167 – Association between Dysbindin gene (DTNBP1) and psychoses in a Spanish isolate population

2008 ◽  
Vol 98 ◽  
pp. 102
Author(s):  
I. Mata ◽  
J.M. López-Ilundain ◽  
M. Otero ◽  
F. Pérez-Nievas ◽  
B. Crespo-Facorro ◽  
...  
Keyword(s):  
2005 ◽  
Vol 58 (6) ◽  
pp. 435-439 ◽  
Author(s):  
Dan A. Clark ◽  
Maria J. Arranz ◽  
Ignacio Mata ◽  
Jose Lopéz-Ilundain ◽  
Fernando Pérez-Nievas ◽  
...  

1997 ◽  
Vol 52 (5-6) ◽  
pp. 391-395
Author(s):  
Juan José López-Moya ◽  
Dionisio López-Abella ◽  
José-Ramón Díaz-Rúiz ◽  
Belén Martinez-Garcia ◽  
Richard Gáborjányi

Abstract Three Hungarian (No.2, 4 and 9), and a Moldavian (K) plum pox virus isolates were compared with a characterized Spanish isolate (5.15) by RT-PCR, ELISA, dot-blot and West­ern blot analysis. Monoclonal antibodies prepared against the external, intermediate and internal sequences of the coat protein of the Spanish isolate were able to differentiate the four isolates. Hungarian isolate No. 2 proved to be serologically identical to the Spanish isolate, while No. 4 showed appreciable differences and No. 9 could be recognized only by the monoclonal antibodies representing the intermedial and internal parts of the coat protein. K isolate showed a more distant relationship to other isolates. Our experiment provided the first demonstration of the presence of D type isolates in Hungary.


Plant Disease ◽  
1999 ◽  
Vol 83 (12) ◽  
pp. 1176-1176 ◽  
Author(s):  
J. Reina ◽  
G. Morilla ◽  
E. R. Bejarano ◽  
M. D. Rodríguez ◽  
D. Janssen

Infection of tomato crops by tomato yellow leaf curl virus (TYLCV) has occurred annually in southern Spain since 1992. In 1997, TYLCV also was reported in common bean (Phaseolus vulgaris) (2) in southern Spain. During the summer of 1999, we observed pepper plants (Capsicum annuum) from a greenhouse in Almería (Spain) exhibiting clear leaf internervial and marginal chlorosis and upward curling of the leaflet margin. Total nucleic acids were extracted from five plants with symptoms and analyzed by Southern blot hybridization and polymerase chain reaction (PCR). As a probe, we used a plasmid (pSP72/97) encompassing the complete genome of the Spanish isolate of TYLCV-IS (1). A positive signal was obtained from three samples. A pair of primers (OTYA3/OTYA6) designed to amplify TYLCV was used for detection in samples (OTYA3: GGGTCGACGTCATCAATGACG; OTYA6: CTACATGAGAATGGGGAACC). Using PCR, we were able to obtain fragments of the expected sizes (649 bp for OTYA3/OTYA6) from four of five samples analyzed. Amplified fragments were later analyzed by restriction fragment length polymorphism with three cutter enzymes (AluI, RsaI, and HinfI). The restriction pattern obtained in all cases corresponded with the Spanish isolate of TYLCV-IS. One of the fragments amplified with OTYA3/OTYA6 was fully sequenced. The sequence was 100% identical to that previously reported for the Spanish isolate of TYLCV-IS. This is the first report of TYLCV infection in C. annuum, which is one of the most important commercial crops in southeastern Spain. Work is in progress to determine whether the presence of TYLCV-IS in pepper plants is responsible for the symptoms described here. References: (1) J. Navas-Castillo et al. Plant Dis. 81:1461, 1997. (2) J. Navas-Castillo et al. Plant Dis. 83:29, 1999.


Plant Disease ◽  
2014 ◽  
Vol 98 (4) ◽  
pp. 573-573 ◽  
Author(s):  
D. L. Ochoa-Martínez ◽  
J. Alfonsina-Hernández ◽  
J. Sánchez-Escudero ◽  
D. Rodