First Report of the Apple Root-Knot Nematode, Meloidogyne mali, on Maple Trees in Republic of Korea

Meloidogyne mali was originally described in Japan on roots of an apple rootstock (Malus prunifolia) (Itoh et al. 1969) and found on elm trees in Italy, Netherlands, Belgium, France and United Kingdom, and euonymus in the USA (EPPO 2018; Prior et al. 2019). In Italy, the nematode was initially described as a new species, Meloidogyne ulmi, but was later synonymized with M. mali (Ahmad et al., 2013). During the study of Meloidogyne species in Republic of Korea, galled roots were found on Acer palmatum collected in Naejangsan National Park, Republic of Korea located at 35°29'29.1"N, 126°55'42.7"E, altitude 147.8 m. Morphologically, the perineal patterns of the females was very similar to M. mali due to rounded dorsal arch and smooth, finely-spaced, indistinct striae. Lateral field shallow, narrow, and faint. Phasmids large, very distinct. Head region of second–stage juveniles flattened anteriorly to hemispherical, slightly set-off from body, without annulations, low head cap. Stylet slender, sharply pointed cone, cylindrical shaft with rounded knob sloping posteriorly. Tail conoid with irregular, and rounded end. Rectum undilated. Several micrographs were made from 25 J2s and females for mean, standard deviation and range. J2s were measured with a body length: 408.2 ± 25.1 (366-449) µm, maximum body width: 15.9 ± 1.0 (14.1-17.9) µm, stylet length: 14.1 ± 0.5 (13.1-15.3) µm, hyaline tail terminus: 10.0 ± 0.9 (8.3-11.0) µm and tail length: 31.7 ± 3.0 (26.0-36.1) µm. Females (n=25) were characterized by a body length: 656.7 ± 102.7 (516-947) µm, a stylet length: 16.4 ± 2.2 (13.9-19.0) µm, a vulval slit length: 22.2 ± 1.8 (19.8-25.7) µm, and a vulva-anal distance: 20.2 ± 2.4 (17.1-25.4) µm. Morphological measurements and configuration of perineal patterns (Fig. 1S) were comparable to M. mali (Itoh et al. 1969; Ahmed et al. 2013; Gu et al. 2020). To confirm pathogenicity, a modified version of Koch’s postulates was conducted in the greenhouse by inoculating 300 eggs from a single egg mass onto each of three, two-year-old A. palmatum plants, grown in sterilized sandy soil. After about one year, symptoms developed on the maple tree roots, with numerous galls containing females and egg masses by visual inspection. In addition, PCR was performed for the 28S rDNA D2-D3 segment and ITS region using the primers D2A, D3B, TW81 and AB28. The resulting sequences (MW522548, MW522549, MW523004 and MW523005) were at least 99% identical to other 28S rDNA D2-D3 segment and ITS region sequences on Genbank (MT406757 and JX978229). The molecular phylogenetic relationships of this species strongly supports M. mali (Fig. 2S). To the best of our knowledge, this is the first report of M. mali in Republic of Korea. The host range of M. mali includes many species which are of economic importance in fruit trees (e.g. apple, chestnut, fig, mulberry), forestry trees (e.g. elm, maple, oak, Yew), and vegetable crops (e.g. cabbage, carrot, cucumber, eggplant, soybean, watermelon). The potential danger to these economically important plants caused M. mali to be added the EPPO Alert List and also the Quarantine List of the Korean Animal and Plant Quarantine Agency. Additionally, in our survey around the Naejangsan National Park, M. mali was not found on other economically important host crops, such as grapes. Although this nematode was not detected other crops, it requires regular monitoring because it poses a serious threat to the future production of these crops.

