeline and a custom 12S reference sequence database including 101 species and 70 genera from the Jequitinhonha and São Francisco basins. The species Cyphocharax gilbert, Leporinus taeniatus, Megaleporinus elongatus, Prochilodus argenteus, P. costatus and Psalidodon fasciatus were detected by all three primer sets in the larva pool, while Pterygoplichthys etentaculatus was detected solely by NeoFish (Fig. 1). Within the egg pool, all three markers detected the species Characidium zebra, Curimatella lepidura, M. elongatus, Pimelodus fur and P. costatus, but Brycon orthotaenia was detected only by NeoFish, P. maculatus only by Teleo, and P. pohli by MiFish and Teleo (Fig. 1). The consistency in species detection among all three markers underpins the credibility of this method to accurately describe the sample composition. Considering that most of species were exclusive to the larvae or egg pool, our experiment highlights the importance of including the identification of fish eggs in reproduction studies, as it can provide additional information about which species are spawning in an area. Furthermore, the application of DNA metabarcoding to the study of ichthyoplankton can help decision makers create more informed guidelines for conservation of economically and ecologically important fish species.

High cryptic diversity in the kleptoparasitic genus Hyalorisia Dall, 1889 (Littorinimorpha: Capulidae) with the description of nine new species from the Indo-West Pacific

2020 ◽  
Vol 86 (4) ◽  
pp. 401-421 ◽  
Author(s):  
Giulia Fassio ◽  
Valeria Russini ◽  
Barbara Buge ◽  
Stefano Schiaparelli ◽  
Maria Vittoria Modica ◽  
...  
Keyword(s):  
Trophic Ecology ◽  
Molecular Data ◽  
Sympatric Species ◽  
Water Current ◽  
Phylogenetic Position ◽  
Nominal Species ◽  
West Pacific ◽  
Allopatric Species ◽  
Wide Range ◽  
The Family

ABSTRACT Species in the family Capulidae (Littorinimorpha: Capuloidea) display a wide range of shell morphologies. Several species are known to live in association with other benthic invertebrates—mostly bivalves and sabellid worms, but also other gastropods—and are believed to be kleptoparasitic filter feeders that take advantage of the water current produced by the host. This peculiar trophic ecology, implying a sedentary lifestyle, has resulted in highly convergent shell forms. This is particularly true for the genus Hyalorisia Dall, 1889, which occurs in deep water in the Caribbean and Indo-West Pacific provinces, with two nominal species recognized so far. Combining morphological, ecological and molecular data, we assessed the diversity of the genus, its phylogenetic position inside the family and its association with its bivalve host, the genus Propeamussium de Gregorio, 1884 (Pectinoidea), resulting in the description of nine new cryptic species. When sympatric, species of Hyalorisia are associated with different host species, but the same species of Propeamussium may be the host of several allopatric species of Hyalorisia.

scholarly journals Behavioral and trophic segregations help the Tahiti petrel to cope with the abundance of wedge-tailed shearwater when foraging in oligotrophic tropical waters

2020 ◽  
Vol 10 (1) ◽  
Author(s):  
Andreas Ravache ◽  
Karen Bourgeois ◽  
Henri Weimerskirch ◽  
Angélique Pagenaud ◽  
Sophie de Grissac ◽  
...  
Keyword(s):  
Trophic Ecology ◽  
Isotope Analysis ◽  
Foraging Strategy ◽  
Gps Tracking ◽  
Ecological Niches ◽  
Extensive Search ◽  
Tropical Area ◽  
Time Space ◽  
Dna Metabarcoding ◽  
Breeding Seasons

