scholarly journals Functionally Antagonistic Transcription Factors IRF1 and IRF2 Regulate the Transcription of the Dopamine Receptor D2 Gene Associated with Aggressive Behavior of Weaned Pigs

Biology ◽  
2022 ◽  
Vol 11 (1) ◽  
pp. 135
Author(s):  
Jing Zhao ◽  
Siyuan Gao ◽  
Yanli Guo ◽  
Qinglei Xu ◽  
Mingzheng Liu ◽  
...  
Keyword(s):  
Transcription Factors ◽  
Aggressive Behavior ◽  
Dopamine Receptor ◽  
Negative Effects ◽  
Drd2 Gene ◽  
Single Nucleotide ◽  
Dopamine Receptor D2 ◽  
Interferon Regulatory Factor 1 ◽  
Functional Single Nucleotide Polymorphism ◽  
Dopamine Signal

Aggressive behavior has negative effects on animal welfare and growth performance in pigs. The dopamine receptor D2 (DRD2) has a critical neuromodulator role in the dopamine signal pathway within the brain to control behavior. A functional single-nucleotide polymorphism (SNP), rs1110730503, in the promoter region of the porcine DRD2 gene was identified, which affects aggressive behavior in pigs. A chromatin immunoprecipitation (ChIP) assay was used to identify the interactions between interferon regulatory factor 1 (IRF1) and IRF2 with the DRD2 gene. The overexpression or knockdown of these two transcription factors in porcine kidney-15 (PK15) and porcine neuronal cells (PNCs) indicate that the binding of IRF1 to DRD2 promotes the transcription of the DRD2 gene, but the binding of IRF2 to the DRD2 gene inhibits its transcription. Furthermore, IRF1 and IRF2 are functionally antagonistic to each other. The downregulation of DRD2 or upregulation of IRF2 increased the apoptosis rate of porcine neuroglial cells. Taken together, we found that transcriptional factors IRF1 and IRF2 have vital roles in regulating the transcription of the DRD2 gene, and rs1110730503 (−915A/T) is a functional SNP that influences IRF2 binding to the promoter of the DRD2 gene. These findings will provide further insight towards controlling aggressive behavior in pigs.

scholarly journals Dopamine Receptor D2 Gene (DRD2) Polymorphisms, Job Stress, and Their Interaction on Sleep Dysfunction

2020 ◽  
Vol 17 (21) ◽  
pp. 8174
Author(s):  
Yu Jiang ◽  
Baoying Liu ◽  
Chuancheng Wu ◽  
Xiaoyan Gao ◽  
Yaoqin Lu ◽  
...  
Keyword(s):  
Dopamine Receptor ◽  
Job Stress ◽  
Quality Index ◽  
Pittsburgh Sleep Quality Index ◽  
Significant Negative Correlation ◽  
Drd2 Gene ◽  
Sleep Dysfunction ◽  
Dopamine Receptor D2 ◽  
Effort Reward Imbalance ◽  
Reward Imbalance

Recent studies have shown that incessant job stress could eventually result in sleep dysfunction (SD), and most importantly, the essential role dopamine receptor D2 (DRD2) gene polymorphisms play in the psychopathological mechanism of SD. The Effort-Reward Imbalance scale and the Pittsburgh Sleep Quality Index were both used to access SD and job stress (JS). A significant negative correlation was observed between the sDA levels and SD subscale scores (sleep efficiency, daytime dysfunction). The findings revealed that high levels of JS were linked to a higher SD score (OR = 2.13, 95% CI: 1.46–3.12). Likewise, the homozygous A1A1 genotype of DRD2 rs1800497 was more likely to be associated with SD (OR = 2.90, 95% CI: 1.75–4.82). Compared to participants with low JS and heterozygous A1A2/A2A2 genotype, those with both high JS and homozygous A1A1 genotype had a higher SD score (OR = 5.40, 95% CI: 2.89–10.11). The A1 allele of the DRD2 rs1800497 polymorphism also enhances the likelihood of SD when undergoing JS. Besides, subjects with low JS and the homozygous A1A1 genotype also showed an increased possibility for sleep dysfunction (OR = 2.05, 95% CI: 1.03–4.11). Our results suggest that the DA system may interrelate with JS to affect sleep.

