Silencing AC1 of Tomato leaf curl virus using artificial microRNA confers resistance to leaf curl disease in transgenic tomato

2020 ◽  
Vol 39 (11) ◽  
pp. 1565-1579
Author(s):  
Namisha Sharma ◽  
Manoj Prasad
Plant Disease ◽  
2000 ◽  
Vol 84 (1) ◽  
pp. 102-102 ◽  
Author(s):  
S. Mansoor ◽  
S. H. Khan ◽  
M. Hussain ◽  
N. Mushtaq ◽  
Y. Zafar ◽  
...  

Whitefly-transmitted geminiviruses (begomoviruses) have emerged as major constraints on food and fiber crops worldwide, and there are several examples of begomovirus mobilization in previously unknown host plants. Here we report on evidence that leaf curl disease of watermelon in Pakistan is caused by Tomato leaf curl virus-India (TLCV-India). Leaf curl disease of watermelon, characterized by leaf curling and mottling and stunted plant growth, was observed at several locations in the Punjab Province of Pakistan. Symptomatic and asymptomatic leaf samples were collected from three locations, and total DNA was isolated by the cetyltrimethylammoniumbromide method and resolved in agarose gel. A full-length clone of Cotton leaf curl virus DNA A was labeled with [32P]dCTP and used as a general probe in Southern hybridization. The probe detected characteristic geminivirus DNA forms in infected watermelon plants, whereas no signal was detected in asymptomatic plants. The association of a begomovirus was confirmed further by polymerase chain reaction (PCR) amplification with degenerate primers PAL1V and pAR1c (2). Samples were screened for infection by TLCV-India, because of symptom similarity. A full-length clone of DNA B of TLCV-India (1) was labeled with [32P]dCTP by random priming and was used as a specific probe in Southern hybridization. The probe detected geminivirus DNA forms, showing that the disease is associated with TLCV-India. Primers TLCV1 (GAGGTACCAAAACTTGTCGTTTTGATTCGG), in the virion-sense, and TLCV2 (GCCCATGGTTCTTTGCTCGGAGAACAAGAA), in the complementary-sense, were designed based on the sequence of DNA A of TLCV-India. These primers were used in PCR and amplified a product of the expected size from infected plants. Similarly, primers TLCVBC1 (GCGGATCCTTATTCCGTAATTATATCTGCA), in the virion-sense, and TLCV BC2 (CACCATGGCAATAGGAAATGATGGTATGGG), in the complementary-sense, were designed based on the sequence of DNA B of TLCV-India (1). These primers amplified a product of expected size when used in PCR. The results show that watermelon leaf curl disease in Pakistan is associated with TLCV-India. This the first report of detection of a begomovirus in watermelon in Pakistan and the first report of detection of TLCV-India on a plant other than tomato from Southeast Asia. References: (1) M. Padidam et al. J. Gen. Virol. 76:25, 1995. (2) M. R. Rojas et al. Plant Dis. 77:340, 1993.


Author(s):  
M. M. Hasan ◽  
M. B. Meah ◽  
Y. Sano

Tomato leaf curl virus (ToLCV) has frequently emerged as a severe problem for tomato in the recent past, in the tropical and subtropical region of the world. We have cloned and sequenced two isolates of ToLCV responsible for the leaf curl disease of tomato in Bangladesh. Two betasatellite DNAs were associated with ToLCV, and complete nucleotide sequences were determined.  The complete genome sequences of ToLCV-[BD:Mym:11] and ToLCV-[BD:Mym2:11] shared the highest nucleotide sequence identities at 95.04 and 92.38%, respectively, with Indian isolate of Tomato leaf curl virus - [India:Ranchi:2007] (ToLCV-[IN:Ran:07]) and Tomato leaf curl Patna virus - [India:Lucknow:2009] (ToLCPatV-[IN:PLuc:09]). Complete nucleotide sequence analysis of the two betasatellite clones, tomato leaf curl betasatellite – [BD:Mym:11] and tomato leaf curl betasatellite – [BD:Mym2:11] associated with (ToLCV-[BD:Mym:11] and (ToLCV-[BD:Mym2:11], when used in BLAST searches respectively revealed 95.51 and 86.43% identity with Tomato leaf curl Bangladesh betasatellite (ToLCBDB-[BD-Gaz-01]) and Tomato leaf curl Patna betasatellite (ToLCPaB-[IN-Pat-07]).


2009 ◽  
Vol 53 (2) ◽  
pp. 99-104 ◽  
Author(s):  
H. Tamarzizt ◽  
S. Chouchane ◽  
R. Lengliz ◽  
D. Maxwell ◽  
M. Marrakchi ◽  
...  

2002 ◽  
Vol 147 (2) ◽  
pp. 255-272 ◽  
Author(s):  
N. Kirthi ◽  
S. P. Maiya ◽  
M. R. N. Murthy ◽  
H. S. Savithri

Plant Disease ◽  
2003 ◽  
Vol 87 (5) ◽  
pp. 598-598 ◽  
Author(s):  
S. L. Shih ◽  
W. S. Tsai ◽  
S. K. Green ◽  
P. M. Hanson ◽  
G. B. Valand ◽  
...  

