Field specific monitoring of cereal yellow dwarf virus aphid vectors and factors influencing their immigration within fields

2021 ◽  
Author(s):  
John M Holland ◽  
Niamh M McHugh ◽  
Francesca Salinari
Keyword(s):  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Cereal Yellow Dwarf Virus ◽  
Factors Influencing ◽  
Aphid Vectors ◽  
Yellow Dwarf Virus

Species Composition of Aphid Vectors (Hemiptera: Aphididae) of Barley Yellow Dwarf Virus and Cereal Yellow Dwarf Virus in Alabama and Western Florida

2011 ◽  
Vol 104 (4) ◽  
pp. 1167-1173 ◽  
Author(s):  
Buyung A. R. Hadi ◽  
Kathy L. Flanders ◽  
Kira I. Bowen ◽  
John F. Murphy ◽  
Susan E. Halbert
Keyword(s):  
Species Composition ◽  
Barley Yellow Dwarf Virus ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Cereal Yellow Dwarf Virus ◽  
Barley Yellow Dwarf ◽  
Aphid Vectors ◽  
Yellow Dwarf Virus

Satellite cereal yellow dwarf virus-RPV (satRPV) RNA requires a DouXble hammerhead for self-cleavage and an alternative structure for replication 1 1Edited by D. E. Draper

1999 ◽  
Vol 293 (4) ◽  
pp. 781-793 ◽  
Author(s):  
Sang Ik Song ◽  
Stanley L. Silver ◽  
Michelle A. Aulik ◽  
Lada Rasochova ◽  
B.R. Mohan ◽  
...  
Keyword(s):  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Cereal Yellow Dwarf Virus ◽  
Yellow Dwarf Virus ◽  
Alternative Structure

scholarly journals First Report of Barley yellow dwarf virus and Cereal yellow dwarf virus Affecting Cereal Crops in Azerbaijan

Plant Disease ◽  
2013 ◽  
Vol 97 (6) ◽  
pp. 849-849 ◽  
Author(s):  
E. S. Mustafayev ◽  
L. Svanella-Dumas ◽  
S. G. Kumari ◽  
Z. I. Akparov ◽  
T. Candresse
Keyword(s):  
Mosaic Virus ◽  
Barley Yellow Dwarf Virus ◽  
The United States ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Cereal Crops ◽  
Cereal Yellow Dwarf Virus ◽  
Barley Yellow Dwarf ◽  
Nucleotide Divergence ◽  
Yellow Dwarf Virus

A field survey was conducted during the 2010/2011 growing season at the Absheron experimental station of the Genetic Resources Institute of Azerbaijan. A total of 49 cereal samples with yellowing and reddening symptoms were obtained from 12 bread wheats (Triticum aestivum), 25 durum wheats (T. durum), 11 wild or cultivated wheat relatives (T. dicoccoides, T. beoticum, T. monococcum, and T. turgidum), and one oat (Avena sativa). Samples were tested by tissue-blot immunoassay (2) using antisera against 7 cereal-infecting viruses: Barley stripe mosaic virus (BSMV), Wheat dwarf virus (WDV), Wheat streak mosaic virus (WSMV), Barley yellow mosaic virus (BaYMV), Barley yellow striate mosaic virus (BYSMV), Maize streak virus (MSV), and Barley yellow dwarf virus (BYDV). Strong positive reactions against the BYDV-PAV polyclonal antiserum were shown by 43 samples. To confirm, total RNAs from 10 of the positive samples (three bread wheat, three durum wheat, the oat, and one sample each of T. beoticum, T. turgidum, and T. dicoccoides) were submitted to RT-PCR with two primer pairs adapted in part from (3). Primers Luteo1F 5′TTCGGMSARTGGTTGTGGTCCA 3′ and YanR-new 5′TGTTGAGGAGTCTACCTATTTNG 3′ (adapted from primer YanR (3)) allow the specific amplification of viruses of the genus Luteovirus (including BYDV) while primers Luteo2F 5′TCACSTTCGGRCCGWSTYTWTCAG 3′ (adapted from primer Shu2a-F (3)) and YanR-new are specific for the genus Polerovirus (including Cereal yellow dwarf virus, CYDV). All 10 tested samples gave a positive amplification at the expected size (~545 bp) with the first primer pair, while only two samples, one from oat and one from the wild wheat relative T. dicoccoides, gave a positive amplification of the expected size (~383 bp) with the second primer pair. Sequencing of amplification products obtained with the Luteo1F/YanR-new primer pair confirmed the presence of BYDV-PAV in all samples (GenBank JX275850 to JX275857). The Azeri isolates were all similar (0 to 1.7% nucleotide divergence) except for one isolate (JX275855, from T. turgidum, 2.4 to 3.2% divergence). An Azeri BYDV-PAV isolate (JX275851, from bread wheat) showed 100% identity with a Latvian isolate (AJ563414) and with two isolates from Morocco (AJ007929 and AJ007918). These isolates belong to a group of widespread PAV isolates and are 99% identical with isolates from Sweden, the United States, China, France, and New Zealand. Sequencing of products obtained with the Luteo2F/YanR-new primers (JX294311 and JX294312) identified CYDV-RPV. The two Azeri sequences show ~3% nucleotide divergence and their closest relatives in GenBank are a range of CYDV-RPV isolates mostly from the United States, including EF521848 and EF521830, with ~4 to 5% divergence. Presence of CYDV was also confirmed using amplification with a CYD-specific primer pair (CYDV-fw-New 5′TTGTACCGCTTGATCCACGG 3′ et CYDV-rev-New 5′GTCTGCGCGAACCATTGCC 3′, both adapted from (1)) and sequencing of the amplification products. This is, to our knowledge, the first report of BYDV-PAV and CYDV-RPV infecting cultivated cereals and wild or cultivated wheat relatives in Azerbaijan. These viruses are responsible for serious disease losses in cereal crops worldwide (4). Their full impact on crops in Azerbaijan is yet to be seen. References: (1) M. Deb and J. M. Anderson. J. Virol. Meth. 148:17, 2008. (2) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (3) C. M. Malmstrom and R. Shu. J. Virol. Meth. 120:69, 2004. (4) W. A. Miller and L. Rasochovà. Ann. Rev. Phytopathol. 35:167, 1997.