Association of steroid 17-alpha-hydroxylase/17,20 lyase (CYP17) single nucleotide polymorphism (SNP) 628 and dopamine receptor D2 (DRD2) SNP939 genotypes with sheep reproductive performance

2019 ◽  
Vol 31 (4) ◽  
pp. 743
Author(s):  
Xiaoyan Qiu ◽  
Xiong Xiao ◽  
Nan Li ◽  
Wenhui Ling ◽  
Mingyu Wang ◽  
...  
Keyword(s):  
Single Nucleotide Polymorphism ◽  
Dopamine Receptor ◽  
Reproductive Performance ◽  
Maternal Behaviour ◽  
Multiple Gestation ◽  
Nucleotide Polymorphism ◽  
Single Nucleotide ◽  
Merino Sheep ◽  
Dopamine Receptor D2 ◽  
Potential Marker

In a previous study we investigated the association between two single nucleotide polymorphism (SNP) genotypes, namely steroid 17-alpha-hydroxylase/17,20 lyase (CYP17) SNP628 and dopamine receptor D2 (DRD2) SNP939, with two temperaments (calm and nervous) in Australian Merino sheep and concluded that the DRD2 SNP939 T/T genotype combined with the CYP17 SNP628 G/G genotype is associated with a calm temperament and could be used as a potential marker for calm sheep, whereas the DRD2 SNP939C allele combined with the CYP17 SNP628 A/A genotype is associated with a nervous temperament and could be used as a potential marker for nervous sheep. In sheep, the association between temperament and reproductive performance has been determined, but the association of these two SNP genotypes with sheep reproduction has not been investigated. Therefore, using Chinese Sinkiang Merino sheep, the present study investigated the association of the two CYP17 SNP628 and DRD2 SNP939 genotypes with sheep reproductive performance. Sheep with the DRD2 SNP939 T/T genotype combined with the CYP17 SNP628 G/G genotype had a higher ovulation rate, multiple gestation rate, better maternal behaviour and lower lamb mortality. Thus, the results of this study contribute to our knowledge of the association between genotypes and reproduction in sheep, which is beneficial for sheep genetics and breeding.

Single nucleotide polymorphisms in dopamine receptor D2 are associated with bruxism and its circadian phenotypes in children

CRANIO® ◽  
2019 ◽  
pp. 1-8
Author(s):  
Rafaela Scariot ◽  
Leonardo Brunet ◽  
Bernardo Olsson ◽  
Marcelo Palinkas ◽  
Simone Cecilio Hallak Regalo ◽  
...  
Keyword(s):  
Single Nucleotide Polymorphisms ◽  
Dopamine Receptor ◽  
Nucleotide Polymorphisms ◽  
Single Nucleotide ◽  
Dopamine Receptor D2

The human dopamine receptor D2 (DRD2) gene is associated with tardive dyskinesia in patients with schizophrenia

2006 ◽  
Vol 86 (1-3) ◽  
pp. 323-325 ◽  
Author(s):  
Ying-Jay Liou ◽  
I-Ching Lai ◽  
Ding-Lieh Liao ◽  
Jen-Yeu Chen ◽  
Ya-Mei Bai ◽  
...  
Keyword(s):  
Tardive Dyskinesia ◽  
Dopamine Receptor ◽  
Drd2 Gene ◽  
Dopamine Receptor D2

scholarly journals Determination of dopamine receptor D2 gene rs1800497 polymorphism using real-time polymerase chain reaction

2019 ◽  
Vol 72 (3-4) ◽  
pp. 110-114
Author(s):  
Katarina Baculov ◽  
Natasa Vucinic ◽  
Jelena Stojcevic-Maletic ◽  
Iva Barjaktarovic
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Dopamine Receptor ◽  
Sensation Seeking ◽  
Deoxyribonucleic Acid ◽  
Receptor Expression ◽  
Chain Reaction ◽  
Single Nucleotide ◽  
Dopamine Receptor D2 ◽  
Polymerase Chain

Introduction. After analyzing a specific nucleotide sequence, located near the dopamine receptor D2 gene, rs1800497 polymorphism was detected, that affects dopamine D2 receptor expression, its density and affinity. This polymorphism is associated with many disorders such as: aggressive behavior, response to stress, sensation seeking, impulsivity, extraversion, anger, random memory, impaired cognitive function, brain glucose metabolism, obesity, pathologic gambling, substance addiction, depression, schizophrenia, that are related to modified gene expression, receptor density and affinity. Due to this association, a considerable interest in detecting a reliable dopamine receptor D2 gene allele was developed. The aim of this paper is optimization of real-time polymerase chain reaction in genotyping dopamine receptor D2 gene rs1800497 polymorphism. Material and Methods. Deoxyribonucleic acid was extracted from the blood of ten healthy individuals. Deoxyribonucleic acid samples were genotyped for dopamine receptor D2 gene rs1800497 (context sequence part containing targeted single nucleotide polymorphism CACAGCCATCCTCAAAGTGCTGGTC[A/G]AG?GCAGGCGCCCAGCTGGACGTCCA) by polymerase chain reaction. The TaqMan assays were used to determine single-nucleotide polymorphisms. The products of amplification were analyzed using Applied Biosystems 7500 fast real-time polymerase chain reaction instrument. Results. After a successful polymerase chain reaction, two alleles that differed in one nucleotide were detected in our samples. Conclusion. Even though it is financially more demanding, real-time polymerase chain reaction method is recommended for dopamine receptor D2 gene genotyping in routine diagnostics because it is simple, accurate, and fast.

Sign in / Sign up

Export Citation Format

Share Document