The Asian Vegetable Research and Development Center's (AVRDC) tomato breeding lines derived from Lycopersicon hirsutum f. glabratum B 6013 × L. esculentum H-24 and carrying the Ty-2 resistance gene located on chromosome 11 are tolerant to tomato leaf curl disease in Karnataka State, southern India (3), where several isolates of Tomato leaf curl Virus-Bangalore (GenBank Accession Nos. L11746, Z48182, and AF165098) and Tomato leaf curl virus-Karnataka (GenBank Accession No. U38239) are reported to infect tomatoes. The only area in south and southeast Asia where these AVRDC tomato breeding lines were found susceptible to begomovirus infection is Thailand, where several bipartite Tomato yellow leaf curl virus isolates (GenBank Accession Nos. X63015, X63016; AF141922, AF141897; and AF511529, AF511528) are reported to be prevalent. However, in field trials conducted in the fall of 1999 in Bodeli, Gujarat State, western India, the AVRDC breeding lines showed typical symptoms of begomovirus infection, such as leaf curling and vein clearing. The presence of a different tomato begomovirus was suspected. Viral DNA from a symptomatic plant from Bodeli was amplified by polymerase chain reaction (PCR) using the begomovirus-specific degenerate primer pair PAL1v1978/PAR1c715 (4) and the expected 1.4-kb PCR product was obtained. Based on the sequence of the 1.4-kb DNA product, specific primers were designed to complete the DNA-A sequence. The DNA-A of the virus associated with tomato leaf curl from Bodeli consists of 2,759 nucleotides (GenBank Accession No. AF413671) and contains six open reading frames (ORFs V1, V2, C1, C2, C3, and C4). The DNA-A sequence of the Bodeli isolate had highest sequence identities of 98 and 98.3%, respectively, with viruses causing tomato leaf curl from Varanasi, Uttar Pradesh State, northern India (GenBank Accession No. AF449999) collected in the fall of 1999 and Panchkhal, Nepal (GenBank Accession No. AY234383) collected in early 2000. There was no evidence for the presence of DNA-B in the Bodeli, Panchkhal, or Varanasi virus isolates using DNA-B specific primer pairs DNABLC1/DNABLV2 and DNABLC2/DNABLV2 (2). However, a 1.3-kb DNA-beta was detected in the Panchkhal and Varanasi isolates using the primer pair Beta01/Beta02 (1). Sequence comparisons with begomovirus sequences available in the GenBank database showed that these three virus isolates and GenBank Accession No. AY190290 collected in 2001 from Varanasi shared more than 97% sequence identity with each other and should be considered closely related strains of the same virus. These four virus isolates belong to a new distinct tomato geminivirus species because their sequences share less than 88% sequence identities with the next most closely related virus, Tomato leaf curl virus-Karnataka (GenBank Accession No. U38239). This new tomato leaf curl virus is prevalent in western India, northern India, and Nepal. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) V. Muniyappa et al. HortScience 37:603, 2002. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.


2021 ◽  
Vol 39 (1) ◽  
pp. 79-83
Author(s):  
Yasir Iftikhar ◽  
◽  
Mustansar Mubeen ◽  
Ashara Sajid ◽  
Mohamed Ahmad Zeshan ◽  
...  

Iftikhar, Y., M. Mubeen, A. Sajid, M.A. Zeshan, Q. Shakeel, A. Abbas, S. Bashir, M. Kamran and H. Anwaar. 2021. Effects of Tomato Leaf Curl Virus on Growth and Yield Parameters of Tomato Crop. Arab Journal of Plant Protection, 39(1): 79-83. Tomato is an important vegetable crop, belongs to the family Solanaceae and is the second most consumed vegetable following potatoes. The tomato crop is grown all over the world in both summer and winter seasons, and plant viruses are a major threat to tomato production. Among these viruses, tomato leaf curl virus (TLCV) causes considerable yield loss to tomato crop. This virus is transmitted by a whitefly (Bemisia tabaci) vector. In this study, the effect of TLCV infection, on the following tomato growth and yield parameters, was evaluated: plant leaf number and area, plant biomass, plant height, root length, and plant stem diameter and yield. Tomato plants were transplanted in wellprepared plots with 4 replications. The control group was covered with polyethene bag to avoid whitefly infestation. Plants were scored on the 15th and 30th day after inoculation and TLCV disease severity was recorded. Analysis of variance (ANOVA) showed the significant differences between the healthy and infected tomato plants. Moreover, growth and yield parameters were reduced with the increase in disease incidence, disease severity and whitefly infestation. Disease severity was increased with the increase in temperature during the growing season. It can be concluded from this study that TLCV significantly affects growth and yield of the tomato crop. Keywords: Tomato, Tomato leaf curl virus, TLCV, disease incidence, disease severity.


2019 ◽  
Vol 31 (1) ◽  
pp. 105-111
Author(s):  
Saneela Arooj ◽  
Yasir Iftekhar ◽  
Mustansar Mubeen ◽  
Muhammad I. Ullah ◽  
Ashara Sajid ◽  
...  


2019 ◽  
Vol 14 (3) ◽  
pp. e1565595 ◽  
Author(s):  
Ravindra K. Chandan ◽  
Achuit K. Singh ◽  
Sunita Patel ◽  
Durga Madhab Swain ◽  
Narendra Tuteja ◽  
...  

Sign in / Sign up

Export Citation Format

Share Document