First Report of Meloidogyne incognita on Cardamine Violifohia in China

Cardamine violifohia is an economically-important medicinal plant, and also a valuable plant for strong ability to accumulate selenium (Se) (Ebba et al. 2020). It is not only be used to extract selenium protein and selenium polysaccharide, but also widely used to develop selenium-supplement reagent. In September 2020, root-knot nematodes (RKN; Meloidogyne spp.) infection experiments showed that galls and egg masses were observed on the roots of numerous C. violifolia plants in Enshi (30°32′25.67″ N; 109°48′48.46″ E), Hubei Province, China. Meanwhile, the overground plants of C. violifohia were stunted and leaves were yellow. Almost 5% C. violifohia plants were affected by the disease. The roots with galls were collected, and nematodes were dissected and extracted (Fig. S1). Based on phytopathological clinic, the number of galls on each plant was 91.87 ± 19.01, and egg masses was 15.27 ± 5.36 (n = 15). Nematodes and galls were collected from soil and infected roots (Barker 1985). The morphological diagnostic of the nematode species was measured as follows. Measurements of adult females (n=20), body length = 628.15 ± 73.69 μm, width = 356.77 ± 36.72 μm, stylet length = 15.58 ±0.93 μm. Meanwhile, a high and trapezoidal dorsal arch with thick striations was observed in the perineal region of females. Second-stage juveniles (J2s) (n=20): body length = 377.09 ± 18.19 μm, body width = 15.64 ± 1.24 μm, stylet length = 13.31 ± 1.04 μm, tail length = 42.49 ± 4.64 μm, hyaline tail terminus = 12.35 ± 2.02 μm and presented well developed esophageal glands. Eggs (n=20): length = 80.81 ± 3.47 μm, and width = 37.09 ± 2.98 μm. All the morphological characteristics of the identified species were consistent with the descriptions of Meloidogyne incognita (Kofoid & White, 1919) Chitwood, 1949 (Whitehead, 1968). Molecular identification was carried out by PCR with the M. incognita-specific primers Mi-F/Mi-R (Meng et al. 2004) and 28S rDNA D2/D3 region primers MF/MR (Hu et al. 2011). The target fragments of 955 bp and 478 bp amplified by of the primer pairs Mi-F/Mi-R and MF/MR were observed under a UV light, which confirmed that these nematodes collected from C. violifohia were M. incognita (Fig. S2). Fragments were, sequenced (MZ596342 and MZ566843, respectively) and aligned with available sequences on NCBI, which were 100% identical to the MK410954, MN728679, and MK410953, MF177882 M. incognita sequences, respectively. Pathogenicity testing was conducted to perform Koch’s postulates in a greenhouse by inoculation of 500 J2s from the original population into C. violifohia seedlings (n = 30, 5-6 leaves stage). After 7 weeks, all inoculated plants exhibited the same symptoms that observed in the field initially. Different life stages of M. incognita were observed in dissected galled tissues. The average reproductive factor was 37.30 ± 6.13, which is considered as the pathogenicity of M. incognita to C. violifohia. Therefore, C. violifohia is a suitable host for M. incognita in China. The growers should be informed of the current findings to avoid serious economic losses that might be caused by this pathogenic nematode, and prepare for proper management action. To our knowledge, this is the first report of M. incognita infecting C. violifohia in China.

First Report of Meloidogyne enterolobii on Ormosia hosiei in China

Ormosia hosiei is an evergreen tree that belongs to the family of Fabaceae. It is prized for ornamental and medicinal value and rosewood. In November 2020, galls were observed on roots of stunted O.hosiei plants in the Nanning arboretum (22°43′38″ N, 108°18′06″ E), Guangxi, China. Disease incidence was approximately 80% (150 plants evaluated). Females were obtained by dissecting galls and J2s were collected from a single egg mass hatching. The female white body was pear to globular-shaped with a distinct neck region, while the perineal pattern usually was oval-shaped with a moderately high dorsal arch. J2 bodies were translucent with narrow tails and pointed tips, with hyaline tail termini. Those morphological characters were consistent with description of Meloidogyne enterolobii (Yang and Eisenback 1983; Brito et al. 2004). Morphological measurements (mean, standard deviation and range) of J2s (n = 20) included body length= 436.07 ± 12.5 (411.8 to 464.3) µm, body width = 16.01 ± 1.1 (14.6 to 17.7) µm, stylet length = 12.4 ± 0.8 (11.3 to 13.5) µm, dorsal esophageal gland orifice to the stylet base (DGO) = 3.8 ± 0.3 (3.3 to 4.3) µm, tail = 53.6 ± 4.3 (48.9 to 60.6) µm, and hyaline tail length = 15.9 ± 1.5 (13.6 to 18.3) µm. Measurements of females (n = 20) were: body length = 669.5 ± 43.8 (549.9 to 709.4) μm, body width = 641.9 ± 45.2 (559.3 to 732.8) μm, DGO = 5.3 ± 0.52 (4.6 to 6.1) μm, and stylet length = 14.9 ± 0.86 (13.8 to 16.8) μm. These measurements were also consistent with M. enterolobii (Yang and Eisenback. 1983). The ITS rRNA gene sequence and D2-D3 expansion segment of 28S rDNA were amplified in the DNA of individual J2 using the primers 18S/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA), respectively (Vrain et al. 1992; Subbotin et al. 2006 ). The sequences were submitted in the NCBI with GeneBank Accessions No. MZ617284 (766-bp) and OK072889 (759-bp). The homology of the genes was 99% to 100% identical to that of M. enterolobii in ITS rRNA gene sequence MT406251, MG773551, KF418369. The D2-D3 region of 28S rRNA gene revealed 100% identity with M. enterolobii sequences from MT193450, MF467276, MZ541997 etc. Neighbor-joining phylogenetic analysis showed that it was the most similar to M. enterolobii. For further confirmation, M. enterolobii species-specific primer pairs Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/ TCAGTTCAGGCAGGATCAACC) were used for amplification of the ribosomal intergenic spacer 2. An expected PCR fragment of approximately 236-bp was obtained (Long et al. 2006). Pathogenicity test was conducted in greenhouse with 26 to 30˚C temperature. Eggs were multiplied in the greenhouse using a single eggmass hand-picked from infested O. hosiei roots. Twelve eight-month-old O. hosiei healthy seedlings were inoculated with 5,000 eggs/pot containing autoclaved soil mix (clay: substrate =1:3, v/v), and 6 noninoculated seedlings were controls. After 10 weeks, the control plants displayed no symptoms. The roots of all inoculated plants showed galling symptoms. The reproduction factor (final population/initial population) was 5.2. Furthermore, the morphological and molecular identification of the nematode was identical to the original samples. M. enterolobii has a broad host range (Philbrick et al. 2020). To our knowledge, this is the first report of M. enterolobii parasitizing O. hosiei worldwide. This finding expands the host range of this nematode.