Abstract Two species breeding in sympatry are more likely to coexist if their ecological niches are segregated either in time, space or in trophic habits. Here, we combined GPS-tracking, stable isotope analysis and DNA metabarcoding analysis to understand how the rare Tahiti petrel Pseudobulweria rostrata (TP) copes with the very abundant (i.e. 500,000 breeding pairs) wedge-tailed shearwater Ardenna pacifica (WTS) when breeding in sympatry in a tropical area. WTS foraged in restricted areas along their path, while TP predominantly foraged using extensive search behavior, suggesting a more opportunistic foraging strategy. Interspecific overlap of foraging areas was higher than intraspecific overlap. Breeding seasons largely overlap between species during the study, but TP seems to be asynchronous breeders. TP fed upon prey with higher δ15N values than WTS, and their diet was mainly composed of deep-sea organisms. TP could feed upon dead prey floating at the surface while WTS preyed mainly upon fish species that generally move in schools. Our study highlights several segregating mechanisms (temporal, behavioral and trophic) that could facilitate the coexistence of the two species despite the predominant number of WTS, and provides the very first information on the foraging and trophic ecology of the poorly-known TP.

359 A NONINVASIVE APPROACH TO DIAGNOSE TRANSGENIC CONCEPTI DURING PREGNANCY IN GOATS

2015 ◽  
Vol 27 (1) ◽  
pp. 268
Author(s):  
K. C. S. Tavares ◽  
C. R. Lazzarotto ◽  
C. M. Calderon ◽  
L. T. Martins ◽  
S. G. Neto ◽  
...  
Keyword(s):  
Mammalian Species ◽  
Proteinase K ◽  
The Road ◽  
Phenol Extraction ◽  
Cell Free Fetal Dna ◽  
Wide Range ◽  
Genetic Features ◽  
Pcr Products ◽  
Dna Precipitation ◽  
Primer Sets

The discovery of cell-free fetal DNA (cffDNA) circulating in the blood of pregnant women, and more recently in cows, ewes, and mares, paves the road towards the development of molecular tools to explore genetic features of embryos and/or fetuses before term. Albeit a wide range of analyses are in current use and development in humans, genetic diagnostic targets other than sex determination are still not described for other mammalian species. The aim of this study was to detect cffDNA from transgenic goat concepti for the human lysozyme (hLZ) gene in the blood of nontransgenic dams. Blood was collected from 3 nontransgenic goats carrying hLZ-transgenic concepti on Days 40–50, 80–90, and 110–120 of gestation. Also, blood was drawn 8 and 12 days after parturition from two other nontransgenic goats that delivered hLZ-transgenic offspring. Blood samples (10 mL) were spun at 1200 rpm for 10 min; resulting serum or plasma were stored at –20°C (serum) or 4°C (plasma). The DNA was extracted by mixing 350 µL of serum or plasma with an equal volume of TE buffer and 5 µL of proteinase K (20 mg mL–1). The mixtures were incubated at 55°C for 3 h, followed by phenol extraction and DNA precipitation by sodium acetate and 100% ethanol, with further incubation at –20°C overnight and centrifugation at 12 000 × g for 10 min. The DNA pellets were washed with 70% ethanol and eluted in 20 µL of ultrapure water. For the PCR, primer sets for the hLZ transgene (hLZ-i1-F 5′ CGGTCCAGGGCAAGGTCTTTGA 3′ and hLZ-i1-R 5′ ACTGCTCCTGGGGTTTTGCC 3′) and for GAPDH as the endogenous control were used. Reactions contained 3 µL of DNA, 200 nM of each primer, and 45 µL of PCR Mastermix (Quatro G Pesquisa & Desenvolvimento, Porto Alegre, Brazil). The DNA from serum and plasma of nontransgenic goats were used as negative controls. The cycling conditions were 95°C for 10 min, followed by 55 cycles of 95°C for 30 s, 58°C for 30 s and 72°C for 30 s, plus a final extension at 72°C for 10 min. The PCR products were analysed by electrophoresis in 2% agarose gel. As expected, GAPDH was amplified in most of the samples (12/13). The 200-bp PCR product corresponding to hLZ was detected in the dam's serum in all 3 gestational phases, with 2 out of 3 animals being positive on 40 to 50 and 80 to 90 days, and all 3 on 110 to 120 days of pregnancy. Furthermore, the transgene was amplified from dam's plasma in all samples after parturition. Only GAPDH amplification was detected in the blood of nontransgenic goats. These results suggest that cffDNA is present in the goat's blood circulation at the fetal phase during pregnancy and at least during the first 2 weeks after parturition. This method can be safely applied as a useful tool in zygote-DNA microinjection experiments, providing an early and preterm diagnostic of transgenic concepti through the dam's blood.Research was supported by FINEP.

