scholarly journals Hemotropic mycoplasmas in bats from forest fragments, state of Paraná, southern Brazil

2022 ◽  
Vol 43 (1) ◽  
pp. 431-440
Author(s):  
Flávia Carolina Meira Collere ◽  
◽  
Larissa Dantas Roeder Ferrari ◽  
Ricardo Nascimento Drozino ◽  
Jéssica Damiana Marinho Valente ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
23S Rrna ◽  
Rrna Gene ◽  
Forest Fragments ◽  
Gene Fragment ◽  
Southern Brazil ◽  
Pcr Assay ◽  
Hemotropic Mycoplasma ◽  
The 16S Rrna Gene

The order Chiroptera is the second largest group of mammals with bats being identified as reservoir of several viral zoonoses, although, little is known about their role in other groups of pathogens, including hemotropic Mycoplasma spp. To date, hemoplasma species have been found infecting several species of bats with high genetic diversity between 16S rRNA gene sequences. On this study, we aimed to identify the occurrence and characterize 16S and 23S rRNA genes of hemoplasma species in four bats species (Artibeus lituratus, Carollia perspicillata, Sturnira lilium and Sturnira tildae) from forest fragments in Paraná State, southern Brazil, using PCR-based assays. Spleen tissue samples were collected, DNA extracted and further screened by a pan‑hemoplasma PCR assay. All samples consistently amplified the mammal endogenous gapdh gene. One out of 15 (6.66%; 95% CI: 0.2-31%) bats tested positive for hemotropic Mycoplasma sp. by the PCR assay targeting the 16S rRNA gene. Sequencing of the 16S rRNA gene fragment from the hemoplasma-positive bat showed 99.14% identity with hemotropic Mycoplasma sp. detected in Sturnira parvidens from Belize. Sequencing of the 23S rRNA gene fragment from the hemoplasma-positive bat showed 86.17% identity with ‘Candidatus Mycoplasma haemosphiggurus’ detected in orange-spined hairy dwarf porcupines (Sphiggurus villosus) from Southern Brazil.

scholarly journals Sporosarcina newyorkensis sp. nov. from clinical specimens and raw cow’s milk

2012 ◽  
Vol 62 (2) ◽  
pp. 322-329 ◽  
Author(s):  
William J. Wolfgang ◽  
An Coorevits ◽  
Jocelyn A. Cole ◽  
Paul De Vos ◽  
Michelle C. Dickinson ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
New York State ◽  
23S Rrna ◽  
Rrna Gene ◽  
The Novel ◽  
Gene Sequences ◽  
16S Rrna Gene Sequences ◽  
Clinical Specimens ◽  
The 16S Rrna Gene

Twelve independent isolates of a Gram-positive, endospore-forming rod were recovered from clinical specimens in New York State, USA, and from raw milk in Flanders, Belgium. The 16S rRNA gene sequences for all isolates were identical. The closest species with a validly published name, based on 16S rRNA gene sequence, is Sporosarcina koreensis (97.13 % similarity). DNA–DNA hybridization studies demonstrate that the new isolates belong to a species distinct from their nearest phylogenetic neighbours. The partial sequences of the 23S rRNA gene for the novel strains and their nearest neighbours also provide support for the novel species designation. Maximum-likelihood phylogenetic analysis of the 16S rRNA gene sequences confirmed that the new isolates are in the genus Sporosarcina. The predominant menaquinone is MK-7, the peptidoglycan has the type A4α l-Lys–Gly–d-Glu, and the polar lipids consist of diphosphatidylglycerol, phosphatidylglycerol and phosphatidylethanolamine. The predominant fatty acids are iso-C14 : 0, iso-C15 : 0 and anteiso-C15 : 0. In addition, biochemical and morphological analyses support designation of the twelve isolates as representatives of a single new species within the genus Sporosarcina, for which the name Sporosarcina newyorkensis sp. nov. (type strain 6062T  = DSM 23544T  = CCUG 59649T  = LMG 26022T) is proposed.

scholarly journals First Report of Blueberry Reddening Disease in Serbia Associated with 16SrXII-A (Stolbur) Phytoplasma