Neomisticius platypi n. sp. and N. variabilis n. sp. (Tylenchomorpha: Anguinidae) from dead oak trees in Japan

Summary Two new Neomisticius species, typologically and phylogenetically close to each other, are described and illustrated from dead Quercus trees and an ambrosia beetle, Platypus quercivorus. The two species share some stylet morphological characteristics, namely, they both possess a long conus occupying more than half of the total stylet length, a long crustaformeria composed of more than 160 cells (eight rows of more than 20 cells each), and a short and broad female tail with a digitate tip. They are distinguished from each other by N. variabilis n. sp. having a wide, spindle-shaped male bursa with a blunt terminus and N. platypi n. sp. having an oval bursa with a rounded terminus. In addition, the males and females of both species have three large rectal glands and the posterior end of the male testis (distal end of the vas deferens) bears three cells that seemingly function as a valve between the vas deferens and the cloacal tube. These characteristics have not been reported in other tylenchids. Currently, the genus contains only three species: the two new species and N. rhizomorphoides, which has a normal stylet with a short conus, a short crustaformeria, and lacks rectal glands and valve cells in the vas deferens. Therefore, the two new species are readily distinguished from N. rhizomorphoides and, based on the previous definition, may even represent a new genus. However, considering their phylogenetic closeness and biological similarities (e.g., association with ambrosia beetles), the generic definition of Neomisticius was emended to include these new species.