Foraging ecology of the horseshoe bat, Rhinolophus megaphyllus (Rhinolophidae), in eastern Australia

2004 ◽  
Vol 31 (4) ◽  
pp. 403 ◽  
Author(s):  
Chris R. Pavey ◽  
Chris J. Burwell
Keyword(s):  
Prey Capture ◽  
Foraging Ecology ◽  
Light Trap ◽  
Foraging Strategy ◽  
Flying Insects ◽  
Open Forest ◽  
Eastern Australia ◽  
Wide Range ◽  
Horseshoe Bat ◽  
Conservation Concern

The foraging ecology of the eastern horseshoe bat, Rhinolophus megaphyllus, was examined at five sites spread along 2100 km of its Australian distribution in coastal Queensland. Foraging strategy and prey-capture behaviour of light-tagged bats were similar across sites. Bats were observed foraging during continuous flight at all sites, whereas perch hunting was observed (rarely) at only one site. Bats captured insects by aerial hawking, with a single record of gleaning. In rainforest bats spent most time close to vegetation whereas openings were favoured in open forest/woodland. Only flying insects were captured and, although a wide range of taxa was taken, Lepidoptera (all sites) and Coleoptera (all sites except one) were the primary prey. Occurrence in faeces of Lepidoptera, Coleoptera, and other taxa combined, varied across sites and across seasons, but there was no three-way interaction between taxon, site and season. Comparison of insect taxa in faeces with those captured in a light-trap set at foraging grounds indicated that insects were selectively captured by R. megaphyllus. The foraging ecology of R. megaphyllus is similar to that of other horseshoe bats in its relative stability across a large geographic range. Although the species is currently not of conservation concern in Australia, aspects of its foraging ecology suggest that it may become regionally threatened in areas with high levels of vegetation clearance.

scholarly journals Phylogeographical structure of the pygmy shrew: revisiting the roles of southern and northern refugia in Europe

2020 ◽  
Vol 129 (4) ◽  
pp. 901-917 ◽  
Author(s):  
Rodrigo Vega ◽  
Allan D McDevitt ◽  
Joanna Stojak ◽  
Alina Mishta ◽  
Jan M Wójcik ◽  
...  
Keyword(s):  
Demographic History ◽  
Glacial Refugia ◽  
Intraspecific Diversity ◽  
Evolutionary Potential ◽  
Mountain Ranges ◽  
Early Diversification ◽  
Patterns And Processes ◽  
Sorex Minutus ◽  
Pygmy Shrew ◽  
The Last Glacial

Abstract Southern and northern glacial refugia are considered paradigms that explain the complex phylogeographical patterns and processes of European biota. Here, we provide a revisited statistical phylogeographical analysis of the pygmy shrew Sorex minutus Linnaeus, 1766 (Eulipotyphla, Soricidae), examining its genetic diversity, genetic differentiation and demographic history in the Mediterranean peninsulas and in Western and Central Europe. The results showed support for genetically distinct and diverse phylogeographical groups consistent with southern and northern glacial refugia, as expected from previous studies. We also identified geographical barriers concordant with glaciated mountain ranges during the Last Glacial Maximum (LGM), early diversification events dated between the Late Pleistocene and Early Holocene for the main phylogeographical groups, and recent (post-LGM) patterns of demographic expansions. This study is the most comprehensive investigation of this species to date, and the results have implications for the conservation of intraspecific diversity and the preservation of the evolutionary potential of S. minutus.

Sign in / Sign up

Export Citation Format

Share Document