scholarly journals Understanding Citrus Greening Disease and Its Possible Management Strategies in Nepal

2021 ◽  
Vol 9 (4) ◽  
pp. 227-234
Author(s):  
Sameer Pokhrel ◽  
Swikriti Pandey ◽  
Ashish Ghimire ◽  
Savyata Kandel

Huanglongbing (HLB), also known as citrus greening, is a devastating disease of citrus that has decimated several citrus orchards throughout the world. The disease is associated with three species of unculturable and phloem-limited bacteriae, Candidatus Liberibacter asiaticus, Candidatus Liberibacter africanus and Candidatus Liberibacter americanus. The most common species of bacteria found in Nepal is Candidatus Liberibacter asiaticus which is transmitted by an insect vector, Asian citrus psyllid (Diaphorina citri). This disease has been detected in several economically important citrus production areas of Nepal, which resulted in heavy yield loss. No cure for the disease has been discovered yet and it is essential to practice proper management strategies to maintain citrus health and sustain citrus production under HLB pressure. Several disease management approaches such as pathogen-free nursery establishment, use of disease tolerant rootstock cultivars, proper irrigation and nutrient supply, removal of HLB affected trees, and control of psyllid with frequent insecticide application are widely practiced throughout the world. This review article highlights the characteristics of the citrus greening disease and its insect vector and gives insights into their management techniques. Several technologically advanced options available to minimize the HLB infection might not be feasible currently in Nepal due to economic and topographic constraints. This article also aims to bring into focus the cost-effective methods that growers in Nepal can practice to mitigate the impact of HLB disease in their citrus orchards. Int. J. Appl. Sci. Biotechnol. Vol 9(4): 227-238.

Plant Disease ◽  
2016 ◽  
Vol 100 (6) ◽  
pp. 1080-1086 ◽  
Author(s):  
Greg McCollum ◽  
Mark Hilf ◽  
Mike Irey ◽  
Weiqi Luo ◽  
Tim Gottwald

Huanglongbing (HLB) disease is the most serious threat to citrus production worldwide and, in the last decade, has devastated the Florida citrus industry. In the United States, HLB is associated with the phloem-limited α-proteobacterium ‘Candidatus Liberibacter asiaticus’ and its insect vector, the Asian citrus psyllid (ACP; Diaphorina citri). Significant effort is being put forth to develop novel citrus germplasm that has a lower propensity to succumb to HLB than do currently available varieties. Effective methods of screening citrus germplasm for susceptibility to HLB are essential. In this study, we exposed small, grafted trees of 16 citrus types to free-ranging ACP vectors and ‘Ca. L. asiaticus’ inoculum in the greenhouse. During 45 weeks of exposure to ACP, the cumulative incidence of ‘Ca. L. asiaticus’ infection was 70%. Trees of Citrus macrophylla and C. medica were most susceptible to ‘Ca. L. asiaticus’, with 100% infection by the end of the test period in three trials, while the complex genetic hybrids ‘US 1-4-59’ and ‘Fallglo’ consistently were least susceptible, with approximately 30% infection. Results obtained in this greenhouse experiment showed good agreement with trends observed in the orchard, supporting the validity of our approach for screening citrus germplasm for susceptibility to HLB.


Insects ◽  
2020 ◽  
Vol 11 (8) ◽  
pp. 469
Author(s):  
Inaiara de Souza Pacheco ◽  
Diogo Manzano Galdeano ◽  
João Roberto Spotti Lopes ◽  
Marcos Antonio Machado

‘Candidatus Liberibacter asiaticus’ (CLas) is a major causal agent of citrus Huanglongbing (HLB), which is transmitted by Asian citrus psyllid (ACP), Diaphorina citri, causing severe losses in various regions of the world. Vector efficiency is higher when acquisition occurs by ACP immature stages and over longer feeding periods. In this context, our goal was to evaluate the progression of CLas population and infection rate over four ACP generations that continuously developed on infected citrus plants. We showed that the frequency of CLas-positive adult samples increased from 42% in the parental generation to 100% in the fourth generation developing on CLas-infected citrus. The bacterial population in the vector also increased over generations. This information reinforces the importance of HLB management strategies, such as vector control and eradication of diseased citrus trees, to avoid the development of CLas-infected ACP generations with higher bacterial loads and, likely, a higher probability of spreading the pathogen in citrus orchards.