Plant Disease ◽  
2013 ◽  
Vol 97 (12) ◽  
pp. 1653-1653 ◽  
Author(s):  
M. Starović ◽  
S. Kojic ◽  
S. T. Kuzmanovic ◽  
S. D. Stojanovic ◽  
S. Pavlovic ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Nested Pcr ◽  
Vaccinium Corymbosum ◽  
23S Rrna ◽  
Rrna Gene ◽  
Restriction Enzyme Digestion ◽  
First Report ◽  
Stolbur Phytoplasma ◽  
The 16S Rrna Gene

Blueberries (Vaccinium corymbosum) are among the healthiest fruits due to their high antioxidant content. The total growing area of blueberries in Serbia ranges from 80 to 90 ha. A phytoplasma-like disease was observed for the first time during July 2009 in three blueberry cultivars (Bluecrop, Duke, and Spartan) grown in central Serbia, locality Kopljare (44°20′10.9″ N, 20°38′39.3″ E). Symptoms of yellowing and reddening were observed on the upper leaves and proliferating shoots, similar to those already described on blueberries (4). There was uneven ripening of the fruits on affected plants. Incidence of affected plants within a single field was estimated to be greater than 20% in 2009 and 50% in 2010. Blueberry leaves, together with petioles, were collected during two seasons, 2009 and 2010, and six samples from diseased plants and one from symptomless plants from each cultivar, resulting in 42 samples in total. For phytoplasma detection, total DNA was extracted from the veins of symptomatic and asymptomatic leaves of V. corymbosum using the protocol of Angelini et al. (1). Universal oligonucleotide primers P1/P7 were used to amplify a 1.8-kb DNA fragment containing the 16S rRNA gene, the 16S-23S spacer region, and the 5′ end of the 23S rRNA gene. Subsequently, a 1.2-kb fragment of the 16S rRNA gene was amplified by nested PCR with the R16F2n/R16R2 primers. Reactions were performed in a volume of 50 μl using Dream Taq Green master mix (Thermo Scientific, Lithuania). PCR reaction conditions were as reported (3), except for R16F2n/R2 primers set (annealing for 30 s at 58°C). PCR products were obtained only from the DNA of symptomatic plants. Fragments of 1.2 kb were further characterized by the PCR-RFLP analysis, using AluI, HpaII, HhaI, and Tru1I restriction enzymes (Thermo Scientific, Lithuania), as recommended by the manufacturer. The products of restriction enzyme digestion were separated by electrophoresis on 2.5% agarose gel. All R16F2n/R2 amplicons showed identical RFLP patterns corresponding to the profile of the Stolbur phytoplasma (subgroup 16SrXII-A). The results were confirmed by sequencing the nested PCR product from the representative strain Br1. The sequence was deposited in NCBI GenBank database under accession number KC960486. Phylogenetic analysis showed maximal similarities with SH1 isolate from Vitis vinifera, Jordan (KC835139.1), Bushehr (Iran) eggplant big bud phytoplasma (JX483703.1), BA strain isolated from insect in Italy (JQ868436.1), and also with several plants from Serbia: Arnica montana L. (JX891383.1), corn (JQ730750.1), Hypericum perforatum (JQ033928.1), tobacco (JQ730740.1), etc. In conclusion, our results demonstrate that leaf discoloration of V. corymbosum was associated with a phytoplasma belonging to the 16SrXII-A subgroup. The wild European blueberry (Vaccinium myrtillus L.) is already detected as a host plant of 16SrIII-F phytoplasma in Germany, North America, and Lithuania (4). The main vector of the Stolbur phytoplasma, Hyalesthes obsoletus Signoret, was already detected in Serbia (2). The first report of Stolbur phytoplasma occurrence on blueberry in Serbia is significant for the management of the pathogen spreading in blueberry fields. Since the cultivation of blueberry has a great economic potential in the region, it is important to identify emerging disease concerns in order to ensure sustainable production. References: (1) E. Angelini et al. Vitis 40:79, 2001. (2) J. Jović et al. Phytopathology 99:1053, 2009. (3) S. Pavlovic et al. J. Med. Plants Res. 6:906, 2012. (4) D. Valiunas et al. J. Plant Pathol. 86:135, 2004.

