First report of Diplodia mutila causing leaf blight on Magnolia grandiflora in China

Magnolia grandiflora is a widely cultivated ornamental tree in China. In June 2020, a leaf blight disease was observed on M. grandiflora in Guizhou University (26° 44' 57'' N, 106° 65' 94'' E) in Guiyang, China. The initial symptoms on leaves were expanding round necrotic lesions with a grey center and dark brown edge, and twigs were withered when the disease was serious. Of the 100 plants surveyed 65% had symptoms. To isolate the potential causal pathogen, diseased leaves were collected from an M. grandiflora tree at Guizhou University. Isolations from made form the junction between healthy and symptomatic tissue and disinfested by immersing in 75% ethanol for 30 seconds, 3% NaOCl for 2 minutes, and then washed 3 times in sterile distilled water. Symptomatic tissue was then plated on potato dextrose agar (PDA) and incubated at 25ºC with 12-hour light for 3–5 days. Three isolates (GUCC 21235.1, GUCC 21235.2 and GUCC 21235.3) were obtained. Colonies on PDA after 7 d were dark brown, pycnidia embedded in the mydelium were dark brown to black, single and separated. Conidiophores were transparent measuring 7–12.5 × 2.5–4.5 µm (mean = 9.5 × 3.6 µm, n = 30) in length. Conidia were transparent becoming brown when mature with a diaphragm, with round ends measuring, 21–27 × 10–15 µm (mean = 23.6 × 12.6 µm, n = 30). To confirm the pathogen by molecular characterization, four genes or DNA fragments, ITS, LSU, tef1 and β-tubulin, were amplified using the following primer pairs: ITS4-F/ ITS5-R (White et al., 1990), LR0R/ LR5 (Rehner & Samuels, 1994), EF1-688F/ EF1-986R (Carbone & Kohn, 1999) and Bt2a/ Bt2b (O'Donnell & Cigelnik, 1997). The sequences of four PCR fragments of GUCC 21235.1 were deposited in GenBank, and the accession numbers were MZ519778 (ITS), MZ520367 (LSU), MZ508428 (tef1) and MZ542354 (β-tubulin). Bayesian inference was performed based on a concatenated dataset of ITS, LSU, tef1 and β-tubulin gene using MrBayes 3.2.10, and the isolates GUCC 21235.1 formed a single clade with the reference isolates of Diplodia mutila (Diplodia mutila strain CBS 112553). BLASTn analysis indicated that the sequences of ITS, LSU, tef1 and β-tubulin revealed 100% (546/546 nucleotides), 99.82% (568/569 nucleotides), 100% (302/302 nucleotides), and 100% (437/437 nucleotides) similarity with that of D. mutila in GenBank (AY259093, AY928049, AY573219 and DQ458850), respectively. For confirmation of the pathogenicity of this fungus, a conidial suspension (1×105 conidia mL-1) was prepared from GUCC 21235.1, and healthy leaves of M. grandiflora trees were surface-disinfested by 75% ethanol, rinsed with sterilized distilled water and dried by absorbent paper. Small pieces of filter paper (5 mm ×5 mm), dipped with 20 µL conidial suspension (1×105 conidia mL-1) or sterilized distilled water (as control), were placed on the bottom-left of the leaves for inoculation. Then the leaves were sprayed with sterile distilled water, wrapped with a plastic film and tin foil successively to maintain high humidity in the dark dark. After 36 h, the plastic film and tin foil on the leaves was removed, and the leaves were sprayed with distilled water three times each day at natural condition (average temperature was about 25 °C, 14 h light/10 h dark). After 10 days of inoculation, the same leaf blight began to appear on the leaves inoculated with conidial suspension. No lesion was appeared on the control leaves. The fungus was re-isolated from the symptomatic tissue. Based on the morphological information and molecular characterization, the isolate GUCC 21235.1 is D. mutila. Previous reports indicated that D. mutila infects a broad host range and gives rise to a canker disease of olive, apple and jujube (Úrbez-Torres et al., 2013; Úrbez-Torres et al., 2016; Feng et al., 2019). This is the first report of leaf blight on M. grandiflora caused by D. mutila in China.

