scholarly journals Resistance Analysis of CRISPR/Cas9 Genome-Edited Chili M2 Mutant Lines against Pepper Yellow Leaf Curl Viral Disease

2021 ◽  
Vol 17 (1) ◽  
pp. 1
Author(s):  
Wandy Murti Prasetya ◽  
Toto Hadiarto ◽  
Wening Enggarini ◽  
Aqwin Polosoro ◽  
Suharsono Suharsono

<p>Pepper yellow leaf curl virus (PepYLCV) infection transmitted by silverleaf whitefly (Bemisia tabaci [Gennadius]) can decrease chili pepper yield up to 100%. At this moment, there is no chili pepper variety resistant to PepYLCV available. Genome editing approach through CRISPR/Cas9 is an effort to develop variety resistance to the viral infection. The purpose of this study was to obtain M2 lines developed by CRISPR/Cas9 system on proliferating cell nuclear antigen (PCNA) gene for resistance to PepYLCV. A total of four M2 lines (C47-7, L84-2, L84-23, and L120-19) consisting of 60 chili plants were tested for their resistance to PepYLCV. PCR analysis was performed to detect the presence (infection) of the virus. The results showed that a total of 35 plants derived from the four lines were resistant to PepYLCV. They consisted of 7 plants from C47-7 line, 11 plants from L84-2 line, 9 plants from L84-23 line, and 8 plants from L120-19 line. PCR analysis confirmed that the resistant plants obtained from this study were negatively infected by the virus. Since not all tested plants were resistant to virus infection, the PCNA gene allele in these resistant lines were most likely heterozigotes. Sequencing of PCNA gene of the resistant lines is needed to confirm that the resistance phenotypes obtained was due to mutation of the gene. Therefore, further selection needs to be performed to obtain stable and PepYLCV-resistant lines.</p>

2020 ◽  
Vol 16 (2) ◽  
pp. 79
Author(s):  
Devi Ayu Kurniawati ◽  
NFN Suharsono ◽  
Tri Joko Santoso

<p>Yellow leaf curl disease caused by Pepper yellow leaf curl virus (PepYLCV), member of geminiviruses group, is responsible for heavy yield losses for chili pepper production. Resistant genes which can cause immunity to the disease have not been found in germplasm collection. The aim of the research was to edit proliferating cell nuclear antigen (PCNA) gene by using CRISPR/Cas9 technology for developing plant resistance against geminivirus in chili pepper. A CRISPR/Cas9 plasmid cassette construct harboring the guide RNA of PCNA gene was constructed by Golden Gate cloning strategy. The construct was then introduced into chili genome via in planta method using Agrobacterium tumefaciens EHA105. The transformed plants were bioassayed by virus inoculation and confirmed using PCR and DNA sequencing to identify a mutagenesis event in PCNA gene target. The results showed that CRISPR/Cas9 plasmid cassette harboring gRNA of PCNA gene was successfully constructed. In planta transformation using A. tumefaciens vector harboring CRISPR/Cas9-gRNA PCNA construct resulted in 307 and 193 transformed plants from chili var. Lingga and Ciko, respectively. Bioassay by using virus inoculation to the transformed plants obtained 6 and 14 lines of Lingga and Ciko, respectively, which were resistant to geminivirus (no symptom observed). The resistant lines of chili pepper var. Lingga and Ciko were mutated in PCNA gene with one base insertion or deletion mutation types. These results exhibit that the CRISPR/Cas9 genome editing can be used to induce mutant of PCNA gene in chili pepper. Further investigation is necessary to evaluate the selected chili lines resistant to PepYLCV infection.</p>


2021 ◽  
Author(s):  
Wanyu Xiao ◽  
Xianyu Zhou ◽  
Hailong Ren ◽  
Yijia Sun ◽  
Jiwen Zou ◽  
...  

Abstract Tomato yellow leaf curl virus (TYLCV) is the dominating pathogen of tomato yellow leaf curl disease that caused severe loss to tomato production in China. In this study, we found that a TYLCV-resistant tomato line drastically reduced the accumulation of viral complementary-sense strand mRNAs but just moderately inhibit that of viral DNA and virion-sense strand mRNAs. However, two other resistant lines did not have such virus inhibition pattern. Analysis of differential expressed genes showed that the potential host defense-relevant processes varied in different resistant tomatoes, as compared to the susceptible line, suggesting a diversity of tomato TYLCV-resistance mechanisms.


