Occurrence of barley yellow dwarf virus in autumn-sown cereal crops in the United Kingdom in relation to field characteristics

2004 ◽  
Vol 60 (2) ◽  
pp. 113-125 ◽  
Author(s):  
Garth N Foster ◽  
Shona Blake ◽  
Steve J Tones ◽  
Ian Barker ◽  
Richard Harrington
2016 ◽  
Vol 67 (10) ◽  
pp. 1054 ◽  
Author(s):  
Eva Beoni ◽  
Jana Chrpová ◽  
Jana Jarošová ◽  
Jiban Kumar Kundu

A survey of Barley yellow dwarf virus (BYDV) incidence in cereal crops in the Czech Republic over 4 years showed, on average, 13.3% BYDV-positive, randomly tested wheat and barley samples. The cultivated wheat and barley cultivars had different levels of susceptibility to BYDV infection. Field trials were performed with different barley and wheat breeding lines and cultivars, and resistance traits were evaluated after artificial inculcation by the viruliferous aphid vector Rhopalosiphum padi L. with BYDV-PAV. Our results showed high variability of visual symptom score (VSS) and reduction in grain weight per spike (GWS-R) in trials within the tested lines and cultivars. The barley line (WBON 96-123) and cultivars (Wysor, Travira) that contained RYd2 differed significantly from other cultivars in VSS. Line WBON 96-123 and cvv. Wysor and Yatzi showed the lowest GWS-R. Wheat line PSR 3628 and cvv. Altigo, Elan, Sparta, Aladin and Hewit showed significant difference from other cultivars in VSS. PSR 3628, Sparta, and Elan showed the lowest GWS-R. Similar results were obtained from BYDV titre analysis by RT-qPCR corresponding to the VSS and GWS-R traits. A low virus titre corresponded to low VSS and GWS-R. Hence, our results suggest that laborious and time-consuming GWS-R analysis could be replaced in some cases by qPCR-based BYDV titre analysis and, together with VSS evaluation, could enhance the efficiency of resistance assessment.


Plant Disease ◽  
2013 ◽  
Vol 97 (6) ◽  
pp. 849-849 ◽  
Author(s):  
E. S. Mustafayev ◽  
L. Svanella-Dumas ◽  
S. G. Kumari ◽  
Z. I. Akparov ◽  
T. Candresse

A field survey was conducted during the 2010/2011 growing season at the Absheron experimental station of the Genetic Resources Institute of Azerbaijan. A total of 49 cereal samples with yellowing and reddening symptoms were obtained from 12 bread wheats (Triticum aestivum), 25 durum wheats (T. durum), 11 wild or cultivated wheat relatives (T. dicoccoides, T. beoticum, T. monococcum, and T. turgidum), and one oat (Avena sativa). Samples were tested by tissue-blot immunoassay (2) using antisera against 7 cereal-infecting viruses: Barley stripe mosaic virus (BSMV), Wheat dwarf virus (WDV), Wheat streak mosaic virus (WSMV), Barley yellow mosaic virus (BaYMV), Barley yellow striate mosaic virus (BYSMV), Maize streak virus (MSV), and Barley yellow dwarf virus (BYDV). Strong positive reactions against the BYDV-PAV polyclonal antiserum were shown by 43 samples. To confirm, total RNAs from 10 of the positive samples (three bread wheat, three durum wheat, the oat, and one sample each of T. beoticum, T. turgidum, and T. dicoccoides) were submitted to RT-PCR with two primer pairs adapted in part from (3). Primers Luteo1F 5′TTCGGMSARTGGTTGTGGTCCA 3′ and YanR-new 5′TGTTGAGGAGTCTACCTATTTNG 3′ (adapted from primer YanR (3)) allow the specific amplification of viruses of the genus Luteovirus (including BYDV) while primers Luteo2F 5′TCACSTTCGGRCCGWSTYTWTCAG 3′ (adapted from primer Shu2a-F (3)) and YanR-new are specific for the genus Polerovirus (including Cereal yellow dwarf virus, CYDV). All 10 tested samples gave a positive amplification at the expected size (~545 bp) with the first primer pair, while only two samples, one from oat and one from the wild wheat relative T. dicoccoides, gave a positive amplification of the expected size (~383 bp) with the second primer pair. Sequencing of amplification products obtained with the Luteo1F/YanR-new primer pair confirmed the presence of BYDV-PAV in all samples (GenBank JX275850 to JX275857). The Azeri isolates were all similar (0 to 1.7% nucleotide divergence) except for one isolate (JX275855, from T. turgidum, 2.4 to 3.2% divergence). An Azeri BYDV-PAV isolate (JX275851, from bread wheat) showed 100% identity with a Latvian isolate (AJ563414) and with two isolates from Morocco (AJ007929 and AJ007918). These isolates belong to a group of widespread PAV isolates and are 99% identical with isolates from Sweden, the United States, China, France, and New Zealand. Sequencing of products obtained with the Luteo2F/YanR-new primers (JX294311 and JX294312) identified CYDV-RPV. The two Azeri sequences show ~3% nucleotide divergence and their closest relatives in GenBank are a range of CYDV-RPV isolates mostly from the United States, including EF521848 and EF521830, with ~4 to 5% divergence. Presence of CYDV was also confirmed using amplification with a CYD-specific primer pair (CYDV-fw-New 5′TTGTACCGCTTGATCCACGG 3′ et CYDV-rev-New 5′GTCTGCGCGAACCATTGCC 3′, both adapted from (1)) and sequencing of the amplification products. This is, to our knowledge, the first report of BYDV-PAV and CYDV-RPV infecting cultivated cereals and wild or cultivated wheat relatives in Azerbaijan. These viruses are responsible for serious disease losses in cereal crops worldwide (4). Their full impact on crops in Azerbaijan is yet to be seen. References: (1) M. Deb and J. M. Anderson. J. Virol. Meth. 148:17, 2008. (2) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (3) C. M. Malmstrom and R. Shu. J. Virol. Meth. 120:69, 2004. (4) W. A. Miller and L. Rasochovà. Ann. Rev. Phytopathol. 35:167, 1997.


