First Report of Root-Knot Nematode Meloidogyne enterolobii on Gardenia jasminoides in China

In early April 2012, a sampling of watermelon crop Citrullus lanatus (Thunb.) Matsum & Nakai, 1916 cv. Sunsugar took place as part of the National System of Epidemiological Phytosanitary Surveillance (SINAVEF-MEX). This sampling was conducted at Riachuelos locality, Tecolutla, Veracruz, located at the geographic coordinates: 20.42008° N and 96.9627° W, within 50 meters of the Gulf of Mexico. Plants showed yellowing, stunting, and high levels of infection expressed by extensive galling on the roots. These symptoms were reproduced in the greenhouse on watermelon cv. Sunsugar. Egg masses were extracted to obtain juveniles (J2). Female necks and perineal patterns were mounted as well as males and J2 to take measurements of selected morphometric characters. To determine the nematode identity based on a morphological species concept, the following characters were considered. Females: stylet length, DGO and perineal pattern; males: stylet length; J2: body, stylet, tail, and hyaline tail terminus length. The morphometric analysis showed that those values corresponded to the original description of the root-knot nematode Meloidogyne enterolobii Yang & Eisenback, 1983 (=M. mayaguensis Rammah & Hirschmann, 1988) (1,2,3,4). For confirmation of this finding, a molecular diagnosis was performed using markers located in rDNA and mtDNA by PCR amplification and DNA sequencing. The rDNA region analyzed was the expansion segments D2-D3 of the 28S gene (primers D2A and D3B). This produced an amplified product of 780 bp. With regard to mtDNA, an amplification of the marker located between the genes COII/16S (primers C2F3 and 1108) resulted in a fragment of 705 bp that is specific for M. enterolobii (1). Sequences of the amplified products were compared with sequences from GenBank (NCBI). The sequences of both markers exhibited 99 and 100% identity with sequences corresponding to M. enterolobii isolates from Florida, Puerto Rico, and China. Maximum likelihood phylogenetic trees of rDNA and mtDNA sequences demonstrated that the Mexican isolate of M. enterolobii grouped among other isolates exclusive of other Meloidogyne species. The detection of this nematode in Veracruz, Mexico, expands the previously known worldwide distribution. It represents a serious threat due to the high level of aggressiveness shown in watermelon, which was so severe that growers had to change to a different crop. To our knowledge, this is the first report of the root-knot nematode M. enterolobii infecting watermelon cv. Sunsugar in Veracruz, Mexico. References: (1) J. Brito et al. J. Nematol. 36:232, 2004. (2) G. Karssen et al. ZooKeys 181:67, 2012. (3) A. Rammah and H. Hirshmann. J. Nematol. 20:58, 1988. (4) B. Yang and J. Eisenback. J. Nematol. 15:381, 1983.

Download Full-text

First Report of Root-Knot Nematode Meloidogyne enterolobii on Cockscomb (Celosia argentea var. cristata) in Taiwan

Plant Disease ◽

10.1094/pdis-10-21-2126-pdn ◽

2021 ◽

Author(s):

Jo Tzu Ho ◽

Che-Chang Liang ◽

P. Janet Chen

Keyword(s):

