scholarly journals First Report of Barley yellow dwarf virus and Cereal yellow dwarf virus Affecting Cereal Crops in Azerbaijan

Plant Disease ◽  
2013 ◽  
Vol 97 (6) ◽  
pp. 849-849 ◽  
Author(s):  
E. S. Mustafayev ◽  
L. Svanella-Dumas ◽  
S. G. Kumari ◽  
Z. I. Akparov ◽  
T. Candresse
Keyword(s):  
Mosaic Virus ◽  
Barley Yellow Dwarf Virus ◽  
The United States ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Cereal Crops ◽  
Cereal Yellow Dwarf Virus ◽  
Barley Yellow Dwarf ◽  
Nucleotide Divergence ◽  
Yellow Dwarf Virus

A field survey was conducted during the 2010/2011 growing season at the Absheron experimental station of the Genetic Resources Institute of Azerbaijan. A total of 49 cereal samples with yellowing and reddening symptoms were obtained from 12 bread wheats (Triticum aestivum), 25 durum wheats (T. durum), 11 wild or cultivated wheat relatives (T. dicoccoides, T. beoticum, T. monococcum, and T. turgidum), and one oat (Avena sativa). Samples were tested by tissue-blot immunoassay (2) using antisera against 7 cereal-infecting viruses: Barley stripe mosaic virus (BSMV), Wheat dwarf virus (WDV), Wheat streak mosaic virus (WSMV), Barley yellow mosaic virus (BaYMV), Barley yellow striate mosaic virus (BYSMV), Maize streak virus (MSV), and Barley yellow dwarf virus (BYDV). Strong positive reactions against the BYDV-PAV polyclonal antiserum were shown by 43 samples. To confirm, total RNAs from 10 of the positive samples (three bread wheat, three durum wheat, the oat, and one sample each of T. beoticum, T. turgidum, and T. dicoccoides) were submitted to RT-PCR with two primer pairs adapted in part from (3). Primers Luteo1F 5′TTCGGMSARTGGTTGTGGTCCA 3′ and YanR-new 5′TGTTGAGGAGTCTACCTATTTNG 3′ (adapted from primer YanR (3)) allow the specific amplification of viruses of the genus Luteovirus (including BYDV) while primers Luteo2F 5′TCACSTTCGGRCCGWSTYTWTCAG 3′ (adapted from primer Shu2a-F (3)) and YanR-new are specific for the genus Polerovirus (including Cereal yellow dwarf virus, CYDV). All 10 tested samples gave a positive amplification at the expected size (~545 bp) with the first primer pair, while only two samples, one from oat and one from the wild wheat relative T. dicoccoides, gave a positive amplification of the expected size (~383 bp) with the second primer pair. Sequencing of amplification products obtained with the Luteo1F/YanR-new primer pair confirmed the presence of BYDV-PAV in all samples (GenBank JX275850 to JX275857). The Azeri isolates were all similar (0 to 1.7% nucleotide divergence) except for one isolate (JX275855, from T. turgidum, 2.4 to 3.2% divergence). An Azeri BYDV-PAV isolate (JX275851, from bread wheat) showed 100% identity with a Latvian isolate (AJ563414) and with two isolates from Morocco (AJ007929 and AJ007918). These isolates belong to a group of widespread PAV isolates and are 99% identical with isolates from Sweden, the United States, China, France, and New Zealand. Sequencing of products obtained with the Luteo2F/YanR-new primers (JX294311 and JX294312) identified CYDV-RPV. The two Azeri sequences show ~3% nucleotide divergence and their closest relatives in GenBank are a range of CYDV-RPV isolates mostly from the United States, including EF521848 and EF521830, with ~4 to 5% divergence. Presence of CYDV was also confirmed using amplification with a CYD-specific primer pair (CYDV-fw-New 5′TTGTACCGCTTGATCCACGG 3′ et CYDV-rev-New 5′GTCTGCGCGAACCATTGCC 3′, both adapted from (1)) and sequencing of the amplification products. This is, to our knowledge, the first report of BYDV-PAV and CYDV-RPV infecting cultivated cereals and wild or cultivated wheat relatives in Azerbaijan. These viruses are responsible for serious disease losses in cereal crops worldwide (4). Their full impact on crops in Azerbaijan is yet to be seen. References: (1) M. Deb and J. M. Anderson. J. Virol. Meth. 148:17, 2008. (2) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (3) C. M. Malmstrom and R. Shu. J. Virol. Meth. 120:69, 2004. (4) W. A. Miller and L. Rasochovà. Ann. Rev. Phytopathol. 35:167, 1997.

