scholarly journals First record in 129 years of the Tamil Treebrown Lethe drypetis todara Moore, 1881 (Lepidoptera: Nymphalidae: Satyrinae) from Odisha, India by fruit-baiting

2019 ◽  
Vol 11 (15) ◽  
pp. 15047-15052
Author(s):  
Anirban Mahata ◽  
Sudheer Kumar Jena ◽  
Sharat Kumar Palita
Keyword(s):  
First Record ◽  
Eastern Ghats ◽  
Butterfly Species ◽  
First Report ◽  
Hill Range

The first record of a butterfly species, the Tamil Treebrown Lethe drypetis todara Moore, 1881 (Nymphalidae: Satyrinae) is described from Deomali Hill range of southern Odisha, in Eastern Ghats of India, collected by fruit-baiting.  This is the first record from Odisha almost 129 years after its first report from Khurda in coastal Odisha by Taylor & de Niceville in the year 1888. The ecology and sampling of the species are described in this study.

First record of the snail-killing fly genus Dichetophora Rondani (Diptera: Sciomyzidae) in Korea, with descriptions of two new species

Zootaxa ◽  
2021 ◽  
Vol 5068 (1) ◽  
pp. 125-132
Author(s):  
YEONGJIN SON ◽  
SANG JAE SUH
Keyword(s):  
New Species ◽  
Korean Peninsula ◽  
First Record ◽  
First Report ◽  
Two New Species ◽  
Palearctic Species

This paper provides the first report of the snail-killing fly genus Dichetophora Rondani, 1868 on the Korean peninsula with the discovery of two new species, D. koreana sp. nov. and D. nigricorpa sp. nov. Descriptions and illustrations of the new species and keys to the Palearctic species of this genus are given.  

scholarly journals First report of caper (Capparis spinosa) serious infestation by Eurydema eckerleini in Cyclades Islands, Greece (Hemiptera: Heteroptera, Pentatomidae)

2017 ◽  
Vol 49 (1) ◽  
pp. 65
Author(s):  
Konstantinos B. Simoglou ◽  
Paride Dioli
Keyword(s):  
Mediterranean Climate ◽  
First Record ◽  
Arid Environments ◽  
Hilly Terrain ◽  
First Report ◽  
Drought Conditions ◽  
Capparis Spinosa ◽  
Heteroptera Pentatomidae ◽  
The Mediterranean

The islands of Tinos and Syros in the Cyclades Archipelago, Greece, have a hilly terrain, a mild Mediterranean climate and vegetation adapted to drought conditions. Caper (<em>Capparis</em> <em>spinosa</em> L.) is highly adapted to arid environments and grows successfully during the Mediterranean summer. In August 2015, we detected serious infestations on wild caper by <em>Eurydema</em> <em>eckerleini</em> (Pentatomidae), which was formerly considered a species endemic to Crete and the Peloponnese, with an isolated report in Turkey. This is the first record of the presence of<em> E. eckerleini</em> in the Cyclades.

scholarly journals First record of Trypanosoma sp. (Protozoa: Kinetoplastida) in tuvira (Gymnotus aff. inaequilabiatus) in the Pantanal wetland, Mato Grosso do Sul State, Brazil

2011 ◽  
Vol 20 (1) ◽  
pp. 85-87 ◽  
Author(s):  
Santiago Benites de Pádua ◽  
Márcia Mayumi Ishikawa ◽  
Fabiana Satake ◽  
Gabriela Tomas Jerônimo ◽  
Fabiana Pilarski
Keyword(s):  
Prevalence Rate ◽  
First Record ◽  
Diagnostic Methods ◽  
Mato Grosso ◽  
First Report ◽  
Paraguay River ◽  
Blood Smears ◽  
Mato Grosso Do Sul ◽  
Pantanal Wetland ◽  
Blood Centrifugation

The blood infection by Trypanosoma sp. in tuvira (Gymnotus aff. inaequilabiatus) from the Pantanal wetland was reported in this study. Ten fish from the Paraguay River in the Pantanal were evaluated for the presence of hemoflagellates. Trypomastigotes of Trypanosoma sp. were observed in blood smears from three fish (30% prevalence) and some forms were seen to be undergoing division. Using the diagnostic methods of fresh examination and blood centrifugation in hematocrit capillary tubes, the prevalence rate was 80%. This is the first report of Trypanosoma sp. in tuvira in Brazil.