First Report of Meloidogyne incognita on Mulberry in Saudi Arabia

The genus Morus comprises many species (Suttie 2012). The species Morus alba is one of the most popular mulberry species worldwide. In October 2020, numerous mulberry trees presented chlorotic leaves and stunted growth with severe root galling in a private compound in Riyadh region, Saudi Arabia. The infected roots showed galls, which are typical symptoms of infection by root-knot nematodes (RKNs). Infected roots were dissected, and males and females were extracted from roots while second stage juveniles (J2s) were from both soil and eggmasses. Morphological and morphometrical features were documented. Perineal patterns of females, males, and J2s were studied using a compound microscope. The endoparasitic females had pearly shaped bodies with projecting neck. Stylet knobs were rounded and set off and the shape of the cone distinctly curved. The posterior perineal had a dorsally high square arch. Striae patterns were zig-zag or forked along the lateral lines. Males were vermiform and the head cap flat to concave. Mostly conus of stylet was longer than shaft. Stylet knobs were prominent, set off, flat and usually greater width than the length. Males had a bluntly rounded tail, spicules were slightly curved and gubernaculum was crescentic. The J2s were vermiform, and stylet knobs were prominent and rounded shape. The J2s tail had a transparent area with an obtuse tip. The morphological measurements (means and range) of the perineal patterns of females (n = 4) were: length of vulval slit (LVS) = 22.5 (21.5 to 23.4) μm, anus to vulval slit (AVS) = 22 (21.8 to 22.1) μm, and anus length (AL) = 7.7 (7.5 to 7.8) μm. The males (n = 16) measurements were: length (L) = 1136 (1116 to 1159) μm; a (total body length / greatest body width) = 34.8 (33 to 37.1); body width = 32.7 (31.2 to 33.8) μm; stylet length = 25.6 (24.7 to 27.3) μm; dorsal oesophageal gland orifice (DGO) = 2.9 (2.6 to 3) μm, tail length = 7.1 (6.5 to 7.8) μm, c (total body length / tail length) = 161 (143.1 to 175), spicules length = 30.8 (26 to 33.8) μm; gubernaculum = 9.7 (9.1 to 10.4) μm. The J2s (n = 11) measurements were: L = 395 (378 to 405) μm; a = 26.2 (24.3 to 28.4); c = 8.6 (8.2 to 9.2); head end to metacorpus valve = 53 (49.4 to 54.6) μm; excretory pore to head end = 78 (72.8 to 80) μm, stylet length = 10.7 (10.4 to 11.7) μm; body width = 15.1 (14.3 to 15.6) μm; tail length = 45.8 (44.2 to 49.4) μm; hyaline tail terminus length = 12.5 (10.4 to 13) μm. Both the morphological and morphometrical features of the perineal pattern of the females, males, and J2s match the original description of Meloidogyne incognita (Kofoid and White, 1919) Chitwood, 1949 (Eisenback and Hirschmann 1981; Taylor and Netscher 1974). To perform Koch’s postulates, mulberry plants maintained in pots were inoculated with 2,500 J2s and eggs of the original population of M. incognita using five replicates. After two months, all inoculated plants had galled roots typical of RKNs. Reproduction factor value was 6.4. The noninoculated plants did not present galls in the roots. These results confirmed the nematode’s pathogenicity on mulberry. To the best of our knowledge, this is the first report that M. incognita was identified as a parasite of mulberry (Morus alba) in Saudi Arabia and the world, while Meloidogyne hispanica was reported on mulberry trees in Iran (Shokoohi et al. 2016). The importance of this report shed some lights on this new problem to direct the attention of farmers and home gardeners to take actions for the management of this newly identified problem. The authors declare no conflict of interest. Acknowledgments Authors wish to thanks College of Food and Agricultural Sciences, Research Center and Deanship of Scientific Research, King Saud University, Saudi Arabia for supporting this work. References: Eisenback, J. D. and Hirschmann, H. 1981. J. Nematol. 13:513. Shokoohi, E. et al. 2016. Australasian Plant Dis. Notes 11:16. Suttie, J. M. 2012. Food and Agricultural Organization of the United Nations. Taylor D. P., Netscher, C. 1974. Nematologica 20:268.

First report of Meloidogyne hapla infecting Yunmuxiang (Aucklandia lappa) in China