scholarly journals Incidence of Viruses Infecting Winter Wheat in Alabama

Plant Disease ◽  
2003 ◽  
Vol 87 (3) ◽  
pp. 288-293 ◽  
Author(s):  
Kira L. Bowen ◽  
John F. Murphy ◽  
Kathy L. Flanders ◽  
Paul L. Mask ◽  
Ruhui Li
Keyword(s):  
Winter Wheat ◽  
Mosaic Virus ◽  
Barley Yellow Dwarf Virus ◽  
Growing Season ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Viral Diseases ◽  
Cereal Yellow Dwarf Virus ◽  
Barley Yellow Dwarf ◽  
Yellow Dwarf Virus

The most important viral diseases of wheat are caused by Barley yellow dwarf virus (BYDV, strains PAV and MAV) and Cereal yellow dwarf virus (CYDV, strain RPV). Starting in 2000, winter wheat crops growing in northern, central, and southern Alabama were evaluated for the occurrence of BYDV-PAV and CYDV-RPV. In addition to these viruses, samples were tested for the presence of Soilborne wheat mosaic virus (SBWMV), Wheat spindle streak mosaic virus (WSSMV), and Wheat streak mosaic virus (WSMV). BYDV-PAV and CYDV-RPV were found throughout the state, alone or as co-infections, in 14.6% of the samples collected in 2000 and 12.2% of samples in 2001. PAV was found at a lower incidence than RPV (4.3 and 9.9%, respectively) in 2000; however, in 2001, PAV was detected in 8.2% and RPV in 1.9% of the samples. There was less rainfall than the 30-year average during the 1999-2000 growing season, and this may have contributed to differences in the relative incidence of PAV and RPV between the 2 years. SBWMV, WSSMV, and WSMV also were detected in Alabama in 2, 7.8, and 5.4% of the samples collected in 2000, respectively, and in 9.6, 34.3, and 18.5% of the samples collected in 2001, respectively. This is the first report of WSMV in Alabama winter wheat.

scholarly journals Coordination of Diagnostic Efforts in the Great Plains: Wheat Virus Survey and Modeling of Disease Onset

Plant Disease ◽  
2016 ◽  
Vol 100 (6) ◽  
pp. 1037-1045 ◽  
Author(s):  
Mary Burrows ◽  
Carla Thomas ◽  
Neil McRoberts ◽  
Richard M. Bostock ◽  
Len Coop ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Great Plains ◽  
Barley Yellow Dwarf Virus ◽  
Laboratory Data ◽  
Disease Onset ◽  
The United States ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Barley Yellow Dwarf ◽  
Yellow Dwarf Virus

Following the discovery of two new wheat virus diseases in the United States, the Great Plains region (Colorado, Kansas, Montana, Nebraska, North Dakota, Oklahoma, South Dakota, Texas, and Wyoming) of the National Plant Diagnostic Network (NPDN) initiated a project to measure the prevalence of five wheat diseases using indirect ELISA. Wheat streak mosaic virus (WSMV), Wheat mosaic virus (WMoV), and Triticum mosaic virus (TriMV) were found in all nine states. WSMV was the most prevalent, averaging 23 to 47% of samples each year. TriMV and WMoV were detected with WSMV (in up to 76% of the samples). All three mite-transmitted viruses were present in 26% or fewer of the samples. Aphid-transmitted viruses in the barley yellow dwarf complex Barley yellow dwarf virus, and Cereal yellow dwarf virus-RPV were less frequent (fewer than 65% of the samples). This paper presents the first case-control methodology paper using plant diagnostic laboratory data and the first signed diagnostic data-sharing agreement between the NPDN and its regulatory stakeholders. Samples collected when <700 cumulative degree-days base 0°C, were twice as likely to be virus negative. This proof-of-concept effort highlights the potential of the NPDN and its National Data Repository to develop knowledge about emerging diseases.

Survey of Barley yellow dwarf virus incidence in winter cereal crops, and assessment of wheat and barley resistance to the virus

2016 ◽  
Vol 67 (10) ◽  
pp. 1054 ◽  
Author(s):  
Eva Beoni ◽  
Jana Chrpová ◽  
Jana Jarošová ◽  
Jiban Kumar Kundu
Keyword(s):  
Barley Yellow Dwarf Virus ◽  
Rhopalosiphum Padi ◽  
Wheat Breeding ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Cereal Crops ◽  
Winter Cereal ◽  
Barley Yellow Dwarf ◽  
Significant Difference ◽  
Yellow Dwarf Virus

A survey of Barley yellow dwarf virus (BYDV) incidence in cereal crops in the Czech Republic over 4 years showed, on average, 13.3% BYDV-positive, randomly tested wheat and barley samples. The cultivated wheat and barley cultivars had different levels of susceptibility to BYDV infection. Field trials were performed with different barley and wheat breeding lines and cultivars, and resistance traits were evaluated after artificial inculcation by the viruliferous aphid vector Rhopalosiphum padi L. with BYDV-PAV. Our results showed high variability of visual symptom score (VSS) and reduction in grain weight per spike (GWS-R) in trials within the tested lines and cultivars. The barley line (WBON 96-123) and cultivars (Wysor, Travira) that contained RYd2 differed significantly from other cultivars in VSS. Line WBON 96-123 and cvv. Wysor and Yatzi showed the lowest GWS-R. Wheat line PSR 3628 and cvv. Altigo, Elan, Sparta, Aladin and Hewit showed significant difference from other cultivars in VSS. PSR 3628, Sparta, and Elan showed the lowest GWS-R. Similar results were obtained from BYDV titre analysis by RT-qPCR corresponding to the VSS and GWS-R traits. A low virus titre corresponded to low VSS and GWS-R. Hence, our results suggest that laborious and time-consuming GWS-R analysis could be replaced in some cases by qPCR-based BYDV titre analysis and, together with VSS evaluation, could enhance the efficiency of resistance assessment.

scholarly journals Occurrence of Winter Cereal Viruses in New South Wales, Australia, 2006 to 2014

Plant Disease ◽  
2016 ◽  
Vol 100 (2) ◽  
pp. 313-317 ◽  
Author(s):  
Andrew Milgate ◽  
Dante Adorada ◽  
Grant Chambers ◽  
Mary Ann Terras
Keyword(s):  
Mosaic Virus ◽  
Barley Yellow Dwarf Virus ◽  
New South ◽  
New South Wales ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Winter Cereal ◽  
Barley Yellow Dwarf ◽  
South Wales ◽  
Yellow Dwarf Virus

Winter cereal viruses can cause significant crop losses; however, detailed knowledge of their occurrence in New South Wales, Australia is very limited. This paper reports on the occurrence of Wheat streak mosaic virus (WSMV), Wheat mosaic virus (WMoV), Barley yellow dwarf virus (BYDV), Cereal yellow dwarf virus (CYDV), and their serotypes between 2006 and 2014. Detection of WMoV is confirmed in eastern Australia for the first time. The BYDV and CYDV 2014 epidemic is examined in detail using 139 samples of wheat, barley, and oat surveyed from southern New South Wales. The presence of virus was determined using enzyme-linked immunosorbent assays. The results reveal a high frequency of the serotype Barley yellow dwarf virus - MAV as a single infection present in 27% of samples relative to Barley yellow dwarf virus - PAV in 19% and CYDV in 14%. Clear differences emerged in the infection of different winter cereal species by serotypes of BYDV and CYDV. These results are contrasted to other Australian and international studies.

Incidence and distribution of Barley yellow dwarf virus and Cereal yellow dwarf virus in over-summering grasses in a Mediterranean-type environment

2005 ◽  
Vol 56 (3) ◽  
pp. 257 ◽  
Author(s):  
J. R. Hawkes ◽  
R. A. C. Jones
Keyword(s):  
Cynodon Dactylon ◽  
Barley Yellow Dwarf Virus ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Annual Rainfall ◽  
Grass Species ◽  
Cereal Yellow Dwarf Virus ◽  
Barley Yellow Dwarf ◽  
Yellow Dwarf Virus ◽  
Chloris Virgata

During the summer periods of 2000 and 2001, incidences of infection with Barley yellow dwarf virus (BYDV) and Cereal yellow dwarf virus (CYDV) were determined in grass weeds and volunteer cereals surviving at isolated sites throughout the grainbelt of south-western Australia, which has a Mediterranean-type climate. Samples of Cynodon dactylon, Eragrostis curvula, Erharta calycina, Pennisetum clandestinum, and volunteer cereals (mostly wheat) were tested for BYDV (serotypes MAV, PAV and RMV) and CYDV (serotype RPV), and those of at least 19 other grass species were tested for BYDV only (serotypes PAV and MAV). In 2000, BYDV and/or CYDV were detected in 33% of 192 sites in 0.7% of 26 700 samples, and in 2001 the corresponding values were 19% of 176 sites and 0.5% of 21 953 samples. Infection was distributed relatively evenly throughout the different annual average rainfall zones of the grainbelt, but when sites were categorised according to actual rainfall for late spring to early autumn, the proportion of sites and samples infected increased where such rainfall exceeded 300 mm. In both summer sampling periods, the most abundant grass species were C. dactylon and E. curvula, with BYDV and/or CYDV being detected in 0.1–0.6% and 0.1–0.5% of samples, respectively. The corresponding incidences were 0–1% for Erharta calycina, 7–8% for P. clandestinum, and 0.2–2% for volunteer wheat. The most abundant species tested for BYDV only were Chloris truncata and Digitaria sanguinalis, with infection incidences of 0.2–0.7 and 0.2–0.3%, respectively. Chloris virgata (2–3%) and Urochloa panicoides (0.3–0.6%) were the only other infected species. Within individual sites and host species, the greatest incidences of CYDV were in P. clandestinum (23% in 2000 and 18% in 2001) and of BYDV in Chloris virgata (14% with PAV and 12% with MAV in 2000). Small populations of grass-infesting aphids were found over-summering at 26% (2000) and 3% (2001) of sites and occurred in all 3 annual rainfall zones. The predominant species was Hysteroneura setariae, but Rhopalosiphum maidis, R. padi, and Sitobion miscanthi occurred occasionally. Presence of over-summering BYDV, CYDV, and aphids in all rainfall zones has important implications for virus spread to cereal crops throughout the grainbelt.

