Nonparametric-based estimation method for river cross-sections with point cloud data from UAV photography URiver-X version 1.0 -methodology development

Aerial surveying with unmanned aerial vehicles (UAVs) has been popularly employed in river management and flood monitoring. One of the major processes in UAV aerial surveying for river applications is to demarcate the cross-section of a river. From the photo images of aerial surveying, a point cloud dataset can be abstracted with the structure from motion (SfM) technique. To accurately demarcate the cross-section from the cloud points, an appropriate delineation technique is required to reproduce the characteristics of natural and manmade channels, including abrupt changes, bumps, and lined shapes, even though the basic shape of natural and manmade channels is a trapezoidal shape. Therefore, a nonparametric-based estimation technique, called the K-nearest neighbor local linear regression (KLR) model, was tested in the current study to demarcate the cross-section of a river with a point cloud dataset from aerial surveying. The proposed technique was tested with a simulated dataset based on trapezoidal channels and compared with the traditional polynomial regression model and another nonparametric technique, locally weighted scatterplot smoothing (LOWESS). Furthermore, the KLR model was applied to a real case study in the Migok-cheon stream, South Korea. The results indicate that the proposed KLR model can be a suitable alternative for demarcating the cross-section of a river with point cloud data from UAV aerial surveying by reproducing the critical characteristics of natural and manmade channels, including abrupt changes and small bumps, as well as the overall trapezoidal shape.

The planning of mine drainage system at PT Perkasa Inakakerta, East Kutai Regency

This research located in Beruang Block Kalimantan. The purpose of the mine drainage planning system is to control runoff water. Therefore, an excellent drainage system is needed without interfering with mining activities such as runoff water pollution, which could cause contamination in the surrounding area and outside the mining sites. Based on the analysis of rainfall data of 2009-2020, the precipitation plan was 341.67 mm/day; the concentration time was 2.37 h, the rain intensity was 41.06 mm/h, and repeated rain periods were 2-years. The extensive catchment area was 1.52 km2 because the runoff entering the sump was 44.38 m3/h. To prevent the water from entering the mining area, an open channel was made around the mine openings, and the water flows naturally into the sump. The water pumped into the settling pond with the pump type Allight HL 150MHD-IT at 50 m/s for 3-days with a single rain, resulting in total water volume of 17,556.5 m3/day. A trapezoidal shape was designed for a sump with dimensions of 3.96 m in length and width at the surface, 1.79 m length and width at the base, and 1.03 depth.

Brugmansia suaveolens as a New Host for Root-Knot Nematode, Meloidogyne incognita, in Goiás State, Brazil