2021 ◽  
Vol 22 (11) ◽  
Author(s):  
Tri Wahono Dyah Ayu Sayekti ◽  
MUHAMAD SYUKUR ◽  
SRI HENDRASTUTI HIDAYAT ◽  
AWANG MAHARIJAYA

Abstract. Sayekti TWDA, Syukur M, Hidayat SH, Maharijaya A. 2021. Morphological response and genetic variability of four species of chili pepper (Capsicum spp.) under infection of pepper yellow leaf curl virus. Biodiversitas 22: 4758-4765. Chili pepper has various types and species, but only five known species are commonly used and consumed. Most cultivated chili is susceptible to various plant diseases, one of which is Pepper yellow leaf curl disease (PYLCD) caused by Pepper yellow leaf curl virus (PYLCV) (Begomovirus, Geminiviridae). To control PYLCD, resistant variety assembly is required to prevent virus infection in cultivated plants. From this research, testing on four chili species is expected to provide information regarding the resistance and performance of chili peppers to conditions infected with PYLCV. This study was conducted at Dramaga Bogor, West Java, Indonesia in two experimental units: planting under virus-free conditions (as control) and virus-infected conditions. Each experimental unit was carried out using a single factor Randomized Complete Block Design (RCBD) with three replications. Twenty-nine genotypes of chili pepper were used consisted of four species, including C. annuum, C. frutescens, C. chinense, and C. baccatum. Of the 29 genotypes tested, thirteen genotypes in the resistant, nine genotypes in moderate resistant, two genotypes in moderate susceptible, three genotypes in the Susceptible, and two genotypes in the highly susceptible category. The heritability, genotypic coefficient of variance (GCOV) and phenotypic coefficient of variance (PCOV) value obtained from testing for all characters is high, ranging from 65.16-99.12%, 14.87-82.60%, and 15.77-84.45%, respectively. Most of the genotypes from C. chinense showed good resistance to PYLCV. In general, by considering the category of the resistance level and other characters such as productivity, ‘Jolokia’ (C. chinense), ‘Anies’ (C. annuum) and ‘Bonita’ (C. frutescens) can be ascertained as potential candidate sources of resistance to PYLCV.


Plant Disease ◽  
2008 ◽  
Vol 92 (5) ◽  
pp. 836-836 ◽  
Author(s):  
Y. Martínez-Zubiaur ◽  
E. Fiallo-Olivé ◽  
J. Carrillo-Tripp ◽  
R. Rivera-Bustamante

Whitefly-transmitted viruses have caused severe losses in tomato crops (Solanum lycopersicum) in Cuba. In 2006 and 2007, tomato greenhouses across eastern Cuba exhibited high levels of Bemisia tabaci (B biotype) infestation. Some plants showed interveinal chlorosis and a severe yellow mosaic, combined with leaf brittleness. These symptoms were different from those induced by Tomato yellow leaf curl virus (TYLCV-IL(CU)). Only 12 of 31 symptomatic samples resulted in positive PCR assays with TYLCV-specific primers (CTGAATGTTTGGATGGAAATGTGC and GCTCGTAAGTTTCCTCAACGGAC). A reverse transcription (RT)-PCR analysis for Tomato chlorosis virus (ToCV) with generic (HS-11/HS-12) and specific primers (ToC-5/ToC-6) was also carried out (2). Sequence analysis of the cloned RT-PCR products (463 bp) confirmed the presence of ToCV in Cuba. The fragment had 97 to 98% identity with GenBank isolates from Spain (DQ136146), Florida (AY903448), and Reunion Island, France (AJ968396). Cloned TYLCV and ToCV amplicons were used as probes to reanalyze the selected 31 samples by a dot-blot hybridization assay in search of mixed infections (1). The assay showed 16 samples to be positive for ToCV, 4 for TYLCV, 8 for both, and 3 samples were negative. To our knowledge, this is the first report of ToCV and TYLCV/ToCV mixed infections in Cuba. References: (1) Y. Abou-Jawdha et al. Plant Dis. 90:378, 2006. (2) C. I. Dovas et al. Plant Dis. 86:1345, 2002.


EPPO Bulletin ◽  
2002 ◽  
Vol 32 (1) ◽  
pp. 31-35
Author(s):  
A. F. Arsenio ◽  
E. Neto ◽  
N. Ramos ◽  
S. Mangerico ◽  
E. Fortunato ◽  
...  

2020 ◽  
pp. 30-34
Author(s):  
С.Ф. Гавриш ◽  
Т.А. Редичкина ◽  
А.В. Буц ◽  
Г.М. Артемьева

