First Report of Root-Knot Nematode Meloidogyne enterolobii on Cockscomb (Celosia argentea var. cristata) in Taiwan

Cockscomb (Celosia argentea) is commonly found in subtropical and temperate zones of Africa, South America and South East Asia, and is a popular ornamental plant in the family Amaranthaceae. Cockscomb has been known to contain antiviral proteins, betalains, and anthocyanin, which can be applied in beneficial ways (2). In September 2020, a cockscomb plant (Celosia argentea var. cristata) showing typical galling root symptoms likely infected by root-knot nematodes (Meloidogyne sp.) was collected from a garden in Taichung, Taiwan, and a quick exam of several individuals using MK7F/R primers (7) indicating they were M. enterolobii. Nematode population was established from a single egg mass and was later used for species identification and pathogenicity tests. Five perineal patterns of mature females from the single female population show round to oval shapes with weak lateral lines. Dorsal arches are moderate to high, almost squared, with the smooth ventral striae. Second-stage juveniles are vermiform and have a slender tail, tapering to rounded tip with distinct hyaline region at the tail terminus. Morphological measurements of 28 J2s revealed body length = 457.2 ± 20.6 (416.1-506.9) μm, body width = 16.0 ± 2.0 (13.4-20.3) μm, stylet length = 14.7 ± 0.5 (13.9-15.9) μm, dorsal gland orifice to the stylet base = 4.0 ± 0.5 (2.0-4.8) μm, and tail length = 56.0 ± 3.8 (47.4-60.3) μm. Female perineal patterns and morphometric data are similar to the original description of Meloidogyne enterolobii (9). DNA purified from approximately 1500 juveniles using GeneMark Tissue & Cell Genomic DNA Purification Kit (GeneMark, Taiwan) was used to amplify 18S rDNA fragment, D2-D3 expansion segments of 28S rDNA, and a COII region on mtDNA with primer sets 1A/MelR, D2A/D3B, and C2F3/1108, respectively (4,5,6). The 18S rDNA sequence (OK076893) of this study shares 99.94% nucleotide identity with those of M. enterolobii isolated from the United States (KP901058) and China (MN832688). D2D3 sequence of haplotype 1 (OK076898) shows 100% identity to those of M. enterolobii from China (MT193450) and Taiwan (KP411230). Sequence of haplotype 2 (OK076899) shows 99.86% identity to those of M. enterolobii from the United States (MN809527) and China (MN269945). Sequence of the COII region (OK086042) show 99.86% identity to that of M. enterolobii from China (MN269945). Phylogenetic trees of the three gene sequences were plotted following Ye et al.(10), revealing that the newly described root-knot nematode on Cockscomb is grouped with other M. enterolobii isolates. DNA fragment amplified by primer sets Me-F/R(3) and MK7F/R specifically targeting of M. enterolobii yielded 236 bp and 520 bp, respectively. Pathogenicity tests were assayed, from July to September 2021, on three-week-old nematode-free cockscomb plant directly germinated from seeds of SkyStar® (ASUSA SPIKE SEEDS, Taipei, Taiwan) planted in a 10.5 cm diameter pot filled with 600 ml sterilized peat moss: sand (1:1, v/v) soil in a 28℃walk-in chamber. Nematode eggs were extracted using 0.05% NaoCl as described by Vrain(8), and cockscomb plants (n=3) were inoculated by adding 6000 eggs (10 eggs/ cm3). Cockscomb plants treated with water were used as mock controls. Rf value of the inoculated plants were determined by the method of Belair and Benoit (1) 45 days after inoculation, and the average was 4.13. No galls were observed on the roots of control plants. The results confirmed that cockscomb is the new host of M. enterolobii. To the best of our knowledge, this is the first report of M. enterolobii on Celosia argentea var. cristata in Taiwan.

