scholarly journals Understanding the Origin of Structural Diversity of DNA Double Helix

Computation ◽  
2021 ◽  
Vol 9 (9) ◽  
pp. 98
Author(s):  
Valeri Poltev ◽  
Victor M. Anisimov ◽  
Veronica Dominguez ◽  
Andrea Ruiz ◽  
Alexandra Deriabina ◽  
...  
Keyword(s):  
Double Helix ◽  
3D Structure ◽  
Structural Diversity ◽  
Local Energy ◽  
Single Chain ◽  
Sequence Dependence ◽  
Torsion Angles ◽  
Sequence Dependent ◽  
Phosphate Backbone ◽  
Dna Double Helix

Deciphering the contribution of DNA subunits to the variability of its 3D structure represents an important step toward the elucidation of DNA functions at the atomic level. In the pursuit of that goal, our previous studies revealed that the essential conformational characteristics of the most populated “canonic” BI and AI conformational families of Watson–Crick duplexes, including the sequence dependence of their 3D structure, preexist in the local energy minima of the elemental single-chain fragments, deoxydinucleoside monophosphates (dDMPs). Those computations have uncovered important sequence-dependent regularity in the superposition of neighbor bases. The present work expands our studies to new minimal fragments of DNA with Watson–Crick nucleoside pairs that differ from canonic families in the torsion angles of the sugar-phosphate backbone (SPB). To address this objective, computations have been performed on dDMPs, cdDMPs (complementary dDMPs), and minimal fragments of SPBs of respective systems by using methods of molecular and quantum mechanics. These computations reveal that the conformations of dDMPs and cdDMPs having torsion angles of SPB corresponding to the local energy minima of separate minimal units of SPB exhibit sequence-dependent characteristics representative of canonic families. In contrast, conformations of dDMP and cdDMP with SPB torsions being far from the local minima of separate SPB units exhibit more complex sequence dependence.

DNA mimicry by proteins

2006 ◽  
Vol 34 (2) ◽  
pp. 317-319 ◽  
Author(s):  
D.T.F. Dryden ◽  
M.R. Tock
Keyword(s):  
Double Helix ◽  
Restriction Enzymes ◽  
Repair Enzymes ◽  
Phosphate Backbone ◽  
Dna Mimicry ◽  
Associated Proteins ◽  
Bonding Properties ◽  
Dna Restriction ◽  
Dna Double Helix ◽  
Dna Restriction Enzymes

It has been discovered recently, via structural and biophysical analyses, that proteins can mimic DNA structures in order to inhibit proteins that would normally bind to DNA. Mimicry of the phosphate backbone of DNA, the hydrogen-bonding properties of the nucleotide bases and the bending and twisting of the DNA double helix are all present in the mimics discovered to date. These mimics target a range of proteins and enzymes such as DNA restriction enzymes, DNA repair enzymes, DNA gyrase and nucleosomal and nucleoid-associated proteins. The unusual properties of these protein DNA mimics may provide a foundation for the design of targeted inhibitors of DNA-binding proteins.

scholarly journals Double-stranded RNA bending by AU-tract sequences

2020 ◽  
Vol 48 (22) ◽  
pp. 12917-12928
Author(s):  
Alberto Marin-Gonzalez ◽  
Clara Aicart-Ramos ◽  
Mikel Marin-Baquero ◽  
Alejandro Martín-González ◽  
Maarit Suomalainen ◽  
...  
Keyword(s):  
Nucleotide Sequence ◽  
Double Helix ◽  
Structural Features ◽  
Sequence Motif ◽  
Microscopy Imaging ◽  
Rna Nanotechnology ◽  
Sequence Dependent ◽  
Structural Deformations ◽  
Dynamics Simulations ◽  
Dna Double Helix

Abstract Sequence-dependent structural deformations of the DNA double helix (dsDNA) have been extensively studied, where adenine tracts (A-tracts) provide a striking example for global bending in the molecule. However, in contrast to dsDNA, sequence-dependent structural features of dsRNA have received little attention. In this work, we demonstrate that the nucleotide sequence can induce a bend in a canonical Watson-Crick base-paired dsRNA helix. Using all-atom molecular dynamics simulations, we identified a sequence motif consisting of alternating adenines and uracils, or AU-tracts, that strongly bend the RNA double-helix. This finding was experimentally validated using atomic force microscopy imaging of dsRNA molecules designed to display macroscopic curvature via repetitions of phased AU-tract motifs. At the atomic level, this novel phenomenon originates from a localized compression of the dsRNA major groove and a large propeller twist at the position of the AU-tract. Moreover, the magnitude of the bending can be modulated by changing the length of the AU-tract. Altogether, our results demonstrate the possibility of modifying the dsRNA curvature by means of its nucleotide sequence, which may be exploited in the emerging field of RNA nanotechnology and might also constitute a natural mechanism for proteins to achieve recognition of specific dsRNA sequences.