United States ◽

18S Rdna ◽

The United States ◽

Root Knot Nematode ◽

First Report ◽

Meloidogyne Enterolobii ◽

Celosia Argentea ◽

Pathogenicity Tests ◽

Primer Sets ◽

Coii Region

Cockscomb (Celosia argentea) is commonly found in subtropical and temperate zones of Africa, South America and South East Asia, and is a popular ornamental plant in the family Amaranthaceae. Cockscomb has been known to contain antiviral proteins, betalains, and anthocyanin, which can be applied in beneficial ways (2). In September 2020, a cockscomb plant (Celosia argentea var. cristata) showing typical galling root symptoms likely infected by root-knot nematodes (Meloidogyne sp.) was collected from a garden in Taichung, Taiwan, and a quick exam of several individuals using MK7F/R primers (7) indicating they were M. enterolobii. Nematode population was established from a single egg mass and was later used for species identification and pathogenicity tests. Five perineal patterns of mature females from the single female population show round to oval shapes with weak lateral lines. Dorsal arches are moderate to high, almost squared, with the smooth ventral striae. Second-stage juveniles are vermiform and have a slender tail, tapering to rounded tip with distinct hyaline region at the tail terminus. Morphological measurements of 28 J2s revealed body length = 457.2 ± 20.6 (416.1-506.9) μm, body width = 16.0 ± 2.0 (13.4-20.3) μm, stylet length = 14.7 ± 0.5 (13.9-15.9) μm, dorsal gland orifice to the stylet base = 4.0 ± 0.5 (2.0-4.8) μm, and tail length = 56.0 ± 3.8 (47.4-60.3) μm. Female perineal patterns and morphometric data are similar to the original description of Meloidogyne enterolobii (9). DNA purified from approximately 1500 juveniles using GeneMark Tissue & Cell Genomic DNA Purification Kit (GeneMark, Taiwan) was used to amplify 18S rDNA fragment, D2-D3 expansion segments of 28S rDNA, and a COII region on mtDNA with primer sets 1A/MelR, D2A/D3B, and C2F3/1108, respectively (4,5,6). The 18S rDNA sequence (OK076893) of this study shares 99.94% nucleotide identity with those of M. enterolobii isolated from the United States (KP901058) and China (MN832688). D2D3 sequence of haplotype 1 (OK076898) shows 100% identity to those of M. enterolobii from China (MT193450) and Taiwan (KP411230). Sequence of haplotype 2 (OK076899) shows 99.86% identity to those of M. enterolobii from the United States (MN809527) and China (MN269945). Sequence of the COII region (OK086042) show 99.86% identity to that of M. enterolobii from China (MN269945). Phylogenetic trees of the three gene sequences were plotted following Ye et al.(10), revealing that the newly described root-knot nematode on Cockscomb is grouped with other M. enterolobii isolates. DNA fragment amplified by primer sets Me-F/R(3) and MK7F/R specifically targeting of M. enterolobii yielded 236 bp and 520 bp, respectively. Pathogenicity tests were assayed, from July to September 2021, on three-week-old nematode-free cockscomb plant directly germinated from seeds of SkyStar® (ASUSA SPIKE SEEDS, Taipei, Taiwan) planted in a 10.5 cm diameter pot filled with 600 ml sterilized peat moss: sand (1:1, v/v) soil in a 28℃walk-in chamber. Nematode eggs were extracted using 0.05% NaoCl as described by Vrain(8), and cockscomb plants (n=3) were inoculated by adding 6000 eggs (10 eggs/ cm3). Cockscomb plants treated with water were used as mock controls. Rf value of the inoculated plants were determined by the method of Belair and Benoit (1) 45 days after inoculation, and the average was 4.13. No galls were observed on the roots of control plants. The results confirmed that cockscomb is the new host of M. enterolobii. To the best of our knowledge, this is the first report of M. enterolobii on Celosia argentea var. cristata in Taiwan.

Download Full-text

First Report of the Root-Knot Nematode Meloidogyne enterolobii Parasitizing African Nightshades in Kenya

Plant Disease ◽

10.1094/pdis-11-15-1300-pdn ◽

2016 ◽

Vol 100 (9) ◽

pp. 1954-1954 ◽

Cited By ~ 3

Author(s):

O. Chitambo ◽

S. Haukeland ◽

K. K. M. Fiaboe ◽

G. M. Kariuki ◽

F. M. W. Grundler

Keyword(s):

Root Knot Nematode ◽

First Report ◽

Meloidogyne Enterolobii

Download Full-text

First report of the root-knot nematode Meloidogyne enterolobii parasitising sweet pepper (Capsicum annuum) in Niger

New Disease Reports ◽

10.5197/j.2044-0588.2017.036.018 ◽

2017 ◽

Vol 36 ◽

pp. 18

Author(s):

B.T. Assoumana ◽

S. Habash ◽

M. Ndiaye ◽

G. Van der Puije ◽

E. Sarr ◽

...