scholarly journals First record of roving coral grouper Plectropomus pessuliferus (Fowler, 1904) from Saint Martin’s Island, Bangladesh based on Morphology and DNA Barcoding

2021 ◽  
Vol 32 (2) ◽  
pp. 293-301
Author(s):  
MD JAYEDUL ISLAM ◽  
SHARMIN AKTER ◽  
PROVAKOR SARKAR ◽  
MOHAMMAD RASHED ◽  
IREEN PARVIN ◽  
...  
Keyword(s):  
Dna Barcoding ◽  
Bay Of Bengal ◽  
New Record ◽  
First Record ◽  
Morphological Characters ◽  
Marine Waters ◽  
First Report ◽  
Saint Martin ◽  
Northern Bay Of Bengal

A new record of Plectropomus pessuliferus (Serranidae: Epinephelinae) wasdocumented based on morphological characters and DNA barcoding. The species was collectedduring a regular survey for making an inventory of reef associated fishes in Saint Martin`sIsland, Bangladesh. This is the first report of roving coral grouper from the marine waters ofBangladesh validated by morpho-meristic analysis and DNA barcoding. This is also the firstreport from the northern Bay of Bengal.

scholarly journals First record of Pilularia americana A. Braun (Polypodiidae, Salviniales, Marsileaceae) from Peru

Check List ◽  
2018 ◽  
Vol 14 (2) ◽  
pp. 319-322
Author(s):  
Blanca León ◽  
Hamilton Beltrán ◽  
Carlos Carrasco-Badajoz ◽  
Edwin Portal-Quicaña ◽  
Mariela Huaycha-Allcca
Keyword(s):  
North America ◽  
First Record ◽  
First Report ◽  
Aquatic Fern

The aquatic fern Pilularia americana A. Braun is known from several countries in South and North America. Here we provide a first report of this species for Peru, from 2 localities in the Ancash and Ayacucho regions (central Peru), which confirm its presence in the national flora.

scholarly journals First record of Conura (Conura) maculata (Fabricius, 1787) (Hymenoptera, Chalcididae) parasitizing Opsiphanes invirae amplificatus Stichel, 1904 (Lepidoptera, Nymphalidae) in the province of Corrientes, Argentina

Check List ◽  
2018 ◽  
Vol 14 (6) ◽  
pp. 1155-1159
Author(s):  
Paula Belén Gervazoni ◽  
Manuel Osvaldo Arbino
Keyword(s):  
First Record ◽  
First Report ◽  
Host Interaction ◽  
Palm Trees ◽  
Lepidopteran Pest

We report the first record of Conura (Conura) maculata (Fabricius, 1787) in the province of Corrientes, Argentina. A total of 85 adult wasps of C. maculata were obtained from 3 chrysalides of Opsiphanes invirae amplificatus Stichel, 1904, a lepidopteran pest of native and exotic palm trees. This is the first report of the occurrence of this parasitoid in the province of Corrientes, extending this species’ known distribution in the country. This is also the first report of the parasitoid-host interaction between these 2 species for Argentina.

scholarly journals First Record Of Meroplius Fukuharai (Iwasa 1984) (Diptera: Sepsidae) On Romanian Territory

2015 ◽  
Vol 57 (2) ◽  
pp. 121-125
Author(s):  
Lavinia Iancu ◽  
Cristina Purcarea
Keyword(s):  
Relative Humidity ◽  
Air Temperature ◽  
Environmental Parameters ◽  
Sampling Period ◽  
First Record ◽  
Research Area ◽  
Insect Species ◽  
First Report ◽  
South Eastern ◽  
Species Dynamics

Abstract The present study represents the first report on the presence of Meroplius fukuharai (Diptera: Sepsidae) in Romania. The research area was located in Bucharest. Meroplius fukuharai was recorded during an experiment for investigating necrophagous insect species dynamics. Adult specimens were sampled during the summer (August 2013) from swine carcasses at the beginning of the advanced decay stage. The species had a sporadic occurrence, only four male specimens being sampled and identified both morphologically and genetically during the four-month survey. The recorded environmental parameters during the sampling period showed an air temperature of 28-33°C and a relative humidity of 53-57%. This report on the presence of M. fukuharai in Romania leads to the expansion of its known distribution range in the South Eastern part of Europe.