IDENTIFICATION OF SOURCES OF RESISTANCE TO Meloidogyne enterolobii IN ACEROLA1

ABSTRACT In Brazil, acerola trees infested by Meloidogyne enterolobii present lower yield and fruit quality. The use of rootstocks resistant to this pathogen is one of the alternatives to overcome this problem. This study aimed to assess the reaction of 22 acerola accessions to M. enterolobii, aiming to identify at least one resistant rootstock. The experiment was carried out in a randomized block design with 10 replications and each plot consisting of 10 plants. Each plant was inoculated with 350 eggs and second-stage juveniles of M. enterolobii, with the gall index (GI) and reproduction factor (RF) being determined after 90 days. The variables were analyzed using the mixed model methodology (REML/BLUP). The accessions ACO-13, ACO-14, ACO-18, and BRS Apodi stood out with four to six plants showing resistance reaction to the root-knot nematode, but the assessment of accessions should be performed under a higher density inoculum and longer time.

First Report of Root-Knot Nematode Meloidogyne enterolobii on Poinsettia ‘Luv U Pink’ in Taiwan

Poinsettia (Euphorbia pulcherrima Willd. ex Klotzsch.), originated in southern Mexico and northern Guatemala, is the most valuable potted flowering plant in the spurge family (Euphorbiaceae). The European Union and the United States are two biggest poinsettia markets (Taylor et al. 2011), with a wholesale value of $153 million in the United States in 2019. Root knot galls of poinsettia ‘Luv U Pink’ were collected from a production greenhouse located in Nantou County, Taiwan in March 2021. No aboveground symptoms were observed. A nematode population was established from a single female and used for identification and the Koch’s postulate. The perineal patterns of randomly picked 5 females are round or ovoid with moderate to high dorsal arches, but no distinct lateral lines, ventral striae are fine and smooth. The Morphometric characters of second-stage juvenile include: a vermiform body shape, tail narrow and tapering with rounded tail tips, and a distinct hyaline tail end. Measurements of 20 J2 are as follows: body length, 430 (398 - 473) μm; body width, 15.4 (13.4 - 17.8) μm; stylet length,13.4 (13.0 - 14.0) μm; dorsal esophageal gland orifice to basal knob, 3.4 (2.8 - 3.9) μm; tail length, 52.9 (47.6 - 62.2) μm. All morphometric data were consistent with the original description of Meloidogyne enterolobii (Yang and Eisenback 1983). Nematode DNA was extracted using GeneMark Tissue & Cell Genomic DNA Purification Kit (GeneMark, Taiwan) from approximately 1500 J2 and used for amplification of 18S rRNA gene, a D2-D3 region of 28S rRNA gene, and a mtDNA COII region with primer sets 1A/MelR, D2A/D3B, and C2F3/1108, respectively (Power and Harris 1993, Subbotin et al. 2006, Tigano et al. 2005). The sequence of 18S rRNA gene (accession no. MZ948800 haplotype 1 and MZ955998 haplotype 2), haplotype 1 shared 100% identity with that of M. enterolobii from the United States (KP901058) and China (MN832688); haplotype 2 shared 99.8% identity with that of KP901058 and MN832688. The sequence of the D2-D3 region (MZ955995) shared 99% identity with that M. enterolobii from the United States (KP901079). Sequence of the COII region (MZ964625) also shared 99% identity with that of M. enterolobii from the United States (AY446975) and China (MN840970). Phylogenetic trees of the three gene sequences plotted as described by Ye et al. (2021) revealed that the newly described nematode was grouped with M. enterolobii. Sequence analysis of two fragments: 236 bp and 520 bp amplified with gene specific primers Me-F/R and MK7F/R, respectively (Long et al. 2006, Tigano et al. 2010) also confirmed the identity of M. enterolobii. To measure the reproductive factor (Rf), the Poinsettia ‘Luv U Pink’ seedlings with eight true leaves were transplanted into three 12-cm diameter pots each containing 6000 eggs or water (mock control). Forty-five days after inoculation, the average Rf value of three inoculated plants was 6, and no galls were observed on mock control plant roots, confirming that poinsettia is the host of M. enterolobii. M. enterolobii has been reported in several Euphorbia species, including E. heterophylla, E. prostrata, E. punicea and E. tirucalli (Han et al. 2012, Rich et al. 2009). To the best of our knowledge, this is the first report of M. enterolobii infecting E. pulcherrima ‘Luv U Pink’.