2021 ◽  
Author(s):  
Maria Cândida de Godoy Gasparoto ◽  
Isabela Vescove Primiano ◽  
Renato Bassanezi ◽  
Silvia Afonseca Lourenço ◽  
Luiz Montesino ◽  
...  

In Brazil, citrus huanglongbing (HLB) is associated with ‘Candidatus Liberibacter americanus’ (CLam) and ‘Ca. Liberibacter asiaticus’ (CLas). However, there are few studies about HLB epidemiology when both Liberibacter spp. and its insect vector, the Asian citrus psyllid (ACP, Diaphorina citri), are present. The objective of this work was to compare the transmission of HLB by ACP when both CLam and CLas are present as primary inoculum. Two experiments were performed under screenhouse conditions from April 2008 to January 2012 (experiment 1) and from February 2011 to December 2015 (experiment 2). The experiments were carried out with sweet orange plants infected with CLam or CLas as inoculum source surrounded by sweet orange healthy plants. One hundred Liberibacter-free adult psyllids were monthly confined to the source of inoculum plants for 7 days with subsequent free movement inside the screenhouse. Fortnightly, nymphs and adults of psyllids were monitored. Psyllid and leaf samples were collected periodically for Liberibacter detection by PCR or qPCR. CLas was detected more frequently than CLam in both psyllid and leaf samples. No mixed infections were detected in the psyllids. A clear prevalence of CLas over CLam was observed in both experiments. The final HLB incidences were 16.7 and 14.5% of Liberibacter-positive test plants, and CLas was detected in 92.3 and 93.1% of these infected plants. Mixed infection was observed only in 3.8% of infected test plants in experiment 1. These results endorse the shift in the prevalence of CLam to CLas observed in citrus orchards of São Paulo, Brazil.


2010 ◽  
Vol 100 (6) ◽  
pp. 567-572 ◽  
Author(s):  
J. Chen ◽  
X. Deng ◽  
X. Sun ◽  
D. Jones ◽  
M. Irey ◽  
...  

Huanglongbing (HLB) (yellow shoot disease) is a highly destructive disease that threatens citrus production worldwide. The disease was first observed in Guangdong, P.R. China, over 100 years ago, and was found in Florida, United States, in 2005. ‘Candidatus Liberibacter asiaticus’ has been associated with HLB in many citrus-growing regions around the world, including Guangdong and Florida. The global epidemiology of HLB, as well as management of the disease, relies on knowledge of ‘Ca. L. asiaticus’ populations in different geographical regions around the world. In this study, we identified a genetic marker containing small tandem repeats in the genome of ‘Ca. L. asiaticus’ and comparatively analyzed the tandem repeat numbers (TRNs) in ‘Ca. L. asiaticus’ populations from Guangdong and Florida. Analyses of TRNs showed that the bacterial population in Guangdong was different from that in Florida. The Guangdong population consisted predominately of strains with a TRN of 7 (TRN7) at a frequency of 47.6%. The Florida population consisted predominately of strains with a TRN of 5 (TRN5) at a frequency of 84.4%. TRNs ranged from 3 to 16. The apparent absence of TRNs of 9, 10, 11, and 12 separated the bacterial strains into two groups: TRNs < 10 (TRN<10) and TRNs > 10 (TRN>10). In Florida, TRN<10 strains (103/109, or 94.5%) were widely distributed in all HLB-affected counties. TRN>10 strains (6/109, or 5.5%) were found in central Florida. This is the first report documenting the differentiation of ‘Ca. L. asiaticus’ populations between Asia and North America and the possible presence of two differentially distributed genotypes of ‘Ca. L. asiaticus’ in Florida.


