DNA-binding protein activated by gamma radiation in human cells

1990 ◽  
Vol 10 (10) ◽  
pp. 5279-5285
Author(s):  
S P Singh ◽  
M F Lavin
Keyword(s):  
Dna Binding ◽  
Ionizing Radiation ◽  
Mammalian Cells ◽  
Binding Protein ◽  
Simian Virus 40 ◽  
Dna Binding Protein ◽  
Simian Virus ◽  
Human Cells ◽  
Binding Motif ◽  
Binding Studies

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.

scholarly journals DNA-binding protein activated by gamma radiation in human cells.

1990 ◽  
Vol 10 (10) ◽  
pp. 5279-5285 ◽  
Author(s):  
S P Singh ◽  
M F Lavin
Keyword(s):  
Dna Binding ◽  
Ionizing Radiation ◽  
Mammalian Cells ◽  
Binding Protein ◽  
Simian Virus 40 ◽  
Dna Binding Protein ◽  
Simian Virus ◽  
Human Cells ◽  
Binding Motif ◽  
Binding Studies

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.

Simian virus 40 origin- and T-antigen-dependent DNA replication with Drosophila factors in vitro

1994 ◽  
Vol 14 (8) ◽  
pp. 5114-5122
Author(s):  
R T Kamakaka ◽  
P D Kaufman ◽  
B Stillman ◽  
P G Mitsis ◽  
J T Kadonaga
Keyword(s):  
Dna Replication ◽  
Dna Binding ◽  
Binding Protein ◽  
Simian Virus 40 ◽  
Dna Binding Protein ◽  
Simian Virus ◽  
T Antigen ◽  
Drosophila Species ◽  
Single Stranded Dna ◽  
Sv40 Dna

DNA replication of double-stranded simian virus 40 (SV40) origin-containing plasmids, which has been previously thought to be a species-specific process that occurs only with factors derived from primate cells, is catalyzed with an extract derived from embryos of the fruit fly Drosophila melanogaster. This reaction is dependent upon both large T antigen, the SV40-encoded replication initiator protein and DNA helicase, and a functional T-antigen binding site at the origin of DNA replication. The efficiency of replication with extracts derived from Drosophila embryos is approximately 10% of that observed with extracts prepared from human 293 cells. This activity is not a unique property of embryonic extracts, as cytoplasmic extracts from Drosophila tissue culture cells also support T-antigen-mediated replication of SV40 DNA. By using highly purified proteins, DNA synthesis is initiated by Drosophila polymerase alpha-primase in a T-antigen-dependent manner in the presence of Drosophila replication protein A (RP-A; also known as single-stranded DNA-binding protein), but neither human RP-A nor Escherichia coli single-stranded DNA-binding protein could substitute for Drosophila RP-A. In reciprocal experiments, however, Drosophila RP-A was able to substitute for human RP-A in reactions carried out with human polymerase alpha-primase. These results collectively indicate that many of the specific functional interactions among T antigen, polymerase alpha-primase, and RP-A are conserved from primates to Drosophila species. Moreover, the observation that SV40 DNA replication can be performed with Drosophila factors provides a useful assay for the study of bidirectional DNA replication in Drosophila species in the context of a complete replication reaction.

scholarly journals Simian virus 40 origin- and T-antigen-dependent DNA replication with Drosophila factors in vitro.

1994 ◽  
Vol 14 (8) ◽  
pp. 5114-5122 ◽  
Author(s):  
R T Kamakaka ◽  
P D Kaufman ◽  
B Stillman ◽  
P G Mitsis ◽  
J T Kadonaga
Keyword(s):  
Dna Replication ◽  
Dna Binding ◽  
Binding Protein ◽  
Simian Virus 40 ◽  
Dna Binding Protein ◽  
Simian Virus ◽  
T Antigen ◽  
Drosophila Species ◽  
Single Stranded Dna ◽  
Sv40 Dna

DNA replication of double-stranded simian virus 40 (SV40) origin-containing plasmids, which has been previously thought to be a species-specific process that occurs only with factors derived from primate cells, is catalyzed with an extract derived from embryos of the fruit fly Drosophila melanogaster. This reaction is dependent upon both large T antigen, the SV40-encoded replication initiator protein and DNA helicase, and a functional T-antigen binding site at the origin of DNA replication. The efficiency of replication with extracts derived from Drosophila embryos is approximately 10% of that observed with extracts prepared from human 293 cells. This activity is not a unique property of embryonic extracts, as cytoplasmic extracts from Drosophila tissue culture cells also support T-antigen-mediated replication of SV40 DNA. By using highly purified proteins, DNA synthesis is initiated by Drosophila polymerase alpha-primase in a T-antigen-dependent manner in the presence of Drosophila replication protein A (RP-A; also known as single-stranded DNA-binding protein), but neither human RP-A nor Escherichia coli single-stranded DNA-binding protein could substitute for Drosophila RP-A. In reciprocal experiments, however, Drosophila RP-A was able to substitute for human RP-A in reactions carried out with human polymerase alpha-primase. These results collectively indicate that many of the specific functional interactions among T antigen, polymerase alpha-primase, and RP-A are conserved from primates to Drosophila species. Moreover, the observation that SV40 DNA replication can be performed with Drosophila factors provides a useful assay for the study of bidirectional DNA replication in Drosophila species in the context of a complete replication reaction.

Sign in / Sign up

Export Citation Format

Share Document