Yunmuxiang (Aucklandia lappa) is a tall, perennial herbaceous plant in the compositae family, occurring mainly in Asia and Europe. Yunmuxiang originated in India and was introduced into China in approximately 1940. Since then it has been widely cultivated in the southwest region of China for medicinal uses; it is included in the Chinese Pharmacopoeia. Yunmuxiang is used primarily as a sedative, including for anesthesia (Ting et al. 2012). Severely stunted and withered Yunmuxiang plants with rotted and galled roots were observed in a field in near the city of Lijiang (N 99°46′; E 27°18′) in October 2019. These symptoms were typical of infection by root-knot nematodes.The second-stage juveniles (J2) were collected from the soil in the root zone, and adult females were dissected from roots. Population densities of J2 ranged from 325 to 645 per 100 cm3. Morphological analysis and species-specific PCR were performed on the second stage (J2) and females. Morphological characteristics are as follows: for J2 (n=20) , body length = 360.5 ± 23.4 µm, tail length = 47.2 ± 6.1 µm, and stylet length = 10.4 ± 1.9 µm, distance from dorsal esophageal gland opening to the stylet knot (DGO) = 3.96 ± 0.42 μm; females (n = 20) were pear-shaped, body length = 565.23 ± 86.68 μm, maximum body width = 407.24 ± 60.21 μm, stylet length = 9.93 ± 0.88 μm, DGO = 4.76 ± 0.32 μm, stylet median bulb width (MBW) = 29.67 ± 3.61 μm, perineum morphology is low and low dorsal arch round, with a typical inferior protrusion near the anus. These morphological characteristics are consistent with Meloidogyne hapla as described by Hunt and Handoo (2009). To confirm species identification, DNA was extracted from females (Blok, et al. 1997) and ITS region was amplified using the primers 18S/26S (Vrain et al. 1992). Furthermore, species-specific SCAR primers JMV1/JMV hapla were used as described by Adam et al. (2007). PCR produced 768 bp and 419 bp sequences. Fragments were sequenced (MW512922and MW228371, respectively) and compared with available sequences on NCBI. Sequences were 99.48% identical to the MT249016, KJ572385, and 100% identical to the GQ395574, GQ395569 M. hapla sequences, respectively. Morphological and molecular characterization supports the identification of the isolate found on Aucklandia lappa as M. hapla. Yunmuxiang seed were planted in 20 cm diameter, 10 cm deep plastic pots containing 1000 cm3 sterilized soil. Seedlings were thinned to one per pot. At the 2-3 leaf stage 10 pots were infested with 1500 M. hapla J2 per seedling, using a sterilized micropipette. Plants were maintained at 20-25°C in a greenhouse. Control plants received sterile water, and the pathogenicity test was repeated three times. After 30 days, plants were removed from pots and soil gently removed from the roots. A large number of galls (95.6 ± 2.5) and egg masses (33.5 ± 0.5) were found on each root system. Yunmuxiang was considered a good host for M. hapla in Lijiang. M. hapla is a major plant parasitic nematode with a wide geographic distribution and range of host plants and causes severe yield losses (Azevedo de Oliveira et al. 2018). Through investigation, this is the first report worldwide of M. hapla infecting Aucklandia lappa.

First report of a Sheathoid Nematode (Hemicriconemoides litchi) on Longan in Taiwan

Longan (Dimocarpus longan Lour.) is a subtropical fruit, widely grown in China, Taiwan, and Southeast Asia. Longan has a high commercial value, US$242,200 of dried longan fruits are exported to the United States from Taiwan every year (Wang et al. 2010). A soil sample from a longan orchard located in Changhua County, Taiwan (24.0162657, 120.529-1457) was collected in June 2019. Sheathoid nematodes were the dominant species in this sample and over 40 adult individuals per 100 g soil were found. In December 2019, sheathoid nematodes were collected again from the same tree and processed for identification by morphological and molecular characteristics. Nematodes were extracted using the modified Baermann funnel method (Wu et al. 2010) for 24 h. The morphometric data from fifteen females with variant tail types were taken. All individuals had a closely sheath, lip region set off with two annuli, stylet frequently slightly dorsally curved with rounded knobs, no vulval flaps, tail narrowing to a broadly rounded terminus, or tapering to a truncate end, anus situated 3-4 annuli posterior to the vulva. The body length = 552 μm (483 to 616 μm), body width at mid-body = 34.02 μm (27.75 to 40.03 μm), a = 15.93 (14.73 to 18.87), b = 4.65 (4.04 to 5.06), V% = 91.57 (86.74 to 92.56), stylet length = 66.66 μm (63.51 to 69.6 μm), tail length = 28.48 μm (23.56 to 37.45 μm), ring number 114 to 130, Rs = 14 to 19, Roes = 22 to 28, RV = 9 to 13, Ran = 5 to 9 and RVan = 3 to 4. Since the stylet length were less than 70μm, they are more fitted to be Hemicriconemoides litchi (Van den Berg et al. 2015). DNA samples extracted using VIAGEN® DirectPCR lysis buffer from single females (n = 10) were processed to amplify the 28S D2-D3 expansion segment and the ITS region using primers sets D2A and D3B, TW81 and AB28, respectively (Van den Berg et al. 2014). The D2-D3 region of the nematodes collected in this study (MT-539384) shared 99% similarity with several H. litchi sequences deposited in the GenBank database (e.g. KP192481, KF856540), and the ITS region (MT556011) also shared 99% similarity with several H. litchi sequences (e.g. KP192482, GQ354786). Therefore, based on morphological, molecular data and phylogenetic relationship analysis (Nguyen et al. 2020) the nematodes from the Longan orchard were determined to be H. litchi. To measure the reproductive factor (Rf), 60 sheathoid nematodes (57 females and three males) recovered from Baermann extraction were inoculated onto root systems of a longan tree in a 15-cm-d pot filled with sterilized soil. One hundred and sixty eight days after inoculation, three 100 cm3 subsamples of soil from the pot were processed as mentioned previously, and the average number was 48/100 cm3 of soil. The final population was approximately 768 nematodes per 1600 cm3 of soil with the Rf value of 12.8 confirming Longan as a host, although no symptoms were observed. The DNA from three individuals in the three subsamples with variant tail types were used to obtain D2-D3 and ITS region sequences, and confirmed the species as H. litchi. Hemicriconemoides spp. is associated with root malformation and nutrient deficiencies on agricultural fruit trees (Milne et al. 1971; McSorley et al. 1980); however, aboveground evidence of damage may not become immediately obvious and the importance of sheathoid nematodes is easily overlooked (Chen et al. 2011). This is the first report of H. litchi as a parasite of longan tree in Taiwan.