First Report of Fusarium avenaceum Causing Canker Disease on Kiwi Tree in China

In May 2021, canker symptoms were detected on ‘Xuxiang’ kiwi trees in southwestern Shaanxi (Hanzhong municipality; 107.27° E, 33.23° N) in China. Seven-year-old trees exhibited black necrotic lesions and cracked areas in the trunk (Figure 1). The symptoms were observed in approximately 10% of the trees in 6 orchards (31 ha in total). Application of commercial fungicides did not control the advancement of the pathogen, and infected trees were removed to control the spread. Three samples, approximately 1 cm2 in size, of symptomatic tissue were collected and surface sterilized in 2% NaOCl for 1 min, and washed with sterile ddH2O. Four isolates showing white mycelium with yellow pigmentation were obtained after 4 days of incubation on PDA, containing chloramphenicol (50 µg/mL), at 28 ºC. The pathogen was isolated from all collected samples. ITS, EF1-α, TUB2, RPB1 and RPB2 genes were amplified using ITS1/ITS4, EF1-728F/EF1-986R, T1/T22, RPB1-5F/RPB1-8R and RPB2-5F/RPB2-7cR (strain NJC06), or RPB2-c7F/RPB2-11aR (strains NJC07 and NJC08), primers, respectively. Two isolates shared the same sequences (strain NJC08). Obtained sequences were submitted to GenBank under accession numbers MZ669205 and OL347898-OL347899 (ITS), OL439731-OL439733 (EF1-α), OL439734-OL439736 (TUB2), OL439737-OL439739 (RPB1), and OL439740-OL439742 (RPB2). The sequences shared >99% (ITS; F. avenaceum CBS 128538, MH864972), >99% (EF1-α; F. avenaceum 55-2, MN473124), 100% (TUB2; F. avenaceum SICAUCC 18-0001, MK253102), >98% (RPB1; F. avenaceum NRRL 26911, MG282372), and >98% (RPB2; F. avenaceum SICAUCC 18-0001, MK396098; or F. avenaceum FRC R-09495, CQ915486) homology to multiple F. avenaceum strains. Molecular phylogenetic tree (Figure 2) was constructed using MEGA7 with Fusarium strains found causing rot in various hosts (Wang et al. 2015), and other fungal species, such as Cadophora nalorum, Diaporthe ambigua, D. australafricana, and Neofusicoccum parvum, which were reported to cause cordon dieback on kiwi tree in Chile (Diaz et al. 2021). Microscope observations after cultivation of all isolates on barley-honey-tryptone medium (Song et al. 2020) showed the presence of septate mycelium, fusiform microconidia (8-15 µm in length, containing between 0 and 3 septa; n = 77) and chlamydospores (n = 21), and agree with the morphology of F. avenaceum (Zhao et al. 2020). To confirm pathogenicity, a sterilized spatula was used to make wounds (3 mm diameter, 1 mm depth) on the trunk of 3-months-old ‘Xuxiang’ kiwi trees. Solutions containing 1 × 106 spores/mL (20 µL) of the isolates were injected in the wounds. Sterile ddH2O was used for the control experiment. Inoculated plants were maintained in a growth chamber at 28 °C and 80% relative humidity for 4 days. The pathogen was recovered from the canker lesions, which were similar to those observed in the orchards, and its identity was confirmed by sequence analysis. The pathogen only infected wounded trees, and probably invaded the orchards during the pruning in February 2021. F. avenaceum was reported to cause canker on almond tree (Stack et al. 2020), stem rot on Anthoxanthum aristatum and Polygonatum cyrtonema (Pieczul et al. 2018; Xu et al. 2019), and root rot on carrot, Coptis chinensis and wheat (Le Moullec-Rieu et al. 2020; Mei et al. 2020; Ozer et al. 2020). Recently, F. avenaceum was found causing fruit blotch in kiwi fruit in Anhui (China) (Zhao et al. 2020). Here, F. avenaceum was found causing canker disease in kiwi tree, demonstrating the host and tissue promiscuity of this pathogen. Kiwi is an important crop in China with nearly 1.5 million tons produced in 2019. This report will help to better understand the pathogens reducing kiwi production in China.