scholarly journals First Report of Barley yellow dwarf virus-MAV in Oat, Wheat, and Barley Grown in the Czech Republic

Plant Disease ◽  
2009 ◽  
Vol 93 (9) ◽  
pp. 964-964 ◽  
Author(s):  
J. K. Kundu
Keyword(s):  
Czech Republic ◽  
Barley Yellow Dwarf Virus ◽  
Virus Disease ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Cereal Crops ◽  
Rt Pcr ◽  
The Czech Republic ◽  
Barley Yellow Dwarf ◽  
Yellow Dwarf Virus

Barley yellow dwarf disease, a ubiquitous virus disease of cereal crops worldwide, is caused by a group of related, single-stranded RNA viruses assigned to Luteovirus (Barley yellow dwarf virus [BYDV] spp. PAV, PAS, MAV, and GAV) or Polerovirus (Cereal yellow dwarf virus-RPV) genera or unassigned to a genera (BYDV-SGV, BYDV-RMV, and BYDV-GPV) in the family Luteoviridae (1). Incidence of BYDV in cereal crops (e.g., barley, wheat, and oats) was high, and in recent years, reached epidemic levels in many regions of the Czech Republic. BYDV-PAV and BYDV-PAS have been identified in Czech cereal crops (2,4). Surveys of the incidence of BYDV were carried out using ELISA (SEDIAG SAS, Longvic, France) and one-step reverse transcription (RT)-PCR (Qiagen, Hilden, Germany) (2) during 2007 and 2008. Samples (125) were collected from different fields around the Czech Republic and 96 were BYDV positive. Three of the field isolates, CZ-6815, CZ-1561, and CZ-10844, from oat (Avena sativa; cv. Auron), winter wheat (Triticum aestivum; cv. Apache), and winter barley (Hordeum vulgare; cv. Merlot), respectively, were identified as BYDV-MAV by sequencing of the RT-PCR product (641-bp fragment) used to identify BYDV, which spanned 2839–3479 of the BYDV genome (GenBank Accession Nos. EF043235 and NC_002160) (2). The partial coat protein gene sequence of 483 nt was compared with the available sequences of 12 BYDV-PAV isolates (PAV-JP, PAV-NY, PAV-ILL, PAV-AUS, PAV-WG2, PAV-whG4y3, PAV-on21-4, Tahoe1, CA-PAV, HB3, FH3, and MA9501); nine BYDV-PAS isolates (PAS-129, PAS-64, WS6603, WG13, PAS-Tcb4-1, PASwaw5-9, FL2, PAS-Vd29, and PAS-MA9516); and six BYDV-MAV isolates (MAV-CA, MAV-PS1X1, MAV-Alameds268, LMB2a, SI-o4, and MAV-CN) by MEGA4 (3). Nucleotide and amino acid sequence identities for the three isolates ranged from 92.9 to 99.4% and 88.0 to 95.8%, respectively, for available BYDV-MAV isolates; 76.8 to 78.2% and 62.7 to 67.6%, respectively, for available BYDV-PAS isolates; and 77.6 to 79.3% and 65.5 to 70.4%, respectively, for available PAV isolates. The sequence data indicates that these isolates (CZ-6815, CZ-1561, and CZ10844; GenBank Accession Nos. FJ645747, FJ645758, and FJ645746, respectively) are BYDV-MAV. To my knowledge, this is the first record of BYDV-MAV in the Czech Republic. References: (1) C. J. D'Arcy and L. L. Domier. Page 891 in: Virus Taxonomy-8th Report of the ICTV. C. M. Fauquet et al., eds. Springer-Verlag, NY, 2005. (2) J. K. Kundu. Plant Dis. 92:1587, 2008. (3) K. Tamura et al. Mol. Biol. Evol. 24:1596, 2007. (4) J. Vacke. Page 100 in: Sbornik Referatu z Odborneho Seminare, Aktualni Problemy Ochrany Polnich Plodin, Praha, 1991.

Sign in / Sign up

Export Citation Format

Share Document