Incidence and Molecular Identification of Apple Necrotic Mosaic Virus (ApNMV) in Southwest China

Apple mosaic disease has a great influence on apple production. In this study, an investigation into the incidence of apple mosaic disease in southwest China was performed, and the pathogen associated with the disease was detected. The results show that 2869 apple trees with mosaic disease were found in the Sichuan, Yunnan, and Guizhou Provinces, with an average incidence of 9.6%. Although apple mosaic virus (ApMV) is widespread in apples worldwide, the diseased samples were negative when tested for ApMV. However, a novel ilarvirus (apple necrotic mosaic virus, ApNMV) was identified in mosaic apple leaves which tested negative for ApMV. RT-PCR analysis indicated that ApNMV was detected in 322 out of 357 samples with mosaic symptoms. Phylogenetic analysis of coat protein (CP) sequences of ApNMV isolates suggested that, compared with ApMV, ApNMV was closer to prunus necrotic ringspot virus (PNRSV). The CP sequences of the isolates showed the diversity of ApNMV, which may enable the virus to adapt to the changeable environments. In addition, the pathology of mosaic disease was observed by microscope, and the result showed that the arrangement of the tissue and the shape of the cell, including the organelle, were seriously destroyed or drastically changed.

Download Full-text

Genomic Analysis, Sequence Diversity, and Occurrence of Apple necrotic mosaic virus, a Novel Ilarvirus Associated with Mosaic Disease of Apple Trees in China

Plant Disease ◽

10.1094/pdis-10-17-1580-re ◽

2018 ◽

Vol 102 (9) ◽

pp. 1841-1847 ◽

Cited By ~ 11

Author(s):

Fei Xing ◽

Berhanu Lemma Robe ◽

Zhixiang Zhang ◽

Hongqing Wang ◽

Shifang Li

Keyword(s):

Mosaic Virus ◽

Strong Association ◽

Genomic Analysis ◽

Mosaic Disease ◽

Sequence Diversity ◽

Apple Trees ◽

Apple Production ◽

Ring Spot ◽

Very High ◽

Sequence Similarities

China accounts for over 50% of apple production worldwide. Very recently, a novel ilarvirus, Apple necrotic mosaic virus (ApNMV), was isolated from apple trees showing mosaic symptoms in Japan. This study compared different types of mosaic symptoms observed in apple trees in China under field conditions. Complete nucleotide sequences were obtained for six isolates of ApNMV. The genomic components varied in size from 3,378 to 3,380 nt (RNA1), 2,778 to 2,786 nt (RNA2), and 1,909 to 1,955 nt (RNA3), respectively. Although nucleotide sequence similarities with subgroup 3 ilarviruses were low (49.2 to 64.3%), results of phylogenetic analysis indicated that Chinese ApNMV isolates were clustered in subgroup 3 together with Prunus necrotic ring spot virus (PNRSV) and Apple mosaic virus (ApMV). Apple mosaic disease occurred widely in apple producing areas of China with a very high percentage (92.1%, 268 out of 291) of symptomatic trees being infected with ApNMV but not with ApMV. The data suggested that ApNMV might be the main pathogen causing apple mosaic disease in China. The genomes of the six studied Chinese ApNMV isolates demonstrated substantial sequence diversity. Here, we demonstrated a strong association of ApNMV with the mosaic disease of apple trees in China.

Download Full-text

Apple Leaf Disease Identification Based on Optimized Deep Neural Network

Handbook of Research on Deep Learning-Based Image Analysis Under Constrained and Unconstrained Environments - Advances in Computational Intelligence and Robotics ◽

10.4018/978-1-7998-6690-9.ch009 ◽

2021 ◽

pp. 167-185

Author(s):

Anitha Ruth J. ◽

Uma R. ◽

Meenakshi A.

Keyword(s):

Neural Network ◽

Deep Neural Network ◽

Monarch Butterfly ◽

Economic Losses ◽

Apple Trees ◽

Leaf Disease ◽

Disease Identification ◽

Apple Leaves ◽

The World ◽

Apple Production

Apples are the most productive fruits in the world with a lot of medicinal and nutritional value. Significant economic losses occur frequently due to various diseases that occur on a huge scale of apple production. Consequently, the effective and timely discovery of apple leaf infection becomes compulsory. The proposed work uses optimal deep neural network for effectively identifying the diseases of apple trees. This work utilizes a convolution neural network to capture the features of Apple leaves. Extracted features are optimized with the help of the optimization algorithm. The optimized features are utilized in the leaf disease identification process. Here the traditional DNN algorithm is modified by means of weight optimization using adaptive monarch butterfly optimization (AMBO) algorithm. The experimental results show that the proposed disease identification methodology based on the optimized deep neural network accomplishes an overall accuracy of 98.42%.

