scholarly journals Cloning and expression of the phosphotriesterase gene hocA from Pseudomonas monteilii C11 b bThe GenBank accession number for the hocA gene is AF469117.

Microbiology ◽  
2002 ◽  
Vol 148 (9) ◽  
pp. 2687-2695 ◽  
Author(s):  
Irene Horne ◽  
Tara D. Sutherland ◽  
John G. Oakeshott ◽  
Robyn J. Russell
Keyword(s):  
Cloning And Expression ◽  
Accession Number ◽  
Pseudomonas Monteilii

Cloning and expression of an airway epithelial 12-lipoxygenase

1992 ◽  
Vol 263 (6) ◽  
pp. 1-1
Author(s):  
Nicoletta De Marzo ◽  
David L. Sloane ◽  
Sherry Dicharry ◽  
Ella Highland ◽  
Elliott Sigal
Keyword(s):  
Amino Acid ◽  
Nucleotide Sequence ◽  
Amino Acid Sequence ◽  
Cloning And Expression ◽  
Airway Epithelial ◽  
Accession Number ◽  
12 Lipoxygenase

Pages L198–L207: Nicoletta De Marzo, David L. Sloane, Sherry Dicharry, Ella Highland, and Elliott Sigal. “Cloning and expression of an airway epithelial 12-lipoxygenase.” Page L202, Fig. 3, nucleotide sequence 1321–1380 should read: TCCTTCTGTCCCCCTGATGACCTGGCTGAC CGGGGGCTCCTGGGAGTCAAGTCTTCTTTC The deduced amino acid sequence for this region in Figs. 3 and 7 is correct. Also, the nucleotide sequence submitted to GenBank (accession number M62516) is correct.

Cloning and expression of an airway epithelial 12-lipoxygenase

1992 ◽  
Vol 263 (1) ◽  
pp. 1-1
Author(s):  
Nicoletta De Marzo ◽  
David L. Sloane ◽  
Sherry Dicharry ◽  
Ella Highland ◽  
Elliott Sigal
Keyword(s):  
Amino Acid ◽  
Nucleotide Sequence ◽  
Amino Acid Sequence ◽  
Cloning And Expression ◽  
Airway Epithelial ◽  
Accession Number ◽  
12 Lipoxygenase

Pages L198–L207: Nicoletta De Marzo, David L. Sloane, Sherry Dicharry, Ella Highland, and Elliott Sigal. “Cloning and expression of an airway epithelial 12-lipoxygenase.” Page L202, Fig. 3, nucleotide sequence 1321–1380 should read: TCCTTCTGTCCCCCTGATGACCTGGCTGAC CGGGGGCTCCTGGGAGTCAAGTCTTCTTTC The deduced amino acid sequence for this region in Figs. 3 and 7 is correct. Also, the nucleotide sequence submitted to GenBank (accession number M62516) is correct.

Molecular cloning and expression analysis of a new WD40 repeat protein gene in upland cotton

Biologia ◽  
2012 ◽  
Vol 67 (6) ◽  
Author(s):  
Quan Sun ◽  
Yingfan Cai ◽  
Xiaoyan Zhu ◽  
Xiaohong He ◽  
Huaizhong Jiang ◽  
...  
Keyword(s):  
Amino Acid Sequences ◽  
Protein Domain ◽  
Cloning And Expression ◽  
Isogenic Line ◽  
Near Isogenic Line ◽  
Accession Number ◽  
Calculated Molecular Mass ◽  
Coding Sequence ◽  
Repeat Protein ◽  
Sequence Identity

AbstractA new member of the WD repeat protein family, named GhWD40, was cloned from a near-isogenic line for glands in cotton. It has 2629 bp cDNA and a complete opening reading frame (ORF) of 1239 bp, containing the initial code (ATG) and terminal code (TAG); there is a 1061 bp non-coding sequence at the 5′-end, and a 329 bp non-coding sequence at the 3′-end, including the poly(A) sequence (accession number: JN714279). The predicted protein of the complete ORF comprised 412 amino acids with a calculated molecular mass of 47.1 kDa and an isoelectric point of 8.88. Protein domain scanning showed that the novel protein has five wd40 motifs and belongs to the WD40 family. From a search for GhWD40 cDNA and amino acid sequences in the database, it has 77% sequence identity and was 90% sequence positive with the WD-40 repeat protein from Trifolium pratense (accession number BAE71307.1), and 80% sequence identity and 89% sequence positivity with the ribosome biogenesis protein bop1 from Ricinus communis (accession number XP 002529002.1). We propose that GhWD40 may play the same role as bop1. In addition, expression of GhWD40 in near-isogenic lines 11 and 3 (with and without glands, respectively) was studied by quantitative RT-polymerase chain reaction, and the level in near-isogenic line 11 was higher than that in near-isogenic line 3, suggesting that GhWD40 may be related to gland formation.

Sign in / Sign up

Export Citation Format

Share Document