Brugmansia suaveolens as a New Host for Root-Knot Nematode, Meloidogyne incognita, in Goiás State, Brazil

Brugmansia suaveolens (Humb. and Bonpl. ex Willd.) Bercht. and J. Presl, also called White Angel’s Trumpet is an ornamental plant known, for its medicinal properties and as an invasive weed (Kwak et al., 2021; Petricevich et al., 2020). It belongs to the Solanaceae family, with a center of origin in South America, and it is currently found all over the world (Petricevich et al., 2020). In February 2020, B. suaveolens plants cultivated in a single garden in Vianópolis region (16°56'60.0"S 48°29'16.0"W), Goiás state, Brazil were observed presenting yellowing symptoms, with descending branches death. When the roots were inspected, a large number of galls were found, typical of root-knot nematodes. Samples of soil and root were sent to a Nematology Laboratory (LabNema) at São Paulo State University, Jaboticabal Campus. Forty-one thousand six hundred eggs and second-stage juveniles (J2s) were extracted from 100 cm³ of soil and 7,600 eggs and J2s of Meloidogyne sp. per gram of root. Morphological, enzymatic, and molecular techniques were used to identify the species. The perineal pattern of the females (n = 15) had a high dorsal arch, with thick streaks and a trapezoidal shape. The male labial region (n = 15) had a trapezoidal shape with apparent annulations (Eisenback and Hirschmann, 1981; Nascimento et al., 2021; Taylor and Netscher, 1974). The morphological characteristics of adults were similar to those originally described for M. incognita (Kofoid and White, 1919) Chitwood 1949. The profile of the isoenzyme esterase was studied (n = 16) and the phenotype I1, characteristic of M. incognita, was found (Esbenshade and Triantaphyllou, 1985). Genomic DNA (N = 20) was obtained through DNA of females, extracted by Worm Lysis Buffer (WLB) (Carvalho et al., 2019). Two sets of primers were used, Finc-1: GGGATGTGTAAATGCTCCTG, Rinc-1: CCCGCTACACCCTCAACTTC (Randig et al., 2002) and Finc-4: GTGAGGATTCAGCTCCCCAG, Rinc-4: ACGAGGAACATACTTCTCCGTCC (Meng et al., 2004), specific for M. incognita, which amplified fragments of 399 and 955 bp, respectively, confirming the species. A pathogenicity test was conducted under greenhouse conditions. Six newly formed seedlings were transplanted individually into 10-liter pots containing autoclaved soil and, subsequently, each plant was inoculated with 3,000 eggs and J2s from the original population of M. incognita. After 120 days, White Angel’s Trumpet plants showed reduced development, yellow leaves, and many root galls with abundant egg masses on the roots, unlike the non-inoculated plants. Nematodes were extracted from roots. The average recovered reached 78,458 eggs and J2s per plant, corresponding to a reproductive factor (RF) of 26.15. A high RF provides an alert for B. suaveolens cultivation in areas with a history of root-knot nematode infestation. Moreover, this disease outbreak might serve as a source of inoculum for large-scale cultivated plants near the farm, which are generally good hosts for M. incognita. This is the first report presenting Angel’s Trumpet as host of root-knot nematode, M. incognita, in Brazil and the world.