Sweet potato genotypes CIP BRS Nuti and Canadense are resistant to Meloidogyne incognita, Meloidogyne javanica and Meloidogyne enterolobii

Sweet potato is a staple crop in Brazil presenting a smaller number of pathogens and diseases in comparison with other root and tuberous crops. Root knot nematodes are among the most serious sweet potato root pathogens. The impact of these pathogens also extends to following crops. Since in Brazil it is common to cultivate more than one crop per season this problem is rapidly disseminated. The aim of this study is to assess the resistance of two sweet potato clones and three commercial sweet potato genotypes to three different Meloidogyne species. Assays were performed under greenhouse conditions in two separate seasons. CIP BRS Nuti, one of the new clones and Canadense, one of the commercial genotypes were resistant to Meloidogyne incognita, M. javanica and M. enterolobii. This finding was obtained based on the reproduction factor smaller than 0,2 meaning that the initial population of 5,000 nematodes was reduced to less than 1,000 individuals after 90 days of inoculation. This data was also confirmed by the small number of eggs, egg masses and galls. Tomato and sweet potato cultivar Beauregard, known to be susceptible to the three nematode species were highly damaged by the pathogens. To our knowledge CIP BRS Nuti and Canadense are the first South American commercial cultivars with triple nematode resistance.

First report of Meloidogyne enterolobii infecting cassava (Manihot esculenta) resulting in root galling damage in Africa

Meloidogyne enterolobii is a highly polyphagous tropical species of root knot nematode. It has been recorded to be causing major damage to a range of economically important crops and is increasingly recorded from new locations. The morphological similarity and overlap of characteristics with other commonly occurring species, especially M. incognita, has confused its diagnosis using morphometrics. Cassava (Manihot esculenta) is an important crop across the tropics, including Africa, where it is among the most important root and tuber crop for food security. Cassava can be heavily infected by root knot nematodes, which can incur heavy production losses. The main species known to affect cassava are M. incognita and M. javanica (Coyne and Affokpon, 2018). With the exception of one report of M. enterolobii morphologically identified from cassava roots during a survey in Brazil (Rosa et al., 2014), there is no record with molecular confirmation of it infecting the crop. In the absence of any molecular or isozyme confirmation, diagnosis of M. enterolobii is difficult to determine. In the current study, the species responsible for substantial galling damage (Fig. 1A) on several cassava roots growing in Ibadan, Nigeria (7°22′39″ N; 3°54′21″ E) were diagnosed. DNA isolated from juveniles recovered using a modified Baermann method (Hooper, 1986) from these roots was used for PCR amplification of the mitochondrial Nad5 using primer pair, NAD5F2 (5’-TATTTTTTGTTTGAGATATATTAG-3’) and NAD5R1 (5’-CGTGAATCTTGATTTTCCATTTTT-3’). The 515 bp PCR DNA product was sequenced on both strands (GenBank Accession No. MW965454) and found to be 100% identical to M. enterolobii with those in the DNA sequence database (KU372358, KU372359) (Janssen et al., 2016; Kolombia et al., 2017). In addition, M. incognita was also recovered from the galled roots and identified using the same primers (GenBank Accession No. MW965455) indicating a combined species infection (Fig. 2). Cultures of M. enterolobii, developed from single egg masses were maintained on tomato plants and used to assess infection on cassava in 10 L pots filled with steam sterilized loam soil in the screenhouse. Cassava cv. IITA-TMS-IBA070593 cuttings planted in June, 2018 and repeated in April, 2019 were inoculated with 1,000 juveniles per pot at three weeks after planting, and then maintained for four months before quantifying the nematode densities in both roots and soil. Nematode reproduction factor (RF), calculated from total nematode densities (n=8) from soil and roots was as high as 44.3, compared to uninoculated controls. Molecular diagnostics of M. enterolobii, as above, confirms unequivocally the host status of cassava to this nematode. This study reports for the first time the infection of cassava by M. enterolobii under field conditions in Africa and for the first time demonstrates the host suitability of cassava to this nematode (Fig. 1B). M. enterolobii is among the most commonly occurring root-knot nematode species in West Africa (dos Santos et al., 2019). It is therefore anticipated that M. enterolobii has long been infecting, especially in West Africa, but has been overlooked due to its morphological similarity with M. incognita. Given the high reproductive ability of M. enterolobii on cassava and its highly aggressive nature on a range of crops, it is likely that it is causing, or will result in, high levels of losses on cassava in Africa.

