Disproportionate Distribution of HBV Genotypes A and D and the Recombinant Genotype D/E in the High and Low HBV Endemic Regions of Uganda: A Wake-Up Call for Regional Specific HBV Management

Background. Hepatitis B virus (HBV) is the leading cause of liver-related diseases. In Uganda, there is a regional disparity in the HBV burden. Our study was aimed at establishing the circulating genotypes in a low and a high endemic region to give plausible explanations for the differences in regional burden and guide the future management of the disease. Methods. A total of 200 HBsAg-seropositive subjects were recruited into the study by convenience sampling. The HBsAg Rapid Test Strip (Healgen Scientific Limited Liability Company, Houston, TX77047- USA) was used to screen for HBsAg while the Roche machine (Roche, Basel Switzerland/Abbot Technologies (USA)) was used to determine the viral load. The Chemistry Analyzer B120 (Mindray, China) was used for chemistry analysis. For HBV genotyping, total DNA was extracted from whole blood using the QIAamp® DNA extraction kit. Nested PCR amplification was performed using Platinum Taq DNA Polymerase (Invitrogen Corporation, USA) to amplify the 400 bp HBV polymerase gene. Purification of nested PCR products was performed using Purelink PCR product purification kit (Life Technologies, USA). Automated DNA sequencing was performed using BigDye Terminator v3.1 Cycle Sequencing Kit on 3130 Genetic Analyzer (Applied Biosystems, USA). The NCBI HBV genotyping tool (https://www.ncbi.nlm.nih.gov/projects/genotyping/formpage.cgi) was used for determination of genotype for each HBV sequence. Pearson’s chi-square, multinomial logistic regression, and Mann–Whitney U tests were used for the analysis. All the analyses were done using SPSS version 26.0 and MedCalc software version 19.1.3 at 95% CI. A p < 0.05 was considered statistically significant. Results. Majority of our study subjects were female (64.5%), youth (51.0%), and married (62.0%). Overall, genotype A was the most prevalent (46%). Genotype D and the recombinant genotype D/E were proportionately more distributed in the high endemic (38.2%) and low endemic (36.5%) regions, respectively. Genotype D was significantly more prevalent in the high endemic region and among the elderly ( p < 0.05 ). Genotype D was significantly associated with elevated viral load and direct bilirubin ( p < 0.05 ). The recombinant genotype D/E was significantly associated with elevated viral load ( p < 0.05 ). Similarly, genotype A was significantly associated with elevated AST and GGT, lowered viral load, and normal direct bilirubin levels ( p < 0.05 ). Conclusion. There is disproportionate distribution of genotypes A and D and the recombinant genotype D/E in the low and high endemic regions of Uganda. This probably could explain the differences in endemicity of HBV in our country signifying the need for regional specific HBV management and control strategies.

Identification of Polymorphisms in GDF9 and BMP15 Genes in Jamunapari and Crossbred Goats in Bangladesh

Growth differentiation factor 9 (GDF9) and bone morphogenetic protein 15 (BMP15) are two crucial fecundity genes 15 associated with litter size traits in the goat. Our previous study on GDF9 and BMP15 genes detected single nucleotide polymorphisms (SNPs) associated with litter size in Bangladeshi Black Bengal goats. In this study, Jamunapari and crossbred goats of Bangladesh were screened to identify polymorphisms in the GDF9 and BMP15 genes and to assess the association between identified SNPs and litter size. The genomic DNA from 100 goats (50 Jamunapari and 50 crossbred) was used in Polymerase Chain Reaction (PCR) to amplify the exon 2 of the GDF9 and exon 2 of the BMP15 gene. PCR products were sequenced employing the BigDye Terminator cycle sequencing protocol, to identify SNPs. A generalized linear model was utilized to perform the association analysis for identified SNPs and litter size. Seven SNPs were identified, of which four: C818CT, G1073A, G1189A and G1330T were in the GDF9 gene, three: G616T, G735A and G811A were in the BMP15 gene. G735A was a synonymous SNP, whereas the remaining were non-synonymous SNPs. Identified SNP loci in GDF9 were low polymorphic (PIC<0.25) while loci in BMP15 were moderately polymorphic (PIC≥0.25). The genotypes at the G1330T locus had a significant (p<0.05) difference in litter size in Jamunapari goat, but no significant difference was observed for all genotypes at other loci. This study provides additional molecular markers that would be useful for future research on the litter size trait in goats of Bangladesh.