Download Full-text

RNA-Seq Reveals Hawthorn Tree as a New Natural Host for Apple Necrotic Mosaic Virus, Possibly Associated with Hawthorn Mosaic Disease

Plant Disease ◽

10.1094/pdis-11-19-2455-re ◽

2020 ◽

Vol 104 (10) ◽

pp. 2713-2719 ◽

Cited By ~ 1

Author(s):

Fei Xing ◽

Wanying Hou ◽

Sebastien Massart ◽

Dehang Gao ◽

Wenhui Li ◽

...

Keyword(s):

Mosaic Virus ◽

Low Frequency ◽

Mosaic Disease ◽

Natural Host ◽

Mosaic Symptom ◽

Rt Pcr ◽

Hypervariable Regions ◽

The Family ◽

Causal Pathogen ◽

Individual Trees

Apple mosaic disease is widespread in the major apple-producing areas in China and is frequently associated with the presence of the newly identified Apple necrotic mosaic virus (ApNMV), belonging to subgroup 3 of Ilarvirus genus in the family of Bromoviridae. Mosaic symptoms were also observed in a hawthorn tree. Deep sequencing revealed the hawthorn tree with mosaic symptom was infected by ApNMV, which was confirmed by RT-PCR. The complete nucleotide sequences of RNA1 (3,378 nt), RNA2 (2,778 nt), and RNA3 (1,917 nt) of ApNMV from the hawthorn were obtained, sharing 93.8 to 96.8%, 89.7 to 96.1%, and 89.8 to 94.6% nucleotide identities with those from apples and crabapples, respectively. Two hypervariable regions were found, which showed 59.2 to 85.7% and 64.0 to 89.3% sequence identities at position 142 to 198 aa and at position 780 to 864 aa in the POL protein, respectively, between the hawthorn isolate and other isolates (apple, crabapple). A grafting test demonstrated that ApNMV was easily transmissible from hawthorns to apple trees, with severe chlorosis, yellowing, mosaic, curling, and necrosis. In addition, a total of 11,685 hawthorn trees were surveyed for the incidence of mosaic disease from five provinces in China, and only six were found showing typical mosaic symptoms. A total of 145 individual trees (six symptomatic, 68 asymptomatic, and 71 other symptoms) were tested for the presence or absence of ApNMV by RT-PCR. Among them, six symptomatic, four asymptomatic, and 10 other symptomatic trees tested positive for ApNMV. Taken together, these results demonstrated that the hawthorn tree was identified as a new natural host for ApNMV with a relatively low frequency (13.8%, 20 out of 145) in the main producing areas, and it was likely to be the causal pathogen of hawthorn mosaic disease.

Download Full-text

First Report of Fig mosaic virus Infecting Common Fig (Ficus carica) in China

Plant Disease ◽

10.1094/pdis-10-14-1028-pdn ◽

2015 ◽

Vol 99 (3) ◽

pp. 422-422 ◽

Cited By ~ 3

Author(s):

M. Mijit ◽

S. F. Li ◽

S. Zhang ◽

Z. X. Zhang

Keyword(s):