Brugmansia suaveolens (Humb. and Bonpl. ex Willd.) Bercht. and J. Presl, also called White Angel’s Trumpet is an ornamental plant known, for its medicinal properties and as an invasive weed (Kwak et al., 2021; Petricevich et al., 2020). It belongs to the Solanaceae family, with a center of origin in South America, and it is currently found all over the world (Petricevich et al., 2020). In February 2020, B. suaveolens plants cultivated in a single garden in Vianópolis region (16°56'60.0"S 48°29'16.0"W), Goiás state, Brazil were observed presenting yellowing symptoms, with descending branches death. When the roots were inspected, a large number of galls were found, typical of root-knot nematodes. Samples of soil and root were sent to a Nematology Laboratory (LabNema) at São Paulo State University, Jaboticabal Campus. Forty-one thousand six hundred eggs and second-stage juveniles (J2s) were extracted from 100 cm³ of soil and 7,600 eggs and J2s of Meloidogyne sp. per gram of root. Morphological, enzymatic, and molecular techniques were used to identify the species. The perineal pattern of the females (n = 15) had a high dorsal arch, with thick streaks and a trapezoidal shape. The male labial region (n = 15) had a trapezoidal shape with apparent annulations (Eisenback and Hirschmann, 1981; Nascimento et al., 2021; Taylor and Netscher, 1974). The morphological characteristics of adults were similar to those originally described for M. incognita (Kofoid and White, 1919) Chitwood 1949. The profile of the isoenzyme esterase was studied (n = 16) and the phenotype I1, characteristic of M. incognita, was found (Esbenshade and Triantaphyllou, 1985). Genomic DNA (N = 20) was obtained through DNA of females, extracted by Worm Lysis Buffer (WLB) (Carvalho et al., 2019). Two sets of primers were used, Finc-1: GGGATGTGTAAATGCTCCTG, Rinc-1: CCCGCTACACCCTCAACTTC (Randig et al., 2002) and Finc-4: GTGAGGATTCAGCTCCCCAG, Rinc-4: ACGAGGAACATACTTCTCCGTCC (Meng et al., 2004), specific for M. incognita, which amplified fragments of 399 and 955 bp, respectively, confirming the species. A pathogenicity test was conducted under greenhouse conditions. Six newly formed seedlings were transplanted individually into 10-liter pots containing autoclaved soil and, subsequently, each plant was inoculated with 3,000 eggs and J2s from the original population of M. incognita. After 120 days, White Angel’s Trumpet plants showed reduced development, yellow leaves, and many root galls with abundant egg masses on the roots, unlike the non-inoculated plants. Nematodes were extracted from roots. The average recovered reached 78,458 eggs and J2s per plant, corresponding to a reproductive factor (RF) of 26.15. A high RF provides an alert for B. suaveolens cultivation in areas with a history of root-knot nematode infestation. Moreover, this disease outbreak might serve as a source of inoculum for large-scale cultivated plants near the farm, which are generally good hosts for M. incognita. This is the first report presenting Angel’s Trumpet as host of root-knot nematode, M. incognita, in Brazil and the world.

VERTICAL STRESS DISTRIBUTION AT THE BASE OF SOIL DAMS WITH A TRAPEZOIDAL CROSS SECTION

Problem statement. The research materials outlined in this work make it possible to construct the design profile of dams from soil materials, taking into account the strong compressibility of the soil and check the strength of the foundation of soil dams in depth. In addition, the results obtained by us can be used to determine the lower boundary of the compressible thickness of the bases, to the upper boundary of which a distributed load of either a triangular or trapezoidal shape is applied. Methods. Theoretical studies of geomechanical processes using analytical and numerical mathematical methods. Analysis and generalization of the results of theoretical research. Results. In the course of writing this article, we obtained analytical dependences of stresses at the base of earth dams on the coordinates and applied to the upper boundary of the base of the trapezoidal external load and showed the methods of accounting. Scientific novelty. Analytical dependences of vertical normal at the base of a soil dam with a trapezoidal profile have been obtained. The profiles of the dam in the form of isosceles and non-isosceles trapezoids are considered. Practical significance. The research materials outlined in this work make it possible to construct the design profile of dams from soil materials, taking into account the strong compressibility of the soil and check the strength of the foundation of soil dams in depth. In addition, our results can be used to determine the lower boundary of the compressible strata of the bases, to the upper boundary of which a distributed load of either a triangular or trapezoidal shape is applied.

Impact of a tunnel on the TL of a vehicle floor in bare and trimmed conditions and investigation on the most suitable simplified geometry able to better represent such impact