Plant Disease ◽  
2003 ◽  
Vol 87 (4) ◽  
pp. 448-448 ◽  
Author(s):  
Y. S. Ahlawat ◽  
V. K. Baranwal ◽  
Thinlay ◽  
Doe Doe ◽  
S. Majumder

During July 2002, surveys of mandarin orchards were conducted in Punakha Valley and Wangdue districts of Bhutan. Symptoms of the greening disease were observed in most of the orchard. The incidence of disease was recorded up to 30% in 24 private orchards with more than 5,000 trees total. Affected trees were generally stunted with leaves showing symptoms of mottling. Sometimes, symptoms were seen only on one part of the canopy. The greening disease is caused by a fastidious phloem restricted bacterium, “Candidatus Liberibacter asiaticus” in Asian countries and “Candidatus Liberibacter africanus” in African countries. To confirm the presence of this bacterium causing greening disease in Bhutan, 33 leaf samples were collected from seven locations in Bhutan and stored at -80°C. Petioles and midribs were used for extraction of DNA using DNeasy Plant Mini Kit (Qiagen Gmbh, Hilden, Germany). Polymerase chain reaction (PCR) was initially performed with a sample from Rimchu, Bhutan using primer pair 5′TATAAAGGTTGACCTTTCGAGTTT/5′ACAAAAGCAGAAATAGCACGAACAA previously designed for amplification of ribosomal protein genes of β-operon of two liberibacter species (1). An amplicon of approximately 700 bp was obtained. The size of the PCR product is similar to that amplified from “Candidatus Liberibacter asiaticus”. The amplicon was cloned in pGEM-T easy vector and sequenced. The clone was 703 nt long and showed 100% sequence homology with the corresponding sequence of “Candidatus Liberibacter asiaticus” confirming that “Candidatus Liberibacter asiaticus” is the cause of greening disease in Bhutan. Later, one sample from each location was analyzed and found to be positive to greening. To our knowledge, this is the first report of this bacterium and greening disease in Bhutan, and citrus greening appears to be the main cause of declining citrus in the Punakha Region of Bhutan. Reference: (1) A. Jocquellet et al. Page 363 in: Proc. Conf. Int. Organ. Citrus Virol. 14th. IOCV, Riverside, CA, 2000.


2020 ◽  
Vol 18 (3) ◽  
pp. 529-541
Author(s):  
Ho Thi Thuong ◽  
Nguyen Thi Thom ◽  
Nguyen Thi Tra ◽  
Trinh Thai Vy ◽  
Pham Bich Ngoc ◽  
...  

Citrus Greening, also known as HuangLongbing (HLB), is considered one of the most dangerous citrus diseases, and limiting the production of citrus trees all over the world. Production of antibodies against Ompa protein of Candidatus Liberibacter asiaticus (CLas) for detection of citrus greening disease is considered as promising research direction. In this study, for the purpose of producting antibodies against Ompa of CLas, we firstly used the camel VHH antibody library for screening VHH antibodies against Ompa using phage-display technique. Next, phages which had strong interaction with Ompa as shown in ELISA were selected for phagemid isolation and the DNA fragments encoding VHH antibodies were sequenced. The DNA fragment encoding the best VHH antibody was then selected and inserted into the expression vector pET-21a (+), then cloned in Ecoli DH5α strain and expressed in BL21 (DE3) strain. The expression of VHH antibodies against Ompa was optimized at different temperatures with an inductive concentration of 0.1 M IPTG. Anti-Ompa VHH antibodies were purified under denatured conditions then re-folded. The biological activity of the VHH antibody with Ompa antigen was assessed by indirect-ELISA reaction. Results indicated that the VHH antibody had a very strong interaction with the Ompa antigen. This opens up the prospect of applying VHH antibody in the detection of citrus greening disease.


Sign in / Sign up

Export Citation Format

Share Document