Mosaic Virus ◽

Blot Hybridization ◽

Ficus Carica ◽

Pcr Analysis ◽

Northern Blot Hybridization ◽

Rt Pcr ◽

Glycoprotein Precursor ◽

First Report ◽

Common Fig ◽

Fig Mosaic Virus

The common fig (Ficus carica) is one of the earliest plants domesticated by humans. It has been cultivated in China ever since the early seventh century. Fig fruit is an important traditional Chinese medicine and a fine health food, featuring a unique flavor and rich nutrients. In addition to its great medicinal values, its abundant availability in the Xinjiang province of China has made the fig one of the most popular fruits in the country. One of the major diseases that affect figs is the fig mosaic disease (FMD) (1,4), which was reported in China in 1935 (3). A causal agent of this disease is associated with the Fig mosaic virus (FMV), a negative-strand RNA virus with six RNA segments (2). In 2013, and later during a survey in 2014, fig plants in several orchards in Xinjiang displayed symptoms of a virus-like disease, which was characterized as FMD. These symptoms included chlorotic clearing as well as banding of leaf veins along with various patterns of discoloration, severely distorted leaves, and deformed fruits. Total RNA extracts (TRIzol reagent, Ambion) from 18 symptomatic and four asymptomatic leaf samples were subjected to reverse reaction (RT) assays using M-MLV reverse transcriptase (Promega, Fitchburg, WI) with primer FMV-GP-R (TATTACCTGGATCAACGCAG). PCR analysis of the synthesized cDNA was performed using FMV-specific primers FMV-GP-F (ACTTGCAAAGGCAGATGATA) and FMV-GP-R. Amplicons of 706 bp produced by RT-PCR assays were obtained from most (15 out of 18) of the symptomatic samples; however, none was obtained from the four asymptomatic leaves. The purified amplicons were cloned and sequenced. BLAST analysis of these sequences revealed more than 94% nucleotide identity with glycoprotein precursor (GP) genes of an FMV-Serbia isolate (SB1). One sequence was deposited in NCBI databases, and one sequence was submitted to GenBank (Accession No. KM034915). RNA segments 2 to 6 of FMV were also amplified by RT-PCR and sequenced. These sequences showed 94 to 96% identity with FMV sequences deposited in the NCBI databases. The collected samples were further detected by Northern-blot hybridization with a digoxigenin-labeled RNA probe, which targets the RNA1 genome of the FMV. The result was in line with RT-PCR detection. To our knowledge, this is the first report of FMV in fig trees in China. Considering the economic importance of fig plants and the noxious nature of FMV, this virus poses a great threat to the economy of the fig industry of Xinjiang. Thus, it is important to develop immediate effective quarantine and management of this virus to reduce any further predictable loss. References: (1) T. Elbeaino et al. J. Gen. Virol. 90:1281, 2009. (2) K. Ishikawa et al. J. Gen. Virol. 93:1612, 2012. (3) H. A. Pittman. J. West Aust. Dept. Agric. 12:196, 1935. (4) J. J. Walia et al. Plant Dis. 93:4, 2009.

Download Full-text

First Report of Chilli veinal mottle virus Infecting Tomato (Solanum lycopersicum) in China

Plant Disease ◽

10.1094/pdis-11-13-1188-pdn ◽

2014 ◽

Vol 98 (11) ◽

pp. 1589-1589 ◽

Cited By ~ 11

Author(s):

F.-F. Zhao ◽

D.-H. Xi ◽

J. Liu ◽

X.-G. Deng ◽

H.-H. Lin

Keyword(s):

Mosaic Virus ◽

Southwest China ◽

Sichuan Province ◽

Mottle Virus ◽

Rt Pcr ◽

Tomato Plants ◽

First Report ◽

Two Samples ◽

Leaf Distortion ◽

Chilli Veinal Mottle Virus

Chilli veinal mottle virus (ChiVMV), a potyvirus, is widespread over the world. In China, it was first reported in chili pepper (Capsicum annuum) in Hainan Province (south China) in 2006 (2). Subsequently, it was reported in tobacco (Nicotiana tabacum) in Yunnan Province (southwest China) in 2011 (1). Sichuan Province is one of the largest vegetable producing areas of China. In May 2012, tomatoes with leaves displaying virus-infected symptoms like mottling, mosaic, narrowing, or curling were observed in several fields of Chengdu, eastern Sichuan Province, southwest China. Of the 20 fields we investigated, four fields with 90% tomato plants were infected. During 2012 and 2013, six samples were collected from symptomatic tomato leaves based on different symptoms and locations. All six samples were assayed by western blotting using polyclonal antisera (Cucumber mosaic virus [CMV], Tobacco mosaic virus [TMV]) obtained from Agdia (Elkhart) and one antiserum to ChiVMV obtained from Yunnan Academy of Agricultural Science (China). Two samples from Pengzhou and one sample from Shuangliu exhibiting mosaic leaves were positive for TMV, one sample from Pixian exhibiting narrowing leaves was positive for CMV, and the other two samples from Shuangliu exhibiting mottle and leaf distortion were positive for ChiVMV. Total RNAs was extracted from all six samples and healthy tomato leaves using Trizol reagent (Invitrogen), First-strand cDNA synthesis primed with oligo(dT) by SuperScript III Reverse Transcriptase (Invitrogen). RT-PCR was performed using primer pairs ChiVMV-CP F (5′-GCAGGAGAGAGTGTTGATGCTG-3′) and ChiVMV–CP R (5′-(T)16AACGCCAACTATTG-3′), which were designed to direct the amplification of the entire capsid protein (CP) gene and 3′ untranslated region (3′-UTR) of ChiVMV (GenBank Accession No. KC711055). The expected 1,166-bp DNA fragment was amplified from the two tomato samples from Shuangliu that were positive for ChiVMV in the western blot tests, but not from the others. The obtained fragments were purified and cloned into the PMD18-T vector (TaKaRa) and sequenced. The sequencing results showed that the two ChiVMV isolates from tomato in Shuangliu were identical (KF738253). Nucleotide BLAST analysis revealed that this ChiVMV isolate shared ~84 to 99% nucleotide identities with other ChiVMV isolates available in GenBank (KC711055 to KF220408). To fulfill Koch's postulates, we isolated this virus by three cycle single lesion isolation in N. tabacum, and mechanically inoculated it onto tomato leaves. The same mottle and leaf distortion symptoms in systemic leaves were observed. Subsequent RT-PCR, fragment clone, and sequence determination tests were repeated and the results were the same. All the evidence from these tests revealed that the two tomato plants were infected by ChiVMV. To our knowledge, this is the first report of ChiVMV naturally infecting tomato in China. It shows that ChiVMV is spreading in China and is naturally infecting a new solanaceous crop in the southwest area, and the spread of the virus may affect tomato crop yields in China. Thus, it is very important to seek an effective way to control this virus. References: (1) M. Ding et al. Plant Dis. 95:357, 2011. (2) J. Wang et al. Plant Dis. 90:377, 2006.