scholarly journals Identification of Mycobacterium kansasiiby Using a DNA Probe (AccuProbe) and Molecular Techniques

1999 ◽  
Vol 37 (4) ◽  
pp. 964-970 ◽  
Author(s):  
Elvira Richter ◽  
Stefan Niemann ◽  
Sabine Rüsch-Gerdes ◽  
Sven Hoffner
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Restriction Pattern ◽  
Molecular Techniques ◽  
Rrna Genes ◽  
23S Rrna ◽  
Rrna Gene ◽  
Genetic Analyses ◽  
New Formulation ◽  
The 16S Rrna Gene

The newly formulated Mycobacterium kansasii AccuProbe was evaluated, and the results obtained with the new version were compared to the results obtained with the old version of this test by using 116 M. kansasii strains, 1 Mycobacterium gastri strain, and 19 strains of several mycobacterial species. The sensitivity of this new formulation was 97.4% and the specificity was 100%. Still, three M. kansasii strains were missed by this probe. To evaluate the variability within the species, genetic analyses of the hsp65 gene, the spacer sequence between the 16S and 23S rRNA genes, and the 16S rRNA gene of several M. kansasii AccuProbe-positive strains as well as all AccuProbe-negative strains were performed. Genetic analyses of the oneM. gastri strain from the comparative assay and of two further M. gastri strains were included because of the identity of the 16S rRNA gene in M. gastri to that inM. kansasii. The data confirmed the genetic heterogeneity of M. kansasii. Furthermore, a subspecies with an unpublished hsp65 restriction pattern and spacer sequence was described. The genetic data indicate that all M. kansasii strains missed by the AccuProbe test belong to one subspecies, the newly described subspecies VI, as determined by thehsp65 restriction pattern and the spacer sequence. Since the M. kansasii strains that are missed are rare and allM. gastri strains are correctly negative, the new formulated AccuProbe provides a useful tool for the identification ofM. kansasii.

scholarly journals Reassessment of the phylogenetic relationships of Thiomonas cuprina

2007 ◽  
Vol 57 (11) ◽  
pp. 2720-2724 ◽  
Author(s):  
Donovan P. Kelly ◽  
Yoshihito Uchino ◽  
Harald Huber ◽  
Ricardo Amils ◽  
Ann P. Wood
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Gene Sequence ◽  
16S Rrna Genes ◽  
Rrna Genes ◽  
23S Rrna ◽  
Rrna Gene ◽  
Significant Similarity ◽  
23S Rrna Gene ◽  
The 16S Rrna Gene

The published sequence of the 16S rRNA gene of Thiomonas cuprina strain Hö5 (=DSM 5495T) (GenBank accession no. U67162) was found to be erroneous. The 16S rRNA genes from the type strain held by the DSMZ since 1990 (DSM 5495T =NBRC 102145T) and strain Hö5 maintained frozen in the Universität Regensburg for 23 years (=NBRC 102094) were sequenced and found to be identical, but to show no significant similarity to the U67162 sequence. This also casts some doubt on the previously published 5S and 23S rRNA gene sequences (GenBank accession nos U67171 and X75567). The correct 16S rRNA gene sequence showed 99.8 % identity to those from Thiomonas delicata NBRC 14566T and ‘Thiomonas arsenivorans’ DSM 16361. The properties of these three species are re-evaluated, and emended descriptions are provided for the genus Thiomonas and the species Thiomonas cuprina.

scholarly journals Identification and Assessment of Genetic Similarity of Soil Bacterial Isolates of Pseudomonas spp. Using Molecular Techniques

2014 ◽  
Vol 63 (3) ◽  
pp. 291-298
Author(s):  
ANNA LISEK ◽  
LIDIA SAS PASZ ◽  
PAWEŁ TRZCIŃSKI
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Genetic Similarity ◽  
Sour Cherry ◽  
23S Rrna ◽  
Rrna Gene ◽  
Bacterial Isolates ◽  
Bacterial Strains ◽  
The 16S Rrna Gene ◽  
Selection Of