Hepatitis B Transmission: Is Vertical Transmission the Major Route in Intermediate Endemic Areas? A Proof-of-Concept Study Based on Mother–Child Genotypes

The route of hepatitis B transmission is believed to be horizontal in India, though pediatric studies showed mother as source in the majority of chronic HBV (CHB) cases. We aimed at establishing the fact that mother–child transmission is the main route of acquisition by documenting genotypically identical viruses in mother–child pairs. Blood samples of consecutive children (≤18 years) with CHB and high DNA (>10,000 IU/mL) and their positive mother were collected from January 2013 to December 2015. Polymerase chain reaction (PCR) products of HBV-DNA were amplified and sequenced by using BigDye Terminator Cycle Sequencing Kit v3.1 and aligned with previously described sequences in the region of interest for genotypes A to G by using BioEdit software. Phylogenetic tree was generated using p-distance algorithm in MEGA software version 6. Genotyping of 59 (33 children and 26 mothers) subjects include genotype A in 24 (40.7%) and genotype D in 35 (59.3%). Both mother–child pair genotyping was possible in 25. The median age of 25 children (20 males) was 9 (interquartile range, IQR: 4–11). The distribution of genotypes among mother–child pairs was similar. The concordance between children and their mothers was 24 of 25 (96%). Evolutionary analyses showed significant similarities between mother and child sequences for both genotype A and D, suggesting thereby the same virus. In conclusion, mother–baby transmission seems to be the major route of acquisition of HBV in children in India and near-complete homology in genetic sequences between mother–child pairs is definite proof for that. However, a larger epidemiological study is required to substantiate our findings.

First report of black currant-associated rhabdovirus in blackcurrants in Latvia

Blackcurrants (Ribes nigrum) are among the most important commercial berry crops in Latvia and, together with redcurrants and gooseberries, have a long history of local cultivation and breeding (Zuļģe et al. 2018). So far at least 20 viruses were reported to infect Ribes plants (Špak et al. 2021). Blackcurrant-associated rhabdovirus (BCaRV) was previously identified in USA by high throughput sequencing (HTS) of blackcurrant germplasm accession introduced from Russia (isolate Veloy) and now serves as an exemplar isolate for BCaRV (Wu et al. 2018). Presence of BCaRV was also confirmed by RT-PCR in blackcurrant germplasm accession of cv. Burga from France during the same study by Wu et al. (2018). Currently Blackcurrant betanucleorhabdovirus is one of the nine species recognized by ICTV in genus Betanucleorhabdovirus of family Rhabdoviridae, but the impact of BCaRV on the host still remains unknown. Leaf tissue from twelve asymptomatic blackcurrant cv. Mara Eglite plants that negatively tested for blackcurrant reversion virus from Dobele, Latvia (56°36'31.9"N, 23°18'13.6"E) was collected on May 17, 2019 and used for HTS study of local Ribes resistance genes. Total RNA from the leaf tissue of sampled plants was isolated following a method described by Kalinowska et al. (2012) with minor modifications. Briefly, RNeasy Plant Mini Kit (QIAGEN) was used with RLC lysis buffer being supplemented with 2% PVP and 1% β-mercaptoethanol. Plant rRNA was subsequently removed by a RiboMinus Plant Kit for RNA-Seq (Thermo Fisher Scientific (TFS)) prior to cDNA library construction. HTS libraries were prepared using MGIEasy RNA Directional Library Prep Set for 16 reactions (MGI), following a protocol for 150 bp pair-end reads. According to the manufacturers guidelines libraries were pooled, circularized and cleaned before being subjected to sequencing on DNBSEQ-G400 (MGI) using PE150 flow cell (MGI). The sequencing run yielded a total of 393660492 150 bp long read pairs. Reads were assembled into transcripts using rnaSPAdes v 3.13.1 (Bushmanova et al. 2019) and a 14424 base long contig with an average coverage of 684x was found to be 99.5% identical (14358/14432 identities and 8 gaps in the pairwise alignment) to the previously reported first complete genome of BCaRV (MF543022.1) using EMBOSS Needle (Madeira et al., 2019). This contig representing the genome of BCaRV isolate Mara Eglite, onto which 66768 of the raw reads could be mapped, was subsequently deposited at European Nucleotide Archive under accession number OU015520. All of the twelve individual samples were also tested for the presence of BCaRV by RT-PCR, using Verso cDNA Synthesis Kit with random hexamer primers (TFS) for first strand cDNA synthesis followed by PCR with N protein nested primers BCaRV-N-F (5’ AGATGTGCTTCATCGATGGCTAGTTCTGCT 3’) and BCaRV-N-R (5’ TGCATTCCCACGGGTTAGGAATACATTGGTACT 3’) resulting in a 243 bp long fragment for six of the samples. RT-PCR products from six BCaRV positive samples were directly sequenced by Sanger-based method using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) with BCaRV-N-F and BCaRV-N-R primers. Acquired RT-PCR product sequences matched the corresponding region of BCaRV isolate Mara Eglite genome assembled from HTS data. In this report, we have documented the natural occurrence of BCaRV in Latvia, which makes it a second evidence on the presence of BCaRV in Europe.