Download Full-text

Genetic Diversity Among Viruses Associated with Sugarcane Mosaic Disease in Tucumán, Argentina

Phytopathology ◽

10.1094/phyto-99-1-0038 ◽

2009 ◽

Vol 99 (1) ◽

pp. 38-49 ◽

Cited By ~ 19

Author(s):

M. F. Perera ◽

M. P. Filippone ◽

C. J. Ramallo ◽

M. I. Cuenya ◽

M. L. García ◽

...

Keyword(s):

Genetic Diversity ◽

Mosaic Virus ◽

Fragment Length Polymorphism ◽

Rflp Analysis ◽

Mosaic Disease ◽

Rt Pcr ◽

Rflp Profile ◽

Pcr Rflp ◽

Polymerase Chain ◽

Sugarcane Mosaic Disease

Sugarcane leaves with mosaic symptoms were collected in 2006–07 in Tucumán (Argentina) and analyzed by reverse-transcriptase polymerase chain reaction (RT-PCR) restriction fragment length polymorphism (RFLP) and sequencing of a fragment of the Sugarcane mosaic virus (SCMV) and Sorghum mosaic virus (SrMV) coat protein (CP) genes. SCMV was detected in 96.6% of samples, with 41% showing the RFLP profile consistent with strain E. The remaining samples produced eight different profiles that did not match other known strains. SCMV distribution seemed to be more related to sugarcane genotype than to geographical origin, and sequence analyses of CP genes showed a greater genetic diversity compared with other studies. SrMV was detected in 63.2% of samples and most of these were also infected by SCMV, indicating that, unlike other countries and other Argentinean provinces, where high levels of co-infection are infrequent, co-existence is common in Tucumán. RFLP analysis showed the presence of SrMV strains M (68%) and I (14%), while co-infection between M and H strains was present in 18% of samples. Other SCMV subgroup members and the Sugarcane streak mosaic virus (SCSMV) were not detected. Our results also showed that sequencing is currently the only reliable method to assess SCMV and SrMV genetic diversity, because RT-PCR-RFLP may not be sufficiently discriminating.

Download Full-text

Search for Vigna species conferring resistance to Mungbean yellow mosaic virus in mungbean

Plant Genetic Resources ◽

10.1017/s1479262114000859 ◽

2014 ◽

Vol 13 (2) ◽

pp. 162-167 ◽

Cited By ~ 9

Author(s):

M. Sudha ◽

A. Karthikeyan ◽

V. G. Shobhana ◽

P. Nagarajan ◽

M. Raveendran ◽

...