First Report of the Root-Knot Nematode, Meloidogyne enterolobii, on Sweet potato in Guangxi Province, China

Sweet potato (Ipomoea batatas Lam.) is the seventh most widely cultivated food crop in the world and the sixth most widely cultivated food crop in China. In June 2021, sweet potato plants were found to be displaying nutrient deficiencies with red leaves in a sweet potato field in Hepu County, Beihai City, Guangxi Province (21°37′43.41"N，109°10′58.74"E). Black irregular protuberant scars on tubers and nodular galls on roots were found. Thirty-five sweet potato ‘Variety Guiziweishu No. 1’ tubers were randomly collected and 97% were infected with root-knot nematodes. Females (n = 20) had perineal patterns that were oval, with moderate to high dorsal arches, the lateral field was not obvious or absent. Morphological measurement of females (n = 20) were made from micrographs taken with a microscope (Axio Imager, Z2, ZEISS). Measurements (mean + standard error) were: body length (BL) = 932.8 ± 18.4 μm; maximum body width (BW) = 588.8 ± 22.0 μm; vulval slit length = 19.6 ± 0.6 μm; and, vulval slit to anus distance = 22.3±0.8 μm. Morphological measurements of second-stage juveniles (J2; n = 20) were: BL =512.0± 5.9 μm; BW = 17.4 ± 0.6 μm; Stylet length = 13.4 ± 0.2 μm; dorsal pharyngeal gland orifice to stylet base (DGO) =3.4 ± 0.0 μm; and, hyaline tail length = 17.6 ± 0.5 μm. These morphological characteristics fit those of the original description for Meloidogyne enterolobii (Yang and Eisenback 1983). Molecular analyses were conducted to confirm species identification. Genomic DNA was extracted from 12 single J2 (Luo et al. 2020). The rDNA-internal transcribed spacer (ITS) region was sequenced using primers V5367/26S (5′-TTGATTACGTCCCTGCCCTTT-3′/5′-TTTCACTCGCCGTTACTAAGG-3′) (Vrain et al. 1992), and the D2–D3 fragment of the 28S rRNA genes using primers D2A/D3B (5′-GTACCGTGAGGGAAAGTTG-3′/5′-TCGGAAGGAACCAGCTACTA-3′) (De Ley et al. 1999). The target gene sequences were 733 bp (GenBank accession no. MZ413814) and 733 bp (MZ411468), respectively; they were all 99-100% similar to those of M. enterolobii sequences available in the GenBank. Species identification was also confirmed using PCR to amplify rDNA-IGS2 with M. enterolobii-specific primers Me-F/Me-R (5′-AACTTTTGTGAAAGTGCCGCTG-3′/5′-TCAGTTCAGGCAGGATCAACC-3′). The electrophoresis results showed a bright band (∼200 bp) only in the lane with the M. enterolobii-specific primers, similar in size to that previously reported for M. enterolobii (Long et al. 2006). Therefore, this Meloidogyne sp. population on sweet potato was identified as M. enterolobii based on its morphological and molecular characteristics. To verify the pathogenicity of nematodes, sweet potato ‘Variety Guiziweishu No. 1’ seedlings were individually planted in 18 cm diameter, 11 cm deep plastic pots containing 1000 cm3 autoclaved sandy soil (sand/soil = 3:1). A total of 15 seedlings were inoculated with 10,000 eggs (the population was same with nematode population in soil the field) and 5 seedlings without eggs were used as a control. Plants were maintained at 25-28°C in a greenhouse. After 2 months, root of inoculated plants exhibited elongated swellings similar to symptoms observed in the field. The noninoculated plants did not have any galls or swelling. A reproduction factor (nematode final population density/initial population density) value of 18.6 was obtained. These results confirmed the nematodes’ pathogenicity. To our knowledge, this is the first report of M. enterolobii on a member of the Convolvulaceae in Guangxi Province. In 2014, the nematode on sweet potato was reported in Guangdong Province (Gao et al. 2014). Guangxi Province is the largest producer of sweet potato in south China and is the third top producing region in the whole country. Meloidogyne enterolobii is a potential risk to the production of sweet potato in this region, and control measures are needed to prevent any further spread.