Дана информация об изучении коллекции гибридов F1томата (Solanum lycopersicum L.) зарубежной селекции различных фирм-оригинаторов, рекомендованных производителями семян как толерантные к вирусу желтой курчавости листьев томата. Все гибриды обладали комплексом хозяйственно ценных признаков и набором генов устойчивости к основным заболеваниям томата, в том числе к новому для юга России опасному патогену с максимальным потенциальным риском – вирусу желтой курчавости листьев томата (Tomato yellow leaf curl virus — TYLCV). Исследования проведены в 2017-2018 годах в лаборатории пасленовых культур ООО «НИИСОК» и в лаборатории молекулярной диагностики растений ООО «Семеновод». Всего было протестировано 34 гибрида F1 томата. Гибриды оценивали по совокупности хозяйственно ценных признаков, также проводили молекулярно-генетический анализ на наличие и аллельное состояние основных генов устойчивости: к вирусу табачной мозаики (Tm2а), фузариозному увяданию (I2), вертициллезному увяданию (Ve), к кладоспориозу (Cf9), нематодам (Mi1.2), вирусу бронзовости томата (Sw5), вирусу желтой курчавости листьев томата (Ty3a). Установлено, что все проанализированные гибриды томата с заявленной оригинаторами семян устойчивостью к вирусу желтой курчавости листьев были гетерозиготны по гену Ty3a. На основании проведенных исследований и с учетом требований рынка разработаны модели гибридов F1 томата юга России. Перспективный гибрид томата должен обладать индетерминантным типом роста с укороченными междоузлиями (4,5-5 см) а также хорошей облиственностью. Плоды томата должны быть с красной равномерной окраской без зеленого пятна у плодоножки, с плоскоокруглой или округлой формой плода и со средней массой 220-270 г. Для повышения транспортабельности томатов необходимо, чтобы плоды отличались высокой прочностью и характеризовались хорошей лежкостью. Урожайность гибрида томата должна быть более 30 кг/м2, а товарность - не менее 85%. Гибрид томата должен обладать следующим набором генов устойчивости в гетерозиготном состоянии: Ty3a, Mi1.2, Cf-9, а также в гомозиготном состоянии: Tm2a, I2, Ve. The article provides information on the study of the collection of F1 tomato hybrids (Solanum lycopersicumL.) of foreign breeding from various firms-originators recommended for cultivation in regions with a strong spread of tomato yellow leaf curl virus. All hybrids had a complex of economically valuable traits and a set of genes for resistance to the main diseases of tomato, including a new dangerous pathogen for the South of Russia with a maximum potential risk — the tomato yellow leaf curl virus (TYLCV). The studies were carried out in 2017-2018 in the Solanaceae Laboratory of LLC NIISOK and in the Molecular Diagnostics Laboratory of Plants of LLC Semenovod. A total of 34 F1 tomato hybrids were tested. The hybrids were assessed by a set of economically valuable traits. Molecular genetic analysis was also carried out for the presence and allelic state of the main resistance genes: Tomato mosaic virus (Tm2a), Fusarium wilt (I2), Werticillium wilt (Ve), Cladosporium fulvum (Cf9), Nematodes (Mi1.2), Tomato spotted wilt virus (Sw5), Tomato yellow leaf curl virus (Ty3a). It was found that all the analyzed tomato hybrids with the declared by seed originators resistance to yellow leaf curl virus were heterozygous for the Ty3a gene. Based on the conducted research and taking into account the market requirements, models of F1 tomato hybrids for protected ground for the South of Russia have been developed. A promising tomato hybrid should have an indeterminate growth type with shortened internodes (4.5-5 cm) and good foliage. Tomato fruits should have a uniform red color without green shoulders, with a flat-round or round shape of the fruit and with an average weight of 220-270 g. To increase the transportability of tomatoes, it is necessary that the fruits are highly firm and characterized by good shelf life. The yield of tomato hybrid should be more than 30 kg/m2, and marketability should be at least 85%. The tomato hybrid should have the following set of resistance genes in a heterozygous state: Ty3a, Mi1.2, Cf-9, and also in a homozygous state: Tm2a, I2, Ve.


Microbiology ◽  
2010 ◽  
Vol 156 (11) ◽  
pp. 3386-3397 ◽  
Author(s):  
Changyi Zhang ◽  
Li Guo ◽  
Ling Deng ◽  
Yuanxin Wu ◽  
Yunxiang Liang ◽  
...  

Organisms belonging to the Crenarchaeota lineage contain three proliferating cell nuclear antigen (PCNA) subunits, while those in the Euryarchaeota have only one, as for Eukarya. To study the mechanism of archaeal sliding clamps, we sought to generate knockouts for each pcna gene in Sulfolobus islandicus, a hyperthermophilic crenarchaeon, but failed with two conventional knockout methods. Then, a new knockout scheme, known as marker insertion and target gene deletion (MID), was developed, with which transformants were obtained for each pMID-pcna plasmid. We found that mutant cells persisted in transformant cultures during incubation of pMID-pcna3 and pMID-araS-pcna1 transformants under counter selection. Studying the propagation of mutant cells by semiquantitative PCR analysis of the deleted target gene allele (Δpcna1 or Δpcna3) revealed that mutant cells could no longer be propagated, demonstrating that these pcna genes are absolutely required for host cell viability. Because the only prerequisite for this assay is the generation of a MID transformant, this approach can be applied generally to any micro-organisms proficient in homologous recombination.


Sign in / Sign up

Export Citation Format

Share Document