First Report of Bacterial Canker on Blueberry (Vaccinium corymbosum) Caused by Pseudomonas syringae pv. syringae in Serbia

During May 2021, necrosis of young twigs and flower buds were observed on two-year-old highbush blueberry plants (Vaccinium corymbosum) cv. Draper, in a 1 hectare orchard in the municipality of Šabac, Serbia. Disease symptoms included reddish-brown to black irregularly shaped cankers developing on the shoot tips that extended downwards along the branches. In some plants, cankers surrounded the stem, causing shoot-tip dieback and necrosis of the buds. Beneath the bark, a distinct margin between diseased and healthy tissue was visible. A few weeks before symptoms development, seven freezing events with temperature from -3°C to -1°C, and five near-freezing temperatures were recorded in this area, leading to the hypothesis that symptoms were associated to the presence of ice nucleating bacteria belonging to Pseudomonas syringae. The observed disease incidence was 80%, while 10% of the plants died. Bacteria were isolated from symptomatic tissue on King’s medium B (KB). After 2 to 3 days of incubation at 27°C, predominantly grey-whitish, shiny, round, convex bacterial colonies were observed on agar plates. Ten isolates producing a fluorescent pigment on KB were selected for further characterization by biochemical and molecular tests. The isolates were Gram, oxidase and arginine-dihydrolase negative, levan positive, induced hypersensitive response on tobacco leaves and showed no pectinolytic activity on potato slices. Based on the results of API 20E and API 20NE tests (BioMerieux, France), and the fact that isolates did not utilize tartrate nor had tyrosinase activity, they were preliminarly identified as Pseudomonas syrinage pv. syringae (Braun-Kiewnick and Sands 2001). Additionally, all tested isolates had ice-nucleation activity at -5°C. The syrB gene responsible for syringomycin synthesis, was amplified in all isoaltes with the specific primer pair B1/B2 (Sorensen et al. 1998). The 16S rRNA gene sequences of five selected isolates (GenBank MZ410287 to 91) showed 100% identity to P. s. pv. syringae isolated from Prunus avium in United Kingdom (GenBank CP026568) and France (GenBank LT962480). Sequences of gyrB gene (Sarkar and Guttman 2004) of two selected isolates (GenBank MZ420633 and MZ420634) showed 98,44% identity to the P. s. pv. syrinage strain isolated in France (GenBank LT962480). Pathogenicity of the isolates was confirmed on 2-year-old blueberry plants cv. Draper, by inoculating two plants per isolate. One-cm long wounds were made on branches using a scalpel and 20 µl of bacterial suspension (106 CFU/ml) was infiltrated into the tissue. The cuts were then covered with moist sterile cotton pads and wraped in parafilm for 3 days. Inoculation was also performed on two leaves per plant by needleless syringe infiltration (106 CFU/ml). Sterile distilled water was used as a negative control. Plants were maintained in greenhouse at 27°C day and 15°C night temperature. Three weeks after inoculation, the inoculated branches and leaves developed necrosis, leaves spots and cankers respectively, resembling the natural infection. Symptoms were not observed on the control plants. Bacteria were reisolated from symptomatic tissue and their identity was confirmed by amplifying the syrB gene sequence and additional biochemical tests. This is the first report of bacterial canker of highbush blueberry caused by P. s. pv. syringae in Serbia. In Europe, there was only one report on Pseudomonas spp. causing disease on blueberry leaves in Poland (Kaluzna et al. 2013). Due to market demands and export potential, blueberry production in Serbia has been rapidly increasing. In 2015, highbush blueberry was cultivated on 220 ha, while in 2020 the area increased to 1899 ha. However, under favourable environmental conditions, blueberry production might be severely affected by bacterial canker. References: Braun-Kiewnick, A. and Sands, D.C. Page 84 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. N. W. Schaad et al., eds. The American Phytopathological Society, St. Paul, MN, 2001. Kaluzna, M., et al. 2013. J Plant Protec Res 53:32. Sarkar, S. F., and Guttman, D. S. 2004. Appl. Environ. Microbiol. 70:1999. https://doi.org/10.1128 Sorensen, K. N., et al. 1998. Appl. Environ. Microbiol. 64:226.