Identification of Tinomiscium petiolare from Vietnam using the DNA barcode

Background. Tinomiscium petiolare Hook.f. & Thomson is a medicinal species of the family Menispermaceae. This species is currently being intensively exploited for therapeutic purposes. Precise and rapid identification of T. petiolare is critical and essential for the classification, propagation, use and conservation of its genetic resources. In recent years, DNA barcoding has been known to be a fast and sensitive method for identifying species at any stage of development, using short DNA sequences. In this study we have performed the identification of T. petiolare specimens in Vietnam based on the sequence analysis of 4 DNA barcode loci: ITS, matK, rbcL and rpoC.Materials and methods. Total DNA was extracted from leaf samples using DNeasy Plant Mini Kit. PCR amplification of the ITS, matK, rbcL and rpoC regions was carried out on the GeneAmp PCR System 9700 with specific primers. The purified PCR products were sequenced on the ABI 3500 Genetic Analyzer system, using BigDye®Terminator v3.1 Cycle Sequencing Kit. These genetic sequences were analyzed and compared, and a phylogenetic tree was constructed using BioEdit, BLAST, and MEGA 6 programs.Results and conclusion. The success rate of amplification and sequencing was 100% for all 4 DNA barcode loci (ITS, matK, rbcL and rpoC) in the studied specimens. The produced sequence sizes of ITS, matK, rbcL and rpoC in the specimens were 574 bp, 810 bp, 527 bp and 488 bp, respectively. Further, we identified that all studied specimens were genetically related to each other and associated with the same species T. petiolare. Overall, the results of the study generated the most complete DNA barcode database of T. petiolare collected in Vietnam, contributing to the taxonomy and identification of this species.

A Case Report on Genetic Analysis of Exon2 of Thyroid Transcription Factor 2 Gene in Congenital Hypothyroidism Patient

A-3-year- old Bangladeshi pediatric patient named Tasin was presented with a diagnosed case of congenital hypothyroidism (CH). This type of hypothyroidism may occur due to the alteration in the nucleotide sequences of the Thyroid transcription factor 2 gene. Few studies are present on the genetic basis of this disease. CH is common in Bangladesh, may be due to geographical variation or other causes. Therefore, this study was conducted to identify whether there was any genetic alteration in the exon2 of Thyroid transcription factor 2 gene. With due procedure and permission from the guardian of the pediatric patient, socio-demographic data was collected. Isolation of DNA, quantitation and qualitation of DNA was ensured, polymerase chain reaction (PCR) was performed, the amplicons that was obtained from PCR; validated visually by gel electrophoresis methods; cycle sequencing was performed by Sanger sequencing. The chromatogram data that was obtained from Sanger sequencing was analyzed and compared with the National Center for Biotechnology Information database by Basic Local Alignment Search Tool search. Sanger sequencing revealed substitution (c.1051G>T) in the Sequence Tagged Site of the exon2 of Thyroid transcription factor 2 gene and this is new variants and not reported in National Center for Biotechnology Information database.

Full length genomic sanger sequencing and phylogenetic analysis of Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) in Nigeria

In an outbreak, effective detection of the aetiological agent(s) involved using molecular techniques is key to efficient diagnosis, early prevention and management of the spread. However, sequencing is necessary for mutation monitoring and tracking of clusters of transmission, development of diagnostics and for vaccines and drug development. Many sequencing methods are fast evolving to reduce test turn-around-time and to increase through-put compared to Sanger sequencing method; however, Sanger sequencing remains the gold standard for clinical research sequencing with its 99.99% accuracy This study sought to generate sequence data of SARS-CoV-2 using Sanger sequencing method and to characterize them for possible site(s) of mutations. About 30 pairs of primers were designed, synthesized, and optimized using endpoint PCR to generate amplicons for the full length of the virus. Cycle sequencing using BigDye Terminator v.3.1 and capillary gel electrophoresis on ABI 3130xl genetic analyser were performed according to the manufacturers’ instructions. The sequence data generated were assembled and analysed for variations using DNASTAR Lasergene 17 SeqMan Ultra. Total length of 29,760bp of SARS-CoV-2 was assembled from the sample analysed and deposited in GenBank with accession number: MT576584. Blast result of the sequence assembly shows a 99.97% identity with the reference sequence. Variations were noticed at positions: nt201, nt2997, nt14368, nt16535, nt20334, and nt28841-28843, which caused amino acid alterations at the S (aa614) and N (aa203-204) regions. The mutations observed at S and N-gene in this study may be indicative of a gradual changes in the genetic coding of the virus hence, the need for active surveillance of the viral genome.