scholarly journals First Report of Meloidogyne enterolobii on Carrot in China

Plant Disease ◽  
2014 ◽  
Vol 98 (7) ◽  
pp. 1019-1019 ◽  
Author(s):  
Y. F. Wang ◽  
S. Xiao ◽  
Y. K. Huang ◽  
X. Zhou ◽  
S. S. Zhang ◽  
...  
Keyword(s):  
Morphological Characteristics ◽  
Severe Infection ◽  
Original Description ◽  
First Record ◽  
Vegetable Crops ◽  
Species Identity ◽  
Fujian Province ◽  
First Report ◽  
Lateral Lines ◽  
Meloidogyne Sp

Carrot (Daucus carota var. sativus) is one of the 10 most economically important vegetable crops in the world. Recently, stunted and yellowing carrots grown on sandy soil in several commercial fields were observed in Dongshan County, Fujian Province, China. Many round to irregular shaped lumps and swellings were present on the surface of tap and fibrous roots, often with secondary roots emerging from the galls on taproots. Severe infection caused short, stubby, forked taproots leading to losses in quality and marketability. Meloidogyne sp. females and egg masses were dissected from the galls. The perineal patterns from 20 females were oval shaped with moderate to high dorsal arches and mostly lacking obvious lateral lines. The second-stage juvenile mean body length (n = 20) was 416 (390 to 461) μm; lateral lips were large and triangular in face view; tail was thin and length was averaged 56.1 (49.8 to 62.1) μm, with a broad, bluntly rounded tip. These morphological characteristics matched the original description of M. enterolobii (5). Species identity was further explored by sequencing the mitochondrial DNA (mtDNA) region between COII and the lRNA genes using primers C2F3/MRH106 (GGTCAATGTTCAGAAATTTGTGG/AATTTCTAAAGACTTTTCTTA GT) (4). A DNA fragment of ~840 bp was obtained and the sequence (GenBank Accession No. KJ146864) was compared with those in GenBank using BLAST and was 100% identical to the sequences of M. enterolobii and M. mayaguensis, a synonym of M. enterolobii (4). Part of the rDNA spanning ITS1, 5.8S gene, ITS2 was amplified with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (3), and the sequence obtained (KJ146863) was 99 to 100% identical to sequences of M. enterolobii (KF418369.1, KF418370.1, JX024149.1, and JQ082448.1). For further confirmation, M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC) (2) were used for amplification of the rDNA-IGS2 sequences of eight populations of the nematode from three localities. A 200-bp amplification product was produced by each population, whereas no product was amplified from control populations of M. incognita or M. javanica. A single product of ~320 bp was obtained using primers 63VNL/63VTH (GAAATTGCTTTATTGTTACTAAG/TAGCCACAGCAAAATAGTTTTC ) (1) from the mtDNA 63-bp repeat region for these populations, and the sequence (KJ146861) showed 100% identity with sequences of M. enterolobii (AJ421395.1, JF309159.1, and JF309160.1). Therefore, the population of Meloidogyne sp. on carrot was confirmed to be M. enterolobii. This nematode has been reported to infect more than 20 plant species belonging to seven families, including Annonaceae, Cucurbitaceae, Convolvulaceae, Fabaceae, Marantaceae, Myrtaceae, and Solanaceae in China. To our knowledge, this is the first report of infection of carrot by M. enterolobii and the first record of M. enterolobii parasitizing a plant in the family Apiaceae in China. M. enterolobii has been reported in Guangdong and Hainan provinces, China. This is the first report of M. enterolobii in Fujian Province, in southeast China. References: (1) V. C. Blok et al. Nematology 4:773, 2002. (2) H. Long et al. Acta Phytopathol. Sin. 36:109, 2006. (3) T. C. Vrain et al. Fundam. Appl. Nematol. 15:565, 1992. (4) J. Xu et al. Eur. J. Plant Pathol. 110:309, 2004. (5) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

scholarly journals First Report on the Molecular Identification of Phytoplasma (16SrII-D) Associated with Witches' Broom of Kalmegh (Andrographis paniculata) in India

Plant Disease ◽  
2015 ◽  
Vol 99 (1) ◽  
pp. 155-155 ◽  
Author(s):  
S. T. Saeed ◽  
A. Khan ◽  
A. Samad
Keyword(s):  
16S Rdna ◽  
Nested Pcr ◽  
Disease Incidence ◽  
Antioxidant Properties ◽  
First Record ◽  
Andrographis Paniculata ◽  
Medicinal And Aromatic Plants ◽  
First Report ◽  
16S Rdna Sequence Analysis ◽  
Virtual Rflp