A Microscopic and Metabolomic Description of Stip-affected Tissue in New Mexico Pod-type Pepper

Stip is a physiological disorder that affects certain pepper (Capsicum annuum) cultivars, most notably bell-pod types. It has been attributed in the literature to nutrient imbalances, temperature extremes, and/or other environmental stressors. Symptoms present as brown, black, and yellow ovoid-shaped necrotic lesions ≈0.5 to 1.2 cm long by 0.5 cm wide. Between 2014 and 2015, symptomatic and asymptomatic pods were harvested from 15 commercial farms in southern New Mexico. Fluorescent microscopy comparisons of harvested symptomatic tissue revealed a unique fluorescent signature and the absence of chlorophyll. A new spectral peak centered around 560 nm was observed in symptomatic tissue. High-performance liquid chromatography (HPLC) and gas chromatography–mass spectrometry (GC-MS) analyses of these tissues detected significant differences in 13 metabolites, of which several have been associated with fruit maturation and/or senescence. This report represents the first combination of a detailed microscopic description and metabolite profile of field-grown symptomatic plants with this disorder.

First report of orchid fleck virus associated with citrus leprosis symptoms in rough lemon (Citrus jambhiri) and mandarin (C. reticulata) the United States

Citrus leprosis is an economically important disease of citrus in South and Central America. The disease can be caused by several non-systemic viruses belonging to the genera Cilevirus (family Kitaviridae) and Dichorhavirus (family Rhabdoviridae) (Roy et al. 2015; Freitas-Astúa et al. 2018). In February 2020, lesions consistent with citrus leprosis were observed on the leaves and stems of rough lemon (Citrus jambhiri) and mandarin (C. reticulata) trees in Hilo, Hawaii. Brevipalpus mites, vector of orchid fleck virus (OFV), were also present on these trees (Freitas-Astúa et al. 2018). To identify the virus associated with the symptoms, total RNA was isolated using a NucleoSpin RNA Plus kit (Macherey-Nagel) and underwent reverse transcription (RT)-PCR with two newly designed universal primers specific for dichorhaviruses (Dichora-R1-F1: 5`-CAYCACTGYGCBRTNGCWGATGA, Dichora-R1-R1: 5`-AGKATRTSWGCCATCCKGGCTATBAG). The expected ~350 bp amplicon was obtained and directly sequenced in both directions. Blastn and Blastx searches revealed that the primer-trimmed consensus sequence (MT232917) shared 99.3% nucleotide (nt) and 100% amino acid (aa) identity with an OFV isolate from Germany (AF321775). OFV has two orchid- (OFV-Orc1 and OFV-Orc2) and two citrus- (OFV-Cit1 and OFV-Cit2) infecting strains (Roy et al. 2020). However, an isolate of OFV-Orc1 has recently been associated with citrus leprosis in South Africa (Cook et al. 2019). To confirm the presence of OFV in Hawaiian citrus and identify the strain, symptomatic tissue was submitted to USDA-APHIS-PPQ-S&T where total RNA were extracted from the symptomatic tissue using RNeasy Plant Mini kit (Qiagen). The RNA samples were tested with OFV-Orc and OFV-Cit generic and specific primers in a conventional RT-PCR assay following optimized RT-PCR protocols (Roy et al. 2020). Two additional sets of generic primers (OFV-Orc-GPF: 5'-AGCGATAACGACCTTGATATGACACC, OFV-Orc-GPR: 5'-TGAGTGGTAGTCAATG CTCCATCAT and OFV-R2-GF1: 5'- CARTGTCAGGAGGATGCATGGAA, OFV-R2-GR: 5'- GACCTGCTTGATGTAATTGCTTCCTTC') were designed based on available OFV phospho (P) and large (L) polyprotein gene sequences in GenBank. These assays detected OFV-Orc2 in the symptomatic citrus samples, with the nucleocapsid (1353 bp), P (626 bp), and L (831 bp) gene sequences sharing 97 to 98% identity with published OFV-Orc2 sequences (AB244417 and AB516441). Ribo-depleted RNA (Ribo-Zero, Illumina) was prepared using a TruSeq Stranded Total RNA Library Prep kit (Illumina) and underwent high throughput sequencing (HTS) on a MiSeq platform (Illumina). The resulting 19.6 million 2x75bp reads were de novo assembled using SPAdes v. 3.10.0 (Bankevitch et al. 2012). In addition to sequences corresponding to citrus tristeza virus and citrus vein enation virus, two contigs of 6,412 nt (average depth 18,821; MW021482) and 5,986 nt (average depth 19,278; MW021483), were found to have ≥98% identity to RNA1 (AB244417) and RNA2 (AB244418) of OFV isolate So (Japan), respectively. This is the first report of OFV in Hawaii and the first time leprosis has been observed in the USA since it was eradicated from Florida in the 1960s, although that outbreak was attributed to infection by citrus leprosis virus-N0, a distant relative of OFV (Hartung et al. 2015). The recent detection of citrus leprosis associated with OFV infection in South Africa (Cook et al. 2019) and now Hawaii underscores the threat this pathogen poses to the global citrus industry.