Plant Disease ◽  
2009 ◽  
Vol 93 (9) ◽  
pp. 964-964 ◽  
Author(s):  
J. K. Kundu

Barley yellow dwarf disease, a ubiquitous virus disease of cereal crops worldwide, is caused by a group of related, single-stranded RNA viruses assigned to Luteovirus (Barley yellow dwarf virus [BYDV] spp. PAV, PAS, MAV, and GAV) or Polerovirus (Cereal yellow dwarf virus-RPV) genera or unassigned to a genera (BYDV-SGV, BYDV-RMV, and BYDV-GPV) in the family Luteoviridae (1). Incidence of BYDV in cereal crops (e.g., barley, wheat, and oats) was high, and in recent years, reached epidemic levels in many regions of the Czech Republic. BYDV-PAV and BYDV-PAS have been identified in Czech cereal crops (2,4). Surveys of the incidence of BYDV were carried out using ELISA (SEDIAG SAS, Longvic, France) and one-step reverse transcription (RT)-PCR (Qiagen, Hilden, Germany) (2) during 2007 and 2008. Samples (125) were collected from different fields around the Czech Republic and 96 were BYDV positive. Three of the field isolates, CZ-6815, CZ-1561, and CZ-10844, from oat (Avena sativa; cv. Auron), winter wheat (Triticum aestivum; cv. Apache), and winter barley (Hordeum vulgare; cv. Merlot), respectively, were identified as BYDV-MAV by sequencing of the RT-PCR product (641-bp fragment) used to identify BYDV, which spanned 2839–3479 of the BYDV genome (GenBank Accession Nos. EF043235 and NC_002160) (2). The partial coat protein gene sequence of 483 nt was compared with the available sequences of 12 BYDV-PAV isolates (PAV-JP, PAV-NY, PAV-ILL, PAV-AUS, PAV-WG2, PAV-whG4y3, PAV-on21-4, Tahoe1, CA-PAV, HB3, FH3, and MA9501); nine BYDV-PAS isolates (PAS-129, PAS-64, WS6603, WG13, PAS-Tcb4-1, PASwaw5-9, FL2, PAS-Vd29, and PAS-MA9516); and six BYDV-MAV isolates (MAV-CA, MAV-PS1X1, MAV-Alameds268, LMB2a, SI-o4, and MAV-CN) by MEGA4 (3). Nucleotide and amino acid sequence identities for the three isolates ranged from 92.9 to 99.4% and 88.0 to 95.8%, respectively, for available BYDV-MAV isolates; 76.8 to 78.2% and 62.7 to 67.6%, respectively, for available BYDV-PAS isolates; and 77.6 to 79.3% and 65.5 to 70.4%, respectively, for available PAV isolates. The sequence data indicates that these isolates (CZ-6815, CZ-1561, and CZ10844; GenBank Accession Nos. FJ645747, FJ645758, and FJ645746, respectively) are BYDV-MAV. To my knowledge, this is the first record of BYDV-MAV in the Czech Republic. References: (1) C. J. D'Arcy and L. L. Domier. Page 891 in: Virus Taxonomy-8th Report of the ICTV. C. M. Fauquet et al., eds. Springer-Verlag, NY, 2005. (2) J. K. Kundu. Plant Dis. 92:1587, 2008. (3) K. Tamura et al. Mol. Biol. Evol. 24:1596, 2007. (4) J. Vacke. Page 100 in: Sbornik Referatu z Odborneho Seminare, Aktualni Problemy Ochrany Polnich Plodin, Praha, 1991.


Crop Science ◽  
1990 ◽  
Vol 30 (5) ◽  
pp. 1008 ◽  
Author(s):  
J. Collin ◽  
A. Comeau ◽  
C.A. St-Pierre

Crop Science ◽  
1994 ◽  
Vol 34 (2) ◽  
pp. 371-375 ◽  
Author(s):  
Ellen M. Bauske ◽  
Frederic L. Kolb ◽  
Adrianna D. Hewings ◽  
Gordon Cisar

Sign in / Sign up

Export Citation Format

Share Document