scholarly journals Sequence-Dependent T:G Base Pair Opening in DNA Double Helix Bound by Cren7, a Chromatin Protein Conserved among Crenarchaea

PLoS ONE ◽  
2016 ◽  
Vol 11 (9) ◽  
pp. e0163361 ◽  
Author(s):  
Lei Tian ◽  
Zhenfeng Zhang ◽  
Hanqian Wang ◽  
Mohan Zhao ◽  
Yuhui Dong ◽  
...  
Keyword(s):  
Base Pair ◽  
Double Helix ◽  
Chromatin Protein ◽  
Sequence Dependent ◽  
Dna Double Helix ◽  
Base Pair Opening

Sequence-dependent conformation of an A-DNA double helix

1983 ◽  
Vol 166 (2) ◽  
pp. 183-201 ◽  
Author(s):  
Z. Shakked ◽  
D. Rabinovich ◽  
O. Kennard ◽  
W.B.T. Cruse ◽  
S.A. Salisbury ◽  
...  
Keyword(s):  
Double Helix ◽  
Sequence Dependent ◽  
Dna Double Helix

scholarly journals Pattern preferences of DNA nucleotide motifs by polyamines putrescine2+, spermidine3+ and spermine4+

2019 ◽  
Vol 47 (12) ◽  
pp. 6084-6097 ◽  
Author(s):  
Sergiy Perepelytsya ◽  
Jozef Uličný ◽  
Aatto Laaksonen ◽  
Francesca Mocci
Keyword(s):  
Driving Force ◽  
Electrostatic Interactions ◽  
Double Helix ◽  
Minor Groove ◽  
Residence Times ◽  
Sequence Dependence ◽  
Pattern Preference ◽  
Dna Fragment ◽  
Dynamics Simulations ◽  
Dna Double Helix

Abstract The interactions of natural polyamines (putrescine2+, spermidine3+ and spermine4+) with DNA double helix are studied to characterize their nucleotide sequence pattern preference. Atomistic Molecular Dynamics simulations have been carried out for three systems consisting of the same DNA fragment d(CGCGAATTCGCGAATTCGCG) with different polyamines. The results show that polyamine molecules are localized with well-recognized patterns along the double helix with different residence times. We observed a clear hierarchy in the residence times of the polyamines, with the longest residence time (ca 100ns) in the minor groove. The analysis of the sequence dependence shows that polyamine molecules prefer the A-tract regions of the minor groove – in its narrowest part. The preferable localization of putrescine2+, spermidine3+ and spermine4+ in the minor groove with A-tract motifs is correlated with modulation of the groove width by a specific nucleotide sequences. We did develop a theoretical model pointing to the electrostatic interactions as the main driving force in this phenomenon, making it even more prominent for polyamines with higher charges. The results of the study explain the specificity of polyamine interactions with A-tract region of the DNA double helix which is also observed in experiments.

scholarly journals Sequence-Dependent Basepair Opening in DNA Double Helix

2006 ◽  
Vol 90 (9) ◽  
pp. 3091-3099 ◽  
Author(s):  
Andrew Krueger ◽  
Ekaterina Protozanova ◽  
Maxim D. Frank-Kamenetskii
Keyword(s):  
Double Helix ◽  
Sequence Dependent ◽  
Dna Double Helix

Protamine-DNA interaction

1978 ◽  
Vol 36 (2) ◽  
pp. 200-201
Author(s):  
D.P. Bazett-Jones ◽  
F.P. Ottensmeyer
Keyword(s):  
Small Volume ◽  
Double Helix ◽  
Dna Interaction ◽  
Dark Field ◽  
Sperm Head ◽  
Nuclear Proteins ◽  
Field Electron Microscopy ◽  
Dark Field Electron ◽  
Dna Double Helix ◽  
Positively Charged

Dark field electron microscopy has been used for the study of the structure of individual macromolecules with a resolution to at least the 5Å level. The use of this technique has been extended to the investigation of structure of interacting molecules, particularly the interaction between DNA and fish protamine, a class of basic nuclear proteins of molecular weight 4,000 daltons.Protamine, which is synthesized during spermatogenesis, binds to chromatin, displaces the somatic histones and wraps up the DNA to fit into the small volume of the sperm head. It has been proposed that protamine, existing as an extended polypeptide, winds around the minor groove of the DNA double helix, with protamine's positively-charged arginines lining up with the negatively-charged phosphates of DNA. However, viewing protamine as an extended protein is inconsistent with the results obtained in our laboratory.

Sign in / Sign up

Export Citation Format

Share Document