Keyword(s):

Mosaic Virus ◽

Yellow Mosaic Virus ◽

Pcr Analysis ◽

Quantitative Detection ◽

Interspecific Crosses ◽

Rt Pcr ◽

Vigna Species ◽

Resistant Varieties ◽

Mungbean Yellow Mosaic Virus ◽

Polymerase Chain

Mungbean yellow mosaic virus (MYMV) is a disastrous pathogen of mungbean. It is widespread in most of southern India and no complete resistance has been identified among its commercial cultivars. Two isolates of MYMV, representing its diversity, were used to assess and characterize the susceptibility reaction of all the three species of Vigna. The seeds were agroinoculated with the virus and the presence of the viral DNA was confirmed after 12 d by reverse transcriptase-polymerase chain reaction (RT-PCR) analysis after which the plants were monitored for the expression of symptoms. All of the 20 accessions of Vigna radiata and ten accessions of Vigna mungo were systemically infected with MYMV, and they all produced typical symptoms. On the other hand, the 24 accessions of Vigna umbellata were found to be resistant to both the isolates. For additional affirmation, three representative accessions of V. radiata and V. mungo and all the accessions of V. umbellata were agroinoculated, and quantitative RT-PCR was performed for the quantitative detection of the MYMV. The mRNA transcripts of MYMV were detected in V. radiata and V. mungo plants but not in the V. umbellata plants. Researching the molecular basis of the resistance in V. umbellate against MYMV might definitely be very constructive for developing resistant varieties of mungbean on a commercial scale. This genetic quality offering resistance to MYMV could also be incorporated into V. radiata/V. mungo by means of interspecific crosses.

Download Full-text

Characteristics of rose mosaic diseases

Acta Agrobotanica ◽

10.5586/aa.2004.008 ◽

2013 ◽

Vol 57 (1-2) ◽

pp. 79-89

Author(s):

Marek S. Szyndel

Keyword(s):

Mosaic Virus ◽

Mosaic Disease ◽

Ringspot Virus ◽

Yellow Vein ◽

Line Pattern ◽

Arabis Mosaic Virus ◽

Tobacco Ringspot Virus ◽

Tomato Ringspot Virus ◽

Prunus Necrotic Ringspot Virus ◽

Methods Of Control

Presented review of rose diseases, associated with the mosaic symptoms, includes common and yellow rose mosaic, rose ring pattern, rose X disease, rose line pattern, yellow vein mosaic and rose mottle mosaic disease. Based on symptomatology and graft transmissibility of causing agent many of those rose disorders are called "virus-like diseases" since the pathogen has never been identified. However, several viruses were detected and identified in roses expressing mosaic symptoms. Currently the most prevalent rose viruses are Prunus necrotic ringspot virus - PNRSV, Apple mosaic virus - ApMV (syn. Rose mosaic virus) and Arabis mosaic virus - ArMV Symptoms and damages caused by these viruses are described. Tomato ringspot virus, Tobacco ringspot virus and Rose mottle mosaic virus are also mentioned as rose pa thogcns. Methods of control of rose mosaic diseases are discussed.

Download Full-text

First Report of Watermelon mosaic virus causing a Mosaic Disease on Cucumis metuliferus in China

Plant Disease ◽

10.1094/pdis-12-20-2744-pdn ◽

2021 ◽

Author(s):

Qiang Gao ◽

Hai-long Ren ◽

Wanyu Xiao ◽

Yan Zhang ◽

Bo Zhou ◽

...

Keyword(s):