Bacteria of the genus Pseudomonas are often components of bioproducts designed to enhance the condition of the soil and plants. The use of Pseudomonas bacteria in bioproducts must be preceded by the acquisition, characterization and selection of beneficial strains living in the soil. A prerequisite for the selection of bacterial strains for use in bioproducts is to be able to identify the isolates rapidly and accurately. To identify and differentiate 15 bacterial isolates obtained from the soil surrounding the roots of sour cherry trees and to assess their genetic similarity, the rep-PCR technique and restriction analysis of the 16S rRNA gene and the 16S-ITS-23S rRNA operon were used. In addition, a sequence analysis of the 16S rRNA gene was performed. The analyses made it possible to divide the isolates into four clusters and to confirm their affiliation with the Pseudomonas species. RFLP analysis of the 16S-ITS-23S rRNA operon enabled greater differentiation of the isolates than RFLP of the 16S rRNA gene. The greatest differentiation of isolates within the clusters was obtained after using the rep-PCR technique. However, none of the techniques was able to discriminate all the isolates, which indicates very high genetic similarity of the Pseudomonas isolates found in the same sample of soil from around the roots of sour cherry trees. The tests performed will find application for distinguishing and identifying Pseudomonas strains collected from the soil in order to select the most valuable bacterial strains that produce beneficial effects on plants.

scholarly journals Nested PCR Assay for Detection of Granulocytic Ehrlichiae

1998 ◽  
Vol 36 (4) ◽  
pp. 1090-1095 ◽  
Author(s):  
Robert F. Massung ◽  
Kim Slater ◽  
Jessica H. Owens ◽  
William L. Nicholson ◽  
Thomas N. Mather ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Nested Pcr ◽  
Limit Of Detection ◽  
Rrna Gene ◽  
Pcr Assay ◽  
Serum Samples ◽  
Blood Specimens ◽  
The 16S Rrna Gene ◽  
Edta Blood

A sensitive and specific nested PCR assay was developed for the detection of granulocytic ehrlichiae. The assay amplifies the 16S rRNA gene and was used to examine acute-phase EDTA-blood and serum samples obtained from seven humans with clinical presentations compatible with human granulocytic ehrlichiosis. Five of the seven suspected cases were positive by the PCR assay using DNA extracted from whole blood as the template, compared with a serologic assay that identified only one positive sample. The PCR assay using DNA extracted from the corresponding serum samples as the template identified three positive samples. The sensitivity of the assay on human samples was examined, and the limit of detection was shown to be fewer than 2 copies of the 16S rRNA gene. The application of the assay to nonhuman samples demonstrated products amplified from template DNA extracted fromIxodes scapularis ticks collected in Rhode Island and from EDTA-blood specimens obtained from white-tailed deer in Maryland. All PCR products were sequenced and identified as specific to granulocytic ehrlichiae. A putative variant granulocytic ehrlichia 16S rRNA gene sequence was detected among products amplified from both the ticks and the deer blood specimens.

scholarly journals The Diversity of Phaseolus-Nodulating Rhizobial Populations Is Altered by Liming of Acid Soils Planted with Phaseolus vulgaris L. in Brazil

2002 ◽  
Vol 68 (8) ◽  
pp. 4025-4034 ◽  
Author(s):  
D. S. Andrade ◽  
P. J. Murphy ◽  
K. E. Giller
Keyword(s):  
Phaseolus Vulgaris ◽  
16S Rrna ◽  
16S Rrna Gene ◽  
Rhizobium Leguminosarum ◽  
Rflp Analysis ◽  
23S Rrna ◽  
Rrna Gene ◽  
Rhizobium Tropici ◽  
The 16S Rrna Gene ◽  
Limed Soil