First Report of Meloidogyne enterolobii on Ormosia hosiei in China

Ormosia hosiei is an evergreen tree that belongs to the family of Fabaceae. It is prized for ornamental and medicinal value and rosewood. In November 2020, galls were observed on roots of stunted O.hosiei plants in the Nanning arboretum (22°43′38″ N, 108°18′06″ E), Guangxi, China. Disease incidence was approximately 80% (150 plants evaluated). Females were obtained by dissecting galls and J2s were collected from a single egg mass hatching. The female white body was pear to globular-shaped with a distinct neck region, while the perineal pattern usually was oval-shaped with a moderately high dorsal arch. J2 bodies were translucent with narrow tails and pointed tips, with hyaline tail termini. Those morphological characters were consistent with description of Meloidogyne enterolobii (Yang and Eisenback 1983; Brito et al. 2004). Morphological measurements (mean, standard deviation and range) of J2s (n = 20) included body length= 436.07 ± 12.5 (411.8 to 464.3) µm, body width = 16.01 ± 1.1 (14.6 to 17.7) µm, stylet length = 12.4 ± 0.8 (11.3 to 13.5) µm, dorsal esophageal gland orifice to the stylet base (DGO) = 3.8 ± 0.3 (3.3 to 4.3) µm, tail = 53.6 ± 4.3 (48.9 to 60.6) µm, and hyaline tail length = 15.9 ± 1.5 (13.6 to 18.3) µm. Measurements of females (n = 20) were: body length = 669.5 ± 43.8 (549.9 to 709.4) μm, body width = 641.9 ± 45.2 (559.3 to 732.8) μm, DGO = 5.3 ± 0.52 (4.6 to 6.1) μm, and stylet length = 14.9 ± 0.86 (13.8 to 16.8) μm. These measurements were also consistent with M. enterolobii (Yang and Eisenback. 1983). The ITS rRNA gene sequence and D2-D3 expansion segment of 28S rDNA were amplified in the DNA of individual J2 using the primers 18S/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA), respectively (Vrain et al. 1992; Subbotin et al. 2006 ). The sequences were submitted in the NCBI with GeneBank Accessions No. MZ617284 (766-bp) and OK072889 (759-bp). The homology of the genes was 99% to 100% identical to that of M. enterolobii in ITS rRNA gene sequence MT406251, MG773551, KF418369. The D2-D3 region of 28S rRNA gene revealed 100% identity with M. enterolobii sequences from MT193450, MF467276, MZ541997 etc. Neighbor-joining phylogenetic analysis showed that it was the most similar to M. enterolobii. For further confirmation, M. enterolobii species-specific primer pairs Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/ TCAGTTCAGGCAGGATCAACC) were used for amplification of the ribosomal intergenic spacer 2. An expected PCR fragment of approximately 236-bp was obtained (Long et al. 2006). Pathogenicity test was conducted in greenhouse with 26 to 30˚C temperature. Eggs were multiplied in the greenhouse using a single eggmass hand-picked from infested O. hosiei roots. Twelve eight-month-old O. hosiei healthy seedlings were inoculated with 5,000 eggs/pot containing autoclaved soil mix (clay: substrate =1:3, v/v), and 6 noninoculated seedlings were controls. After 10 weeks, the control plants displayed no symptoms. The roots of all inoculated plants showed galling symptoms. The reproduction factor (final population/initial population) was 5.2. Furthermore, the morphological and molecular identification of the nematode was identical to the original samples. M. enterolobii has a broad host range (Philbrick et al. 2020). To our knowledge, this is the first report of M. enterolobii parasitizing O. hosiei worldwide. This finding expands the host range of this nematode.