Mosaic Virus ◽

Direct Sequencing ◽

Rna Extraction ◽

Viral Disease ◽

Complete Sequence ◽

Mosaic Disease ◽

Shanxi Province ◽

Watermelon Mosaic Virus ◽

Rt Pcr ◽

First Report

Cucumis metuliferus, also called horned cucumber or jelly melon, is considered as a wild species in the Cucumis genus and a potential material for nematodes- or viruses-resistant breeding (Provvidenti, et al. 1977; Sigüenza et al. 2005; Chen et al. 2020). This species, originating from Africa, has been cultivated as a fruit in China in recent years. In July 2020, a mosaic disease was observed on C. metuliferus growing in five fields (approximately 0.7 hectare) in Urumqi, Xijiang, China, where more than 85~100% of the field plants exhibited moderate to severe viral disease-like leaf mosaic and/or deformation symptoms. Delayed flowering and small and/or deformed fruits on the affected plants could result in yield loss of about 50%. To identify the causal pathogen, the symptomatic leaf samples were collected from the five fields (five plants/points for each field) and their total RNAs were extracted using a commercial RNA extraction kit. The universal potyviral primers (Ha et al. 2008) and specific primers for a number of frequently-occurring, cucurbit crop-infecting viruses including Papaya ringspot virus (PRSV) (Lin et al. 2013), Cucumber mosaic virus (CMV) and Watermelon mosaic virus (WMV) were designed and used for detection by RT-PCR. The result showed that only the WMV primers (forward: 5’-AAGTGTGACCAAGCTTGGACTGCA-3’ and reverse: 5’-CTCACCCATTGTGCCAAAGAACGT-3’) could amplify the corresponding target fragment from the total RNA templates, and direct sequencing of the RT-PCR products and GenBank BLAST confirmed the presence of WMV (genus Potyvirus) in the collected C. metuliferus samples. To complete Koch’s postulates, the infected C. metuliferus leaves were ground in the sodium phosphate buffer (0.01 M, pH 7.0) and the sap was mechanically inoculated onto 30 four-leaf-stage C. metuliferus seedlings (two leaves for each seedling were inoculated) kept in an insect-proof, temperature-controlled greenhouse at 25~28℃. Twenty-five of the inoculated plants were observed to have apparent leaf mosaic similar to the field symptoms two weeks after inoculation, and positive result was obtained in RT-PCR detection for the symptomatic leaves of inoculated plants using the WMV primers aforementioned, confirming the virus as the pathogen of C. metuliferus in Urumqi. To our knowledge, this is the first report of WMV naturally infecting C. metuliferus in China. We obtained the full-length sequence of the WMV Urumqi isolation (WMV-Urumqi) by sequencing the RT-PCR amplicons from seven pairs of primers spanning the viral genome and the 5’RACE and 3’RACE products. The complete sequence of WMV-Urumqi (GenBank accession no. MW345911) is 10046 nucleotides (nt) long and contains an open reading frame that encodes a polyprotein of 3220 amino acids (aa). WMV-Urumqi shares the highest nt identity (95.9%) and aa identity (98.0%) with the Cucurbita pepo-infecting isolation (KX664483) from Shanxi province, China. Our findings provide a better understanding of the host range and genetic diversity of WMV, and a useful reference for virus-resistant breeding involving C. metuliferus.

Download Full-text

Selective Interaction of Sugarcane eIF4E with VPgs from Sugarcane Mosaic Pathogens

Viruses ◽

10.3390/v13030518 ◽

2021 ◽

Vol 13 (3) ◽

pp. 518

Author(s):

Zongtao Yang ◽

Meng Dong ◽

Guangyuan Cheng ◽

Shuxian Liu ◽

Hai Zhang ◽

...

Keyword(s):

Mosaic Virus ◽

Expression Profiles ◽

Mosaic Disease ◽

Translation Initiation Factor ◽

Bimolecular Fluorescence Complementation ◽

Initiation Factor ◽

Pcr Analysis ◽

Protein Coding ◽

Sugarcane Cultivar ◽

Real Time Quantitative Pcr

Eukaryotic translation initiation factor 4E (eIF4E) plays a key role in the infection of potyviruses in susceptible plants by interacting with viral genome-linked protein (VPg). Sugarcane (Saccharum spp.) production is threatened by mosaic disease caused by Sugarcane mosaic virus (SCMV), Sorghum mosaic virus (SrMV), and Sugarcane streak mosaic virus (SCSMV). In this study, two eIF4Es and their isoform eIF(iso)4E and 4E-binding protein coding genes were cloned from sugarcane cultivar ROC22 and designated SceIF4Ea, SceIF4Eb, SceIF(iso)4E, and ScnCBP, respectively. Real-time quantitative PCR analysis showed different expression profiles of these four genes upon SCMV challenge. A subcellular localization assay showed that SceIF4Ea, SceIF4Eb, SceIF(iso)4E, and ScnCBP were distributed in the nucleus and cytoplasm. Yeast two-hybrid (Y2H) and bimolecular fluorescence complementation (BiFC) assays showed that SceIF4Ea/b and SceIF(iso)4E were selectively employed by different sugarcane mosaic pathogens, i.e., SCMV-VPg interacted with SceIF4Ea/b and SceIF(iso)4E, SrMV-VPg interacted with both SceIF4Eb and SceIF(iso)4E, and SCSMV-VPg interacted only with SceIF(iso)4E. Intriguingly, the BiFC assays, but not the Y2H assays, showed that ScnCBP interacted with the VPgs of SCMV, SrMV, and SCSMV. Competitive interaction assays showed that SCMV-VPg, SrMV-VPg, and SCMV-VPg did not compete with each other to interact with SceIF(iso)4E, and SceIF(iso)4E competed with SceIF4Eb to interact with SrMV-VPg but not SCMV-VPg. This study sheds light on the molecular mechanism of sugarcane mosaic pathogen infection of sugarcane plants and benefits sugarcane breeding against the sugarcane mosaic disease.

Download Full-text