ABSTRACT PCR-mediated restriction fragment length polymorphism (RFLP) analysis of the 16S-23S rRNA internally transcribed spacer (ITS) region and the 16S rRNA gene indicated that the rhizobial populations isolated from common bean (Phaseolus vulgaris L.) nodules in the unlimed soil from a series of five lime rates applied 6 years previously to plots of an acidic oxisol had less diversity than those from plots with higher rates of liming. Isolates affiliated with Rhizobium tropici IIB and Rhizobium leguminosarum bv. phaseoli were predominant independent of lime application. An index of richness based on the number of ITS groups increased from 2.2 to 5.7 along the soil liming gradient, and the richness index based on “species” types determined by RFLP analysis of the 16S rRNA gene varied from 0.5 to 1.4. The Shannon index of diversity, based on the number of ITS groups, increased from 1.8 in unlimed soil to 2.8 in limed soil, and, based on RFLP analysis of the 16S rRNA gene, ranged from 0.9 to 1.4. In the limed soil, the subpopulation of R. tropici IIB pattern types contained the largest number of ITS groups. In contrast, there were more R. leguminosarum bv. phaseoli types in the unlimed soil with the lowest pH than in soils with the highest pH. The number of ITS (“strain”) groups within R. leguminosarum bv. phaseoli did not change with increased abundance of rhizobia in the soil, while with R. tropici IIB, the number of strain groups increased significantly. Some cultural and biochemical characteristics of Phaseolus-nodulating isolates were significantly related to changes in soil properties caused by liming, largely due to changes in the predominance of the rhizobial species groups.

scholarly journals Towards a Genome-Based Taxonomy for Prokaryotes

2005 ◽  
Vol 187 (18) ◽  
pp. 6258-6264 ◽  
Author(s):  
Konstantinos T. Konstantinidis ◽  
James M. Tiedje
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Gene Content ◽  
Rrna Genes ◽  
23S Rrna ◽  
Rrna Gene ◽  
Protein Coding ◽  
Protein Coding Genes ◽  
A Genome ◽  
The 16S Rrna Gene

ABSTRACT The ranks higher than the species in the prokaryotic taxonomy are primarily designated based on phylogenetic analysis of the 16S rRNA gene sequences, but no definite standards exist for the absolute relatedness (measured by 16S rRNA or other means) between the ranks. Accordingly, it remains unknown how comparable the ranks are between different organisms. To gain insights into this question, we studied the relationship between shared gene content and genetic relatedness for 175 fully sequenced strains, using as a robust measure of relatedness the average amino acid identity (AAI) of the shared genes. Our results reveal that adjacent ranks (e.g., phylum versus class) frequently show extensive overlap in terms of genetic and gene content relatedness of the grouped organisms, and hence, the current system is of limited predictive power in this respect. The overlap between nonadjacent ranks (e.g., phylum versus family) is generally limited and attributable to clear inconsistencies of the taxonomy. In addition to providing means for standardizing taxonomy, our AAI-based approach provides a means to evaluate the robustness of alternative genetic markers for phylogenetic purposes. For instance, the 23S rRNA gene was found to be as good a marker as the 16S rRNA gene, while several of the widely distributed protein-coding genes, such as the RNA polymerase and gyrase subunits, show a strong phylogenetic signal, albeit less strong than the rRNA genes (0.78 > R 2 > 0.69 for the protein-coding genes versus R 2 = 0.84 for the rRNA genes). The AAI approach outlined here could contribute significantly to a genome-based taxonomy for all microbial organisms.

scholarly journals Real-Time Quantitative Broad-Range PCR Assay for Detection of the 16S rRNA Gene Followed by Sequencing for Species Identification

2006 ◽  
Vol 44 (8) ◽  
pp. 2750-2759 ◽  
Author(s):  
F. Zucol ◽  
R. A. Ammann ◽  
C. Berger ◽  
C. Aebi ◽  
M. Altwegg ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Real Time ◽  
Species Identification ◽  
Rrna Gene ◽  
Pcr Assay ◽  
The 16S Rrna Gene

scholarly journals First Report of Bacterial Leaf Spot of Pumpkin Caused by Xanthomonas cucurbitae in Georgia, United States