First Report of Botryosphaeria dothidea Causing Stem Canker on Soybean in China

In September 2020, widespread stem canker on soybean (Glycine max) was detected in southeastern Jiangsu (Nantong municipality; 120.76° E, 32.23° N) in China. Mature plants, 14 weeks of cultivation, exhibited brown necrotic lesions and dried-up stem. The symptoms were observed in eleven soybean fields, 1.6 ha in total, and approximately 80% of the plants were symptomatic. The symptoms were consistent with those previously reported for stem canker on soybean caused by Diaporthe aspalathi, D. caulivora and D. sojae (Ghimire et al. 2019; Mena et al. 2020). Small pieces, approximately 0.4 cm2 in size, of symptomatic tissue were surface sterilized in 1.5% NaOCl for 1 min, and washed twice with sterile ddH2O. The pathogen was isolated and cultured on potato dextrose agar (PDA), containing chloramphenicol (50 µg/mL), under darkness at 28 ºC for 7 days. Amplification of internal transcribed spacer (ITS), elongation factor 1-α (EF1-α) and β-tubulin (TUB2) genes was performed using ITS1/ITS4, EF1-728F/EF1-986R and Bt2a/Bt2b primers, respectively (Jia et al. 2019). Sequences were submitted to GenBank under accession numbers MW130133 (ITS), MW147481 (EF1-α) and MW147482 (TUB2). Blast search revealed that the amplified sequences had 99.65% (ITS; B. dothidea JZB310202, MN945381), 100% (EF1-α; B. dothidea ZB-77, MH726166) and 99.75% (TUB2; B. dothidea ZB-1, MN642587) matches to multiple B. dothidea strains, whereas all reported Diaporthe strains showed no nucleotide identity to the amplified sequences. Molecular phylogenetic tree was constructed using MEGA7 to confirm the identity of the pathogen. ITS, EF1-α and TUB2 sequences were blasted separately in Muscle (https://www.ebi.ac.uk/Tools/msa/muscle/) and then combined together to make the phylogenetic tree. The evolutionary history was inferred by using the Maximum Likelihood method based on the Tamura 3-parameter model, and the tree with the highest likelihood (-4291.3981) is shown in Figure 1. Diaporthe strains found causing stem canker on soybean, some Phytophthora sojae strains (which also cause dried-up stem on soybean) (Yang et al. 2019), and B. dothidea strains found in China in other hosts were included in the phylogenetic tree. To confirm pathogenicity, a sterilized spatula was used to make wounds (3 mm diameter, 1 mm depth) on the stem of 2-week old soybean plants. Mycelial plugs from a 7 day-old culture on PDA were placed on the wounds and covered with Parafilm. Sterilized PDA plugs were used as control. Inoculated plants were maintained in a growth chamber at 28 °C and 60% relative humidity. Typical stem canker symptoms were observed 5 days after inoculation (Figure 2). Microscope observations showed the presence of septate mycelium, fusiform conidia and round conidiomata, and agreed with those previously reported for the morphology of B. dothidea strains (Phillips et al. 2013). During recent months, B. dothidea was reported to cause stem canker and leave wilt on a number of plant species in China (Huang et al. 2020; Ju et al. 2020; Wang et al. 2020a, 2020b, 2020c), confirming the expansion and host promiscuity of this pathogen. Stem canker on soybean has been thoroughly associated to Diaporthe strains; however, this is the first report of B. dothidea causing this disease. We believe that our results will help to better understand the pathogens affecting soybean production in China.

Can Biological Control Agents Reduce Multiple Fungal Infections Causing Decline of Milkwort in Ornamental Nursery?

