scholarly journals Small RNA Profiling of Susceptible and Resistant Ty-1 Encoding Tomato Plants Upon Tomato Yellow Leaf Curl Virus Infection

2021 ◽  
Vol 12 ◽  
Author(s):  
Corien M. Voorburg ◽  
Yuling Bai ◽  
Richard Kormelink
Keyword(s):  
Gene Silencing ◽  
Cytosine Methylation ◽  
Tomato Yellow Leaf ◽  
Transcriptional Gene Silencing ◽  
Viral Gene ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
Susceptible Tomato ◽  
Leaf Curl Virus ◽  
Leaf Curl

Ty-1 presents an atypical dominant resistance gene that codes for an RNA-dependent RNA polymerase (RDR) of the gamma class and confers resistance to tomato yellow leaf curl virus (TYLCV) and other geminiviruses. Tomato lines bearing Ty-1 not only produce relatively higher amounts of viral small interfering (vsi)RNAs, but viral DNA also exhibits a higher amount of cytosine methylation. Whether Ty-1 specifically enhances posttranscriptional gene silencing (PTGS), leading to a degradation of RNA target molecules and primarily relying on 21–22 nucleotides (nts) siRNAs, and/or transcriptional gene silencing (TGS), leading to the methylation of cytosines within DNA target sequences and relying on 24-nts siRNAs, was unknown. In this study, small RNAs were isolated from systemically TYLCV-infected leaves of Ty-1 encoding tomato plants and susceptible tomato Moneymaker (MM) and sequence analyzed. While in susceptible tomato plants vsiRNAs of the 21-nt size class were predominant, their amount was drastically reduced in tomato containing Ty-1. The latter, instead, revealed elevated levels of vsiRNAs of the 22- and 24-nt size classes. In addition, the genomic distribution profiles of the vsiRNAs were changed in Ty-1 plants compared with those from susceptible MM. In MM three clear hotspots were seen, but these were less pronounced in Ty-1 plants, likely due to enhanced transitive silencing to neighboring viral genomic sequences. The largest increase in the amount of vsiRNAs was observed in the intergenic region and the V1 viral gene. The results suggest that Ty-1 enhances an antiviral TGS response. Whether the elevated levels of 22 nts vsiRNAs contribute to an enhanced PTGS response or an additional TGS response involving a noncanonical pathway of RNA dependent DNA methylation remains to be investigated.

scholarly journals V2 of tomato yellow leaf curl virus can suppress methylation-mediated transcriptional gene silencing in plants

2014 ◽  
Vol 95 (1) ◽  
pp. 225-230 ◽  
Author(s):  
Bi Wang ◽  
Fangfang Li ◽  
Changjun Huang ◽  
Xiuling Yang ◽  
Yajuan Qian ◽  
...  
Keyword(s):  
Gene Silencing ◽  
Fluorescent Protein ◽  
Methylation Status ◽  
Promoter Sequence ◽  
Tomato Yellow Leaf ◽  
Transcriptional Gene Silencing ◽  
35S Promoter ◽  
Yellow Leaf ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV) is a DNA virus belonging to the genus Begomovirus. TYLCV replicates using double-stranded DNA intermediates that can become the target of plant transcriptional gene silencing (TGS). Here, we show that the V2 protein of TYLCV can suppress TGS of a transcriptionally silenced green fluorescent protein (GFP) transgene in Nicotiana benthamiana line 16-TGS. Through bisulfite sequencing and chop-PCR, we demonstrated that the TYLCV V2 can reverse GFP transgene silencing by reducing the methylation levels in the 35S promoter sequence. Both AtSN1 and MEA-ISR loci in Arabidopsis thaliana were previously reported to be strongly methylated, and we show that the methylation status of both loci was significantly reduced in TYLCV V2 transgenic Arabidopsis plants. We conclude that TYLCV can efficiently suppress TGS when it infects plants, and its V2 protein is responsible for the TGS suppression activity.

scholarly journals First Report of Tomato yellow leaf curl virus in South Carolina

Plant Disease ◽  
2006 ◽  
Vol 90 (3) ◽  
pp. 379-379 ◽  
Author(s):  
K. S. Ling ◽  
A. M. Simmons ◽  
R. L. Hassell ◽  
A. P. Keinath ◽  
J. E. Polston
Keyword(s):  
South Carolina ◽  
The United States ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
First Report ◽  
Pcr Products ◽  
Primer Sequence ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of “across-state” distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

scholarly journals First Report of TYLCV-IS141, a Tomato Yellow Leaf Curl Virus Recombinant Infecting Tomato Plants Carrying the Ty-1 Resistance Gene in Sardinia (Italy)

Plant Disease ◽  
2019 ◽  
Vol 103 (6) ◽  
pp. 1437-1437 ◽  
Author(s):  
M. Granier ◽  
L. Tomassoli ◽  
A. Manglli ◽  
M. Nannini ◽  
M. Peterschmitt ◽  
...  
Keyword(s):  
Resistance Gene ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
First Report ◽  
Virus Recombinant ◽  
Leaf Curl Virus ◽  
Leaf Curl

Whitefly-mediated transmission and subsequent acquisition of highly similar and naturally occurring Tomato yellow leaf curl virus variants

2021 ◽  
Author(s):  
Wendy Marchant ◽  
Saurabh Gautam ◽  
Bhabesh Dutta ◽  
Rajagopalbab Srinivasan
Keyword(s):  
Amino Acids ◽  
Mixed Infection ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Plant Interactions ◽  
Tomato Plants ◽  
Individual Host ◽  
Field Samples ◽  
Leaf Curl Virus ◽  
Leaf Curl

Begomoviruses are whitefly-transmitted viruses that infect many agricultural crops. Numerous reports exist on individual host plants harboring two or more begomoviruses. Mixed infection allows recombination events to occur among begomoviruses. However, very few studies have examined mixed infection of different isolates/variants/strains of a Begomovirus species in hosts. In this study, the frequency of mixed infection of tomato yellow leaf curl virus (TYLCV) variants in field-grown tomato was evaluated. At least 60% of symptomatic field samples were infected with more than one TYLCV variant. These variants differed by a few nucleotides and amino acids resembling a quasispecies. Subsequently, in the greenhouse, single and mixed infection of two TYLCV variants (“variant #2” and “variant #4”) that shared 99.5% nucleotide identity and differed by a few amino acids was examined. Plant-virus variant-whitefly interactions including transmission of one and/or two variants, variants’ concentrations, competition between variants in inoculated tomato plants, and whitefly acquisition of one and/or two variants were assessed. Whiteflies transmitted both variants to tomato plants at similar frequencies; however, the accumulation of variant #4 was greater than variant#2 in tomato plants. Despite differences in variants’ accumulation in inoculated tomato plants, whiteflies acquired variant #2 and variant #4 at similar frequencies. Also, whiteflies acquired greater amounts of TYLCV from singly-infected plants than from mixed-infected plants. These results demonstrated that even highly similar TYLCV variants could differentially influence component (whitefly-variant-plant) interactions.

Interaction between ‘Candidatus Phytoplasma australasiae’ and Tomato yellow leaf curl virus in tomato plants

2020 ◽  
Vol 158 (3) ◽  
pp. 733-744
Author(s):  
Nazanin Ebadi ◽  
Gilda Najafipour ◽  
Mohammad Mehdi Faghihi ◽  
Kavous Ayazpour ◽  
Mohammad Salehi
Keyword(s):  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
Leaf Curl Virus ◽  
Leaf Curl
Sign in / Sign up

Export Citation Format

Share Document