Plant Disease ◽  
2013 ◽  
Vol 97 (10) ◽  
pp. 1375-1375 ◽  
Author(s):  
B. Dutta ◽  
R. D. Gitaitis ◽  
F. H. Sanders ◽  
C. Booth ◽  
S. Smith ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Leaf Spot ◽  
Pathogenic Bacteria ◽  
Bacterial Suspension ◽  
Rrna Gene ◽  
Bacterial Isolates ◽  
Pcr Assay ◽  
First Report ◽  
The 16S Rrna Gene

In August 2012, a commercial pumpkin (Cucurbita maxima L. cv. Neon) field in Terrell County, GA, had a disease outbreak that caused severe symptoms on leaves and fruits. Leaves displayed small (2 to 3 mm), angular, water-soaked, yellow lesions while fruits had small (2 to 3 mm), sunken, circular, dry lesions. The field exhibited 40% disease incidence with observable symptoms on fruits. In severe cases, fruit rots were also observed. Symptomatic leaves and fruits were collected from 25 pumpkin plants and isolations were made on both nutrient agar and yeast extract-dextrose-CaCO3 (YDC) agar medium (1). Xanthomonad-like yellow colonies were observed on both agar plates and colonies appeared mucoid on YDC. Suspect bacteria were gram-negative, oxidase positive, hydrolyzed starch and esculin, formed pits on both crystal violet pectate and carboxymethyl cellulose media, but were indole negative and did not produce nitrites from nitrates. Bacterial isolates also produced hypersensitive reactions on tobacco when inoculated with a bacterial suspension of 1 × 108 CFU/ml. Identity of the isolates were identified as genus Xanthomonas by using primers RST2 (5′AGGCCCTGGAAGGTGCCCTGGA3′) and RST3 (5′ATCGCACTGCGTACCGCGCGCGA3′) in a conventional PCR assay, which produced an 840-bp band. The 16S rRNA gene of five isolates was amplified using universal primers fD1 and rD1 (3) and amplified products were sequenced and compared using BLAST in GenBank. The nucleotide sequences (1,200 bp) of the isolates matched Xanthomonas cucurbitae (GenBank Accession AB680438.1), X. campestris (HQ256868.1), X. campestris pv. campestris (NR074936.1), X. hortorum (AB775942.1), and X. campestris pv. raphani (CP002789.1) with 99% similarity. PCR amplification and sequencing of a housekeeping gene atpD (ATP synthase, 720 bp) showed 98% similarity with X. cucurbitae (HM568911.1). Since X. cucurbitae was not listed in the BIOLOG database (Biolog, Hayward, CA), substrate utilization tests for three pumpkin isolates were compared with utilization patterns of Xanthomonas groups using BIOLOG reported by Vauterin et al. (4). The isolates showed 94.7, 93.7, and 92.6% similarity to the reported metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, PCR assay with X. campestris- and X. raphani-specific primers (3) did not amplify the pumpkin isolates, indicating a closer relationship with X. cucurbitae. Spray inoculations of five bacterial isolates in suspensions containing 1 × 108 CFU/ml on 2-week-old pumpkin seedlings (cv. Lumina) (n = five seedlings/isolate/experiment) under greenhouse conditions of 30°C and 70% RH produced typical yellow leaf spot symptoms on 100% of the seedlings. Seedlings (n = 10) spray-inoculated with sterile water were asymptomatic. Reisolated bacterial colonies from symptomatic seedlings displayed similar characteristics to those described above. Further confirmation of bacterial identity was achieved by amplifying and sequencing the 16S rRNA gene, which showed 98 to 99% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on pumpkin in Georgia. As this bacterium is known to be seedborne, it is possible that the pathogen might have introduced through contaminated seeds. References: (1) N. W. Schaad et al. Laboratory Guide for the Identification of Plant Pathogenic Bacteria, third edition. APS Press. St. Paul, MN, 2001. (2) Y. Besancon et al. Biotechnol. Appl. Biochem. 20:131, 1994. (3) Leu et al. Plant Pathol. Bull. 19:137, 2010. (4) Vauterin et al. Int. J. Syst. Bacteriol. 45:472, 1995.

Sign in / Sign up

Export Citation Format

Share Document