Andrographis paniculata (family Acanthaceae), also known as “King of Bitters” or Kalmegh, is an important medicinal plant used for the treatment of various diseases. It has antimicrobial, antiviral, anti-inflammatory, hepatoprotective, antidiabetic, antihyperglycemic, and antioxidant properties (1). During June 2014, while performing a routine survey of the commercial trial fields of Kalmegh at Central Institute of Medicinal and Aromatic Plants (CIMAP), Lucknow, India, typical phytoplasma disease symptoms such as virescence, proliferation, and witches' broom along with little leaf and stunted growth were observed. The disease incidence was estimated to be approximately 7 to 10%. To ascertain the presence of phytoplasma, 16 samples of leaves were collected from nine different field sites, and total genomic DNA was extracted from the symptomatic and symptomless Kalmegh plants by the CTAB method. Direct and nested PCR assays were performed targeting the 16S rDNA using generic phytoplasma primer pairs P1/P6 followed by R16F2n/R16R2 (2). Resulting bands of the expected size (1.5 kb and 1.2 kb, respectively) were amplified from symptomatic plants. No amplification was observed with DNA from asymptomatic plant samples. The purified nested PCR products were cloned into E. coli DH5α, using the pGEM-T Easy vector (Promega, United States) and sequenced with primers M13For/M13Rev using an automatic sequencer (ABI Prism, Perkin Elmer) at CIMAP. The sequence was analyzed by BLASTn and found to share 99% similarity with Echinacea witches'-broom phytoplasma and Sesame phyllody phytoplasma strain (GenBank Accession Nos. JF340080 and KF612966, respectively), which belong to the 16SrII-D group. The sequence was deposited in NCBI as GenBank Accession No. KM359410. A phylogenetic tree using MEGA v5.0 (4) was constructed with 16S rDNA; consensus sequences of phytoplasmas belonging to distinct groups revealed that the present phytoplasma clustered with the 16SrII group. iPhyClassifier software was used to perform sequence comparison and generate a virtual restriction fragment length polymorphism (RFLP) profile (5). On the basis of iPhyClassifier, the 16S rDNA sequence analysis of our isolate showed 99.2% similarity with that of the ‘Candidatus Phytoplasma australasiae’ reference strain (GenBank Accession No. Y10097), which belongs to 16Sr group II. The virtual RFLP pattern of F2n/R2 fragment was most similar to the 16SrII-D subgroup (similarity coefficient of 0.91) but showed a difference in profile with HpaI, HhaI, and MseI enzymes. Several bacterial/fungal and viral diseases have been reported on A. paniculata (3); however, to our knowledge, this is the first report of witches' broom disease in India and the first record of a 16SrII-D group phytoplasma on Kalmegh. Its presence in Kalmegh is of great significance due to its commercial interest. References: (1) S. Akbar. Altern. Med. Rev. 16:1, 2011. (2) D. E. Gundersen and M. Lee. Phytopathol. Mediterr. 35:144, 1996. (3) A. Khan and A. Samad. Plant Dis. 98:698, 2014. (4) K. Tamura et al. Mol. Biol. Evol. 28:2731, 2011. (5) Y. Zhao et al. Int. J. Syst. Evol. Microbiol. 59:2582, 2009.

scholarly journals Corrigenda: Peixoto SR, Rocha DS, Dale C, Galvão C (2020) Panstrongylus geniculatus (Latreille, 1811) (Hemiptera, Reduviidae, Triatominae): first record on Ilha Grande, Rio de Janeiro, razil.Check List 16 (2): 391–394. https://doi.org/10.15560/16.2.391

Check List ◽  
2020 ◽  
Vol 16 (4) ◽  
pp. 989-989
Author(s):  
Solange Peixoto ◽  
Dayse da Silva Rocha ◽  
Carolina Dale ◽  
Cleber Galvão
Keyword(s):  
Trypanosoma Cruzi ◽  
Chagas Disease ◽  
Disease Transmission ◽  
Rio De Janeiro ◽  
New Record ◽  
First Record ◽  
First Report ◽  
Panstrongylus Geniculatus

Panstrongylus geniculatus (Latreille, 1811) is the most widely distributed species in Brazil. This study presents the first report of this species collected inside a building in the “Centro de Estudos Ambientais e Desenvolvimento Sustentável”, at the Vila Dois Rios, Ilha Grande, Rio de Janeiro, Brazil. The new record is important to understand the risk of Chagas disease transmission, mainly because this species is commonly found infected with Trypanosoma cruzi (Chagas, 1909).

Sign in / Sign up

Export Citation Format

Share Document