Characterisation of plant-parasitic nematodes Helicotylenchus digonicus and H. vulgaris from the rhizosphere of grapevines in Crimea, Russia

During 2016-2020, about 120 soil samples were collected from the rhizosphere of grapes in different vineyards of the Central and Southern regions of Crimea. Two morphologically close nematode species, Helicotylenchus digonicus and Helicotylenchus vulgaris, were found at all sampling sites in the Yalta, Sevastopol, Simferopol and Bakhchisarai districts. Morphologically, these species could be differentiated by the stylet length and the shape of tails. In addition, these species have significant differences in sequences of the D2-D3 expansion segments of the 28S rRNA.

Morphological and molecular characterisation of Punctodera mulveyi n. sp. (Nematoda: Punctoderidae) from a golf course green in Oregon, USA, with a key to species of Punctodera

Summary Punctodera mulveyi n. sp. is described and illustrated from turf grass (Poa annua) in golf course greens with other fescues in Bandon, Coos County, Oregon, USA. Females and cysts are characterised by a saccate, globose to ovoid or pear-shaped body with a protruding neck. The cuticle has a lace-like pattern of ridges and heavy punctations on the subsurface. Cysts have distinctive vulval and anal circumfenestral patterns with heavy bullae scattered around the fenestral area, these being absent in young cysts. Second-stage juveniles (J2) vermiform, tapering to a long and cylindrical tail with a bluntly rounded to occasionally clavate tail terminus. Morphologically the new species resembles all known species of Punctodera using both light microscopy and scanning electron microscopy observations, but differs from the other species either by the J2 body and stylet length, shape of head, tail and tail terminus, female and male stylet or spicule length, and in having distinctive vulval and anal circumfenestral patterns in the cysts. Molecular analysis with sequence alignments and phylogenetic trees of ITS rDNA, nuclear heat shock protein 90 and mitochondrial COI sequences separated P. mulveyi n. sp. from P. matadorensis, P. punctata, P. stonei and P. chalcoensis, but 18S and 28S were relatively conserved with a few bp differences and there were insufficient Punctodera species sequences to give strong support to a new species designation. A morphologically most closely related species, P. stonei from Canada, further supported the status of P. mulveyi n. sp. An identification key to all five nominal species of Punctodera is given.

Schistonchus macrophylla (Nematoda: Aphelenchoididae): an enigmatic taxon from sycones of Ficus section Malvanthera in eastern Australia, with description of a new subspecies

Summary Over a period of 15 years, Schistonchus was collected from sycones of Ficus subgenus Urostigma section Malvanthera in eastern Australia, and was found to occur widely. Here, Schistonchus macrophylla macrophylla is redescribed from F. macrophylla and F. superba, and a new subspecies, Schistonchus m. lightfooti subsp. n., from F. rubiginosa and F. superba. Schistonchus m. lightfooti subsp. n., is characterised by having a long post-vulval uterine sac (PUS) with thickened walls and a narrowly rounded or pointed distal tip, procorpus which is usually longer than the stylet length, pyriform metacorpus, trapezoid-shaped head capsule, papillae arranged as one large pair adcloacal, a large pair at mid-tail length, and a small pair near the tail tip, no caudal alae, and a spatulate tail tip in females; and was collected from Sydney in New South Wales (NSW) to southern Queensland. Schistonchus m. macrophylla is characterised by having a procorpus shorter than or equal to the stylet length, an ovoid metacorpus, rectangular-shaped head capsule, long PUS with thickened wall only at its distal tip, caudal alae, and papillae arranged as one pair precloacal, one small pair adcloacal, and a large pair at mid-tail length. It was collected in NSW.