Development of Datura metel in different pot sizes

Datura metel L. belongs to Solanaceae family and presents medicinal and ornamental potential. The use of D. metel as an ornamental plant is still unexplored, however there is a need to gather more information about this species planting, especially for pot cultivation. This study aimed to verify the effects of different pot sizes in the development of D. metel, in order to enable the use of this species in the potted flower market. The work was conducted in a greenhouse at the Biotechnology Department located at Center of Agricultural Sciences of the Federal University of Paraíba (CCA-UFPB), Areia, PB, Brazil. The experimental design used was completely randomized with 3 treatments (pot sizes: T1 = 0.82 dm3, T2 = 1.55 dm3 e T3 = 3.68 dm3) and 10 replications. The variables analyzed were: plant height, stem diameter, canopy diameter, number of ramifications, leaf length, leaf width, leaf number, flower number, flower length, flower diameter, chrolophyll a e chrolophyll b. The data obtained was submited to analysis of variance and later on clustered based Tukey’s test (5%). All the analyses were made on GENES software. There is variation between treatments for characteristics evaluated. Treatments 2 (1.55dm3) and 3 (3.68dm3) had similar values and the highest mean values for the characteristics of plant height, number of leaves and chlorophyll b. The size of the vase influences the development of the Angel’s trumpet (D. metel). Pot size influences D. metel development. The medium size recipient (1.55 dm3) is recommended for cultivation of D. metel because it presents ideal plant development, such as plant height and number of leaves, for use with ornamental species pots.

Evaluation of different aqueous plant extracts against rice blast disease fungus (Magnaporthe oryzae)

The antifungal potentials of some medicinal plant leaf extracts have been established against fungal diseases. This research work was conducted to evaluate the effects of aqueous plant leaf extracts of five plants: Apple of Sodom (Calotropis procera), Neem tree (Azadirachta indica), Thorn Apple/Angel's trumpet (Datura metel), Aleo plant (Aleo vera) and Siam weed (Chromolaena odorata)) at different concentration (25, 50, and 100%) against rice blast disease (Magnaporthe oryzae) in-vitro and in-vivo. The research work was laid out in a split-split plot arrangement using a randomized complete block design with three replications. Data were collected for disease severity, disease incidence, number of tillers per plant, number of filled grains, the weight of 1000 grains, and panicle weight. The data collected were analyzed using IRRI STAR software (IRRI, 1979). Percentage inhibition was significantly higher at higher concentrations for all the aqueous plant extracts as compared to lower concentrations. The field trial result shows that there were significant differences among all the studied traits though at different levels for all the sources of variation. The leaf plant aqueous extracts at all the varied concentrations reduced the rate of disease severity and incidence while the number of tillers per plant, the number of filled grains, the weight of 1000 seeds, and panicle weight increased compared to control. The result revealed that Apple of Sodom (Calotropis procera) is the most efficient in combating rice blast disease followed by Neem tree (Azadirachta indica), Thorn Apple/Angel's trumpet (Datura metel), Aleo plant (Aleo vera), and Siam weed (Chromolaena odorata) in that other. These aqueous plant extracts can be used to manage rice blast disease at a low cost and it is ecofriendly compare to chemical fungicides. Keywords: Disease severity, Magnaporthe oryzae, Medicinal plants, Plant extracts, Rice

Potent In Vitro α-Glucosidase and β-Secretase Inhibition of Amyrin-Type Triterpenoid Isolated from Datura metel Linnaeus (Angel’s Trumpet) Fruits

This study deals with α-glucosidase and β-secretase inhibitory screening of extract/fractions and isolated daturaolone (1), namely, 3-oxo-6-β-hydroxy-β-amyrin (daturaolone) from chloroform fraction of Datura metel L. Among entire fractions, the chloroform soluble fraction showed excellent activity against α-glucosidase with % inhibition 90.8 with IC50160.2±1.85 μg and daturaolone (1) with 98.7% inhibition with IC50840.4±1.74 μM, respectively. Similarly, extract and daturaolone (1) also exhibited significant activity against the β-secretase enzyme (BACE1) with % activities 88.27 and 95.19 and with IC50 values 304.21±2.98 μg and 260.70±1.87 μM, respectively, as compared to the standard inhibitor (Ans670, Sta671, Val672)-amyloid-β/A4 precursor protein 770 fragments 662-675) with % activity 94.21 and IC50 value 289.24±1.60 μM. This finding encourages and opens a new window for further detail phytochemical investigation on D. metel in order to isolate novel compounds with promising enzyme inhibitory potential.