NVH engineers are faced with the challenge of designing trim parts for vehicle interior and exterior, like inner dash insulators, carpets, underbody shields or engine encapsulations, which can be made with very different Bills of Materials (BOMs) including among others foams, felts or heavier layers. The measurables commonly used to rank various solutions are Transmission Loss (TL) and absorption. Depending on the numerical analysis method, different approaches may be considered for the evaluation of the TL of an automotive component. In particular, in Statistical Energy Analysis (SEA), automotive components are modeled as an assembly of panels having a simple shape, e.g. flat panels and/or panels with single or double curvature. Furthermore, in SEA the trim is normally modeled by means of the Transfer Matrix Method (TMM), which is essentially a 2-dimensional methodology. This paper intends to analyze in some depth the level of approximation that these practices bring with themselves, specifically in relation to the modelling of an automotive floor. More in detail, the aim of the paper is first to investigate what impact has the presence of the tunnel on the TL of a vehicle floor in bare and trimmed conditions and then to evaluate if the presence of the tunnel can be better modeled by using a semi-cylinder or three flat plates welded together in a trapezoidal shape, both shapes considered as a reasonable simplification of the actual geometry of a typical tunnel. The analysis is carried out at simulation level using FE. To investigate both air bone noise and structure borne noise transmission, two types of excitations are used: a diffuse acoustic pressure field applied to the entire floor surface and an imposed displacement applied to the edge of the floor surface. Furthermore, 3 different kind of trims are taken into consideration in order to analyze if and how the tunnel modeling strategy may influence the evaluation of the trim effectiveness.

The Effect of Adding Shear Connectors to the Composite Slabs with Different Geometry of Profile Steel Sheet

The aim of this research is to investigate experimentally the effect of adding shear connectors to the composite deck slabs which have various geometries of steel sheeting. The behavior and resistance of composite slab is basically depending on the development of longitudinal shear resistance. In this study six specimens of composite deck slabs which have different types of geometries of steel sheets (trapezoidal, triangle and T-shapes) with dimensions (1850mm x 500mm x 110mm) were casted and tested under four-point load in presence and absence of shear connectors in order to evaluate the behavior and longitudinal shear resistance of composite slabs. The results show that the adding shear connectors to composite slabs with trapezoidal shape and triangle shape act to increase ultimate load capacity by 22.2% and 17.8% respectively as compared with composite slabs without shear connectors while effect of adding shear connectors to the composite slab with T-shape was very little or can be neglected. As well as the adding shear connectors to composite slabs with trapezoidal shape and triangle shape act to decreasing the deflection as compared with the same load also act to enhance the general performance of slabs

Evaluation of Active Heat Sinks Design under Forced Convection—Effect of Geometric and Boundary Parameters

This study shows the performance of heat sinks (HS) with different designs under forced convection, varying geometric and boundary parameters, via computational fluid dynamics simulations. Initially, a complete and detailed analysis of the thermal performance of various conventional HS designs was taken. Afterwards, HS designs were modified following some additive manufacturing approaches. The HS performance was compared by measuring their temperatures and pressure drop after 15 s. Smaller diameters/thicknesses and larger fins/pins spacing provided better results. For fins HS, the use of radial fins, with an inverted trapezoidal shape and with larger holes was advantageous. Regarding pins HS, the best option contemplated circular pins in combination with frontal holes in their structure. Additionally, lattice HS, only possible to be produced by additive manufacturing, was also studied. Lower temperatures were obtained with a hexagon unit cell. Lastly, a comparison between the best HS in each category showed a lower thermal resistance for lattice HS. Despite the increase of at least 38% in pressure drop, a consequence of its frontal area, the temperature was 26% and 56% lower when compared to conventional pins and fins HS, respectively, and 9% and 28% lower when compared to the best pins and best fins of this study.

Augmentation of Fluid Flow and Heat Transfer Characteristics in corrugated Channel: A Review Study

The corrugation configuration played an important role in heat transfer enhancement in many engineering applications such as heat exchangers, microchannel heat sink, solar collectors, etc. The significance of the corrugation configuration is manifested in its ability to offer a larger heat transfer area more than a straight channel. Besides, the periodic interruption and redeveloping of the thermal boundary layer which is an important feature offered by corrugation is remarkably enhanced the heat transfer. The researchers were keen to take advantage of these features and develop them by manipulating geometrical parameters to obtain the optimal results. The current work aims to collect available research data, which focused on improving heat transfer in corrugated channels and identifying the most important factors affecting the performance of corrugated channels. Among the studied shapes of the various operating conditions of the corrugated channels, the researchers unanimously agreed that the trapezoidal shape of the corrugations gives the best thermal improvement with a reasonable pressure drop inside the channels.