This research evaluates biological control agents (BCAs) and fungicide alone and in combination for the management of decline caused by multiple fungi on milkwort (Polygala myrtifolia). Four experiments were performed in a greenhouse within a nursery located in Catania province (southern Italy). The activity of fungicides and biological control agents was evaluated by calculating the plant mortality (%) and recovery frequency (%) of different fungi associated with symptomatic tissue. Comprehensively, boscalid + pyraclostrobin and fosetyl-Al showed the best results in managing disease complex on milkwort. Biological control agents provided, on average, the lowest performances; nevertheless, in most cases, they were able to significantly reduce multiple infections and sometimes when combined with fungicide enhanced the effectiveness. The molecular analysis of 86 isolates obtained from symptomatic tissue allowed to identify the fungi involved in the disease as Calonectriapauciramosa, C. pseudomexicana, Fusariumoxysporum, Neocosmospora solani (syn. F. solani) and binucleate Rhizoctonia AG-R. Calonectriapseudomexicana never reported on milkwort and in Europe was inoculated on P. myrtifolia potted healthy cuttings and produced crown and root rot after 40 days. Our findings represent the first worldwide report about disease complex of milkwort caused by several fungi (Calonectria spp., Fusarium spp. and binucleate Rhizoctonia) and on the effects of integrated control strategies to manage this disease in the nursery.

First report of Mochi tree (Ilex integra) Anthracnose caused by Colletotrichum fioriniae in Korea

Ilex integra, also called Mochi tree, is an woody ornamental common in Asia, particularly in Korea, China, Japan, and Taiwan. Anthracnose, caused by Colletotrichum spp., is an economically important disease worldwide, affecting both fruit and seed quality. In April 2019, symptoms of Anthracnose were observed on leaves from several Mochi trees in an urban planting in Wando-gun, South Korea. Irregularly shaped, light-to-dark brown spots of 1-4mm were observed on young leaves. The lesions coalesced as each spot enlarged, flat and black fruiting bodies (acervuli) occurred on the brown lesions. Four symptomatic leaves were collected; fractions were cut from symptomatic tissue, including healthy tissue, then were disinfected with 1% sodium hypochlorite and 70% ethanol, and placed on potato dextrose agar (PDA). After dark-incubation at 25℃ for 7 days two isolates were obtained, the fungal colonies appeared as white to light gray mycelium, then becoming dark and orange to pink on the underside. After acervuli were produced on the plate, orange-red conidial masses erupted. Conidia observed from two isolates were hyaline, 1-celled, and oblong with round to acute apices, and measured 7 to 12 × 2 to 5 μm (mean ± SD: 9.29 ±2.26 × 3.68± 1.31 μm) (n=30). Genomic DNA was extracted and multi-locus sequencing was performed with one representative isolate using the internal transcribed spacer (ITS) (White et al. 1990), actin (ACT) genes, chitin synthase 1 gene (CHS-1) (Carbone and Kohn 1999), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), Calmodulin (CAL) (Weir et al. 2012) and submitted. Blast search results showed that the isolate had 100%, 98.45%, 99.74%, 100%, and 100% nucleotide sequence identity with those of C. fioriniae (MT607651, MH717601, MG666441, MN895544, MN974144) respectively (Jamin and Mateu 2008). The five sequences were deposited in NCBI GenBank (Accession No: MT457472, MT465884, MT465885, MT465886, MT465887), which were assigned to ITS, ACT, CHS-1, GAPDH, and CAL regions, respectively. Based on the morphology (Shivas and Tan 2009) and molecular characterization (Guerber et al. 2003), the isolate was identified as C. fioriniae. To confirm pathogenicity, a conidial suspension (10⁶ conidia/ml) of the sequenced isolate was used to inoculated, young and mature leaves of a 4-year-old Mochi tree. Ten leaves of the seedling were disinfected with 70% ethanol, then were wounded with a toothpick. The conidial suspension (20 µl) was placed on the wound. The inoculated plant and control plants were tested with sterilized water and incubated at 25℃ in a moist chamber. The pathogenicity test was repeated three times. Typical spots were observed on the young leaves 2 days after inoculation, whereas they were observed on the mature leaves 7 days after inoculation. Acervuli developed on both young and mature leaves 5 and 20 days after treatment, respectively. The control plants did not show symptoms, and the fungus was re-isolated from the inoculated plant; thus, fulfilling Koch’s Postulates. In Korea, C. fioriniae has been recorded as a pathogen of fruit (apple, eggplant and peach), but this is the first report of the fungus causing anthracnose on Mochi tree. The pathogen has been reported on leaves of a different Ilex species in the eastern USA (Farr and Rossman 2020). Although this new disease of I. integra is limited occurrence, C. fioriniae may be able to infect other plant species in South Korea.