Plasmodium falciparum multidrug resistance gene-1 polymorphisms in Northern Nigeria: implications for the continued use of artemether-lumefantrine in the region

Background The analysis of single nucleotide polymorphism (SNPs) in drug-resistance associated genes is a commonly used strategy for the surveillance of anti-malarial drug resistance in populations of parasites. The present study was designed and performed to provide genetic epidemiological data of the prevalence of N86Y-Y184F-D1246Y SNPs in Plasmodium falciparum multidrug resistance 1 (pfmdr1) in the malaria hotspot of Northern Nigeria. Methods Plasmodium falciparum-positive blood samples on Whatman-3MM filter papers were collected from 750 symptomatic patients from four states (Kano, Kaduna, Yobe and Adamawa) in Northern Nigeria, and genotyped via BigDye (v3.1) terminator cycle sequencing for the presence of three SNPs in pfmdr1. SNPs in pfmdr1 were used to construct NYD, NYY, NFY, NFD, YYY, YYD, YFD and YFY haplotypes, and all data were analysed using Pearson Chi square and Fisher’s exact (FE) tests. Results The prevalence of the pfmdr1 86Y allele was highest in Kaduna (12.50%, 2 = 10.50, P = 0.02), whilst the 184F allele was highest in Kano (73.10%, 2 = 13.20, P = 0.00), and the pfmdr1 1246Y allele was highest in Yobe (5.26%, 2 = 9.20, P = 0.03). The NFD haplotype had the highest prevalence of 69.81% in Kano (2 = 36.10, P = 0.00), followed by NYD with a prevalence of 49.00% in Adamawa, then YFD with prevalence of 11.46% in Kaduna. The YYY haplotype was not observed in any of the studied states. Conclusion The present study suggests that strains of P. falciparum with reduced sensitivity to the lumefantrine component of AL exist in Northern Nigeria and predominate in the North-West region.

Plasmodium falciparum Multidrug Resistance Gene-1 polymorphisms in Northern Nigeria: implications for the continued use of artemether-lumefantrine in the region

Background The analysis of single nucleotide polymorphism (SNPs) in drug-resistance associated genes is a commonly used strategy for the surveillance of anti-malarial drug resistance in populations of parasites. The present study was designed and performed to provide genetic epidemiological data of the prevalence of N86Y-Y184F-D1246Y SNPs in Plasmodium falciparum multidrug resistance 1 (pfmdr1) in the malaria hotspot of Northern Nigeria.Methods Plasmodium falciparum-positive blood samples on Whatman-3MM filter papers were collected from 750 symptomatic patients from four states (Kano, Kaduna, Yobe and Adamawa) in Northern Nigeria, and genotyped via BigDye (v3.1) terminator cycle sequencing for the presence of three SNPs in pfmdr1. SNPs in pfmdr1 were used to construct NYD, NYY, NFY, NFD, YYY, YYD, YFD and YFY haplotypes, and all data were analysed using Pearson Chi-square and Fisher's exact (FE) tests.Results The prevalence of the pfmdr1 86Y allele was highest in Kaduna (12.50%, 𝜒² = 10.50, P = 0.02), whilst the 184F allele was highest in Kano (73.10%, 𝜒² = 13.20, P = 0.00), and the pfmdr1 1246Y allele was highest in Yobe (5.26%, 𝜒² = 9.20, P = 0.03). The NFD haplotype had the highest prevalence of 69.81% in Kano (𝜒² = 36.10, P = 0.00), followed by NYD with a prevalence of 49.00% in Adamawa, then YFD with prevalence of 11.46% in Kaduna. The YYY haplotype was not observed in any of the studied states.Conclusion The present study suggests that strains of P. falciparum with reduced sensitivity to the lumefantrine component of AL exist in Northern Nigeria and predominate in the North-West region.

Preimplantation Genetic Diagnosis for Beta Thalassemia

Background: Beta thalassemia is an autosomal recessive genetic disease with the symptoms of severe anaemia, ineffective erythropoiesis and bone deformities. Preimplantation genetic diagnosis is a noninvasive clinical tool for couples who are at risk of affected pregnancy to have a healthy child. Objectives: Here we report a PGD test for a couple who were heterozygous for CD36/37(-T) mutation in HBB gene and had terminated one affected pregnancy. Methods: Haplotype analysis of 6 flanking STR markers as well as variant detection by cycle sequencing were included in our PGD test in order to investigate the status of the embryos reliably. Results: Three out of five embryos were transferable. Conclusions: One normal and one carrier embryo were transferred which resulted in the singleton pregnancy and the birth of a healthy girl.