Relationships of Barley yellow dwarf virus-PAV and Cereal yellow dwarf virus-RPV from Iran with viruses of the family Luteoviridae

2005 ◽  
Vol 113 (3) ◽  
pp. 321-326 ◽  
Author(s):  
M. Rastgou ◽  
B. Khatabi ◽  
A. Kvarnheden ◽  
K. Izadpanah
Keyword(s):  
Barley Yellow Dwarf Virus ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Cereal Yellow Dwarf Virus ◽  
Barley Yellow Dwarf ◽  
The Family ◽  
Yellow Dwarf Virus

Incidence and distribution of Barley yellow dwarf virus and Cereal yellow dwarf virus in over-summering grasses in a Mediterranean-type environment

2005 ◽  
Vol 56 (3) ◽  
pp. 257 ◽  
Author(s):  
J. R. Hawkes ◽  
R. A. C. Jones
Keyword(s):  
Cynodon Dactylon ◽  
Barley Yellow Dwarf Virus ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Annual Rainfall ◽  
Grass Species ◽  
Cereal Yellow Dwarf Virus ◽  
Barley Yellow Dwarf ◽  
Yellow Dwarf Virus ◽  
Chloris Virgata

During the summer periods of 2000 and 2001, incidences of infection with Barley yellow dwarf virus (BYDV) and Cereal yellow dwarf virus (CYDV) were determined in grass weeds and volunteer cereals surviving at isolated sites throughout the grainbelt of south-western Australia, which has a Mediterranean-type climate. Samples of Cynodon dactylon, Eragrostis curvula, Erharta calycina, Pennisetum clandestinum, and volunteer cereals (mostly wheat) were tested for BYDV (serotypes MAV, PAV and RMV) and CYDV (serotype RPV), and those of at least 19 other grass species were tested for BYDV only (serotypes PAV and MAV). In 2000, BYDV and/or CYDV were detected in 33% of 192 sites in 0.7% of 26 700 samples, and in 2001 the corresponding values were 19% of 176 sites and 0.5% of 21 953 samples. Infection was distributed relatively evenly throughout the different annual average rainfall zones of the grainbelt, but when sites were categorised according to actual rainfall for late spring to early autumn, the proportion of sites and samples infected increased where such rainfall exceeded 300 mm. In both summer sampling periods, the most abundant grass species were C. dactylon and E. curvula, with BYDV and/or CYDV being detected in 0.1–0.6% and 0.1–0.5% of samples, respectively. The corresponding incidences were 0–1% for Erharta calycina, 7–8% for P. clandestinum, and 0.2–2% for volunteer wheat. The most abundant species tested for BYDV only were Chloris truncata and Digitaria sanguinalis, with infection incidences of 0.2–0.7 and 0.2–0.3%, respectively. Chloris virgata (2–3%) and Urochloa panicoides (0.3–0.6%) were the only other infected species. Within individual sites and host species, the greatest incidences of CYDV were in P. clandestinum (23% in 2000 and 18% in 2001) and of BYDV in Chloris virgata (14% with PAV and 12% with MAV in 2000). Small populations of grass-infesting aphids were found over-summering at 26% (2000) and 3% (2001) of sites and occurred in all 3 annual rainfall zones. The predominant species was Hysteroneura setariae, but Rhopalosiphum maidis, R. padi, and Sitobion miscanthi occurred occasionally. Presence of over-summering BYDV, CYDV, and aphids in all rainfall zones has important implications for virus spread to cereal crops throughout the grainbelt.

Sign in / Sign up

Export Citation Format

Share Document