First report: Co-infection of Sarcococca hookeriana (sweetbox) by Coccinonectria pachysandricola and Calonectria pseudonaviculata causes a foliar disease of sweetbox in Pennsylvania

Sweetbox (Sarcococca hookeriana) are high value ornamental shrubs susceptible to disease caused by Calonectria pseudonaviculata (Cps) and Coccinonectria pachysandricola (Cpa) (Malapi-Wight et al. 2016; Salgado-Salazar et al. 2019). In July 2018, 18-month old sweetbox with leaf spots and defoliation were observed in a residential landscape in Lancaster County, Pennsylvania. Small tan leaf spots grew to cover half of the leaf, developing a concentric banding with dark brown rings and a yellow halo (Sup. Doc. 1: Sup. Fig. 1). The symptoms agreed with those of Cpa disease of sweetbox reported from Washington D.C. (Salgado-Salazar et al. 2019). Diseased plants were located ~1.5 m from Buxus sempervirens with boxwood blight. Morphological and genetic characterization of isolated fungi and pathogenicity tests followed Salgado-Salazar et al. (2019) (Sup. Doc. 2). White to salmon pink spore masses developed on the abaxial leaf surface after humid chamber incubation. Two distinct fungal cultures were recovered (JAC 18-61, JAC 18-79) on potato dextrose agar (Fisher Scientific, Pittsburg, PA). JAC 18-61 presented cultural and morphological characteristics as described for Cps (Crous et al. 2002). JAC 18-79 produced flat, filamentous, light salmon colonies with tan centers and white filiform borders containing pale pink sporodochia, verticillate and simple conidiophores (x̄: 61.8 ± 20.12 µm, N = 20) with lateral, cylindrical phialides (x̄ = 18.1 ± 5.83 x 2.4 ± 0.7 µm, N = 20), and ellipsoid, hyaline conidia without septa (x̄ = 15.2 ± 1.9 x 3.3 ± 0.7 µm, N = 20). Sexual structures and chlamydospores were not observed. The characteristics of JAC 18-79 agree with those reported for Cpa (Salgado-Salazar et al. 2019). Bidirectional sequencing of the ITS, beta-TUB, and RPB1 and RPB2 regions was performed as described (Salgado-Salazar et al. 2019). BLASTn comparisons against NCBI GenBank revealed JAC 18-61 sequences (MT318150 and MT328399) shared 100% identity with Cps sequences (JX535321 and JX535307 from isolate CB002). Sequences from JAC 18-79 (MT318151, MT341237 to MT341239) were 100% identical to Cpa sequences (MH892596, MH936775, MH936703 from isolate JAC 16-20 and JF832909, isolate CBS 128674). The genome of JAC 18-79 was sequenced and yielded an assembly of 26.3 Mb (204 contigs > 1000 bases, N50 = 264.3 kb, 92x coverage, JABAHV0000000000) that contained the MAT1-2 mating-type idiomorph and shared 98.9% similarity with Cpa BPI910731. Isolate JAC 18-61 (Cps) caused lesions on wounded and unwounded sweetbox and boxwood leaves (Sup. Table 1). In general, JAC 18-79 (Cpa) infected only wounded leaves of both hosts; however, in one trial, one unwounded sweetbox and two unwounded boxwood plants developed lesions, possibly due to the presence of natural wounds. Control plants did not develop symptoms. These results diverge to some degree from previous reports of Cpa infecting unwounded sweetbox and not infecting wounded boxwood (Salgado-Salazar et al. 2019). These results indicate that virulence variation among Cpa isolates might occur. Plating of symptomatic tissue and examination of spores fulfilled Koch’s postulates for both pathogens. To our knowledge, this is the first report of Cpa blight on sweetbox in Pennsylvania, and the second U.S. report of the disease. This is also the first report of co-infection of Cpa and Cps on diseased sweetbox foliage. Given the capacity of Cpa to infect both sweetbox and boxwood, inspection for Cpa on both hosts is advisable.