Keyword(s):

Capsicum Annuum ◽

Sweet Pepper ◽

Root Knot Nematode ◽

First Report ◽

Meloidogyne Enterolobii

Download Full-text

First Report of the Root-Knot Nematode Meloidogyne enterolobii Infecting Mulberry in China

Plant Disease ◽

10.1094/pdis-03-19-0648-pdn ◽

2019 ◽

Vol 103 (9) ◽

pp. 2481-2481

Author(s):

Y. F. Sun ◽

H. B. Long ◽

F. P. Lu

Keyword(s):

Root Knot Nematode ◽

First Report ◽

Meloidogyne Enterolobii

Download Full-text

First Report of the Root-Knot Nematode Meloidogyne enterolobii Infecting Jackfruit Tree in China

Plant Disease ◽

10.1094/pdis-04-15-0406-pdn ◽

2015 ◽

Vol 99 (12) ◽

pp. 1868-1868

Author(s):

H. B. Long ◽

Y. F. Sun ◽

C. Bai ◽

D. L. Peng

Keyword(s):

Root Knot Nematode ◽

First Report ◽

Meloidogyne Enterolobii

Download Full-text

First Report on the Root-Knot Nematode Meloidogyne enterolobii (Yang and Eisenback, 1988) Infecting Guava (Psidium guajava) in Udham Singh Nagar of Uttarakhand

International Journal of Current Microbiology and Applied Sciences ◽

10.20546/ijcmas.2018.704.195 ◽

2018 ◽

Vol 7 (04) ◽

pp. 1720-1724 ◽

Cited By ~ 1

Author(s):

Satya Kumar ◽

Shilpi Rawat

Keyword(s):

Psidium Guajava ◽

Root Knot Nematode ◽

First Report ◽

Meloidogyne Enterolobii

Download Full-text

First Report of the Root-Knot Nematode Meloidogyne enterolobii Infecting Jujube in China

Plant Disease ◽

10.1094/pdis-04-14-0370-pdn ◽

2014 ◽

Vol 98 (10) ◽

pp. 1451-1451 ◽

Cited By ~ 1

Author(s):

H. B. Long ◽

C. Bai ◽

J. Peng ◽

F. Y. Zeng

Keyword(s):

Morphological Characteristics ◽

Nematode Species ◽

First Record ◽

Reproduction Rate ◽

Root Knot Nematode ◽

Mt Dna ◽

First Report ◽

Intergenic Spacers ◽

Traditional Chinese Herbal Medicine ◽

Meloidogyne Enterolobii

Jujube (Ziziphus jujuba Mill.) is an economically-important fruit crop grown in Europe, Australia, and southern/eastern Asia. In China, it is often called red date and the fruit is used in traditional Chinese herbal medicine and wine. In February 2014, jujube plants growing in a sandy soil in Sanya, Hainan Province, China, were observed exhibiting symptoms of decline, including stunting, wilting, and no flowering or fruit set. Roots systems of sick plants (n = 20) had many galls, the typical symptoms of root-knot nematode infection, and the incidence of infection was 100%. These galls were formed in the primary, secondary, and tertiary roots. Meloidogyne spp. females and egg masses were dissected from the symptomatic roots. Each root contained about 72 females on average (n = 20). The perineal patterns of females (n = 10) were oval shaped with moderate to high dorsal arches and mostly lacking obvious lateral lines. Second-stage juveniles (n = 20) had large and triangular lateral lips and broad, bluntly rounded tail tips. These morphological characteristics are the same as those for Meloidogyne enterolobii Yang & Eisenback 1983 (5). Identification was further confirmed after DNA extraction from 12 nematodes. Part of the rDNA spanning the internal transcribed spacer (ITS) 1, 5.8S gene, and ITS2 was amplified with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (4). A 764-bp fragment was amplified, which was 100% identical to sequences of M. enterolobii (GenBank Accession Nos. KJ146863, KF418369, JQ082448, and JX024149) in GenBank. Species identification was confirmed by using PCR to amplify mitochondrial (mt) DNA and rDNA intergenic spacers (IGS) 2 with primers C2F3/1108 (GGTCAATGTTCAGAAATTTGTGG/TACCTTTGACCAATCACGCT) (3) and M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), respectively (2). The PCR products were approximately 700 bp for mtDNA and 200 bp for rDNA-IGS2, which were also identical to those previously reported for M. enterolobii (2,3). M. enterolobii is considered as one of the most damaging root-knot nematode species due to its wide host range, high reproduction rate, and ability to overcome the resistance genes (Mi-1, Mh, Mir1, N, Tabasco, and Rk) in several crops (1). It is reported that over 20 plant species from eight families (Annonaceae, Apiaceae, Cucurbitaceae, Convolvulaceae, Fabaceae, Marantaceae, Myrtaceae, and Solanaceae) in China are hosts for M. enterolobii. To our knowledge, this is the first report of jujube as a host of M. enterolobii and the first record of M. enterolobii as a parasite of a plant in the family Rhamnaceae in China. References: (1) P. Castagnone-Sereno. Nematology 14:133, 2002. (2) H. Long et al. Acta Phytopathol. Sinica 36:109, 2006. (3) T. O. Powers and T. S. Harris. J. Nematol. 25:1, 1993. (4) T. C. Vrain et al. Fundam. Appl. Nematol. 15:565, 1992. (5) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

Download Full-text

First Report of Root-Knot Nematode Meloidogyne enterolobii on Guava in Vietnam

Plant Disease ◽

10.1094/pdis-93-6-0675c ◽

2009 ◽

Vol 93 (6) ◽

pp. 675-675 ◽

Cited By ~ 5

Author(s):

H. Iwahori ◽

N. T. N. Truc ◽

D. V. Ban ◽

K. Ichinose

Keyword(s):

Sequence Data ◽

Nematode Species ◽

Original Description ◽

The United States ◽

Psidium Guajava ◽

Root Knot Nematode ◽

First Report ◽

Citrus Greening Disease ◽

Southern Vietnam ◽

Meloidogyne Enterolobii

In southern Vietnam, citrus is interplanted with guava (Psidium guajava L.) for the management of citrus greening disease. Guava seedlings exhibited decline symptoms including leaf browning, growth inhibition, leaf drop, and death. These symptomatic seedlings were accompanied by severely galled roots, possibly attributable to root-knot nematodes. We collected second-stage juveniles from the soil and picked adult females from roots to perform morphological observations. The perineal patterns of most specimens were similar to those in the original description of Meloidogyne enterolobii (3). However, some were similar to that of M. incognita. Such variability among perineal patterns precluded unequivocal identification. Therefore, DNA was extracted from these nematodes and their sequences were compared with those in the DNA sequence database. For the comparison, we employed the primer sets of Powers and Harris (1) to amplify a region between cytochrome oxidase II and the 16S ribosomal DNA gene of mitochondria by PCR. An approximate 700-bp fragment was obtained and analyzed, revealing more than 99.6% homology to M. mayaguensis, a synonym of M. enterolobii (2), when aligned with sequence data of isolates from France (GenBank Accession No. AJ421396), the United States (GenBank Accession No. AY446978), and China (GenBank Accession No. AY831967). These results indicate that the nematode species responsible for guava damage in southern Vietnam is M. enterolobii. To our knowledge, this is the first report of M. enterolobii in Vietnam. References: (1) T. O. Powers and T. S. Harris. J. Nematol. 25:1, 1993. (2) J. Xu et al. Eur. J. Plant Pathol. 110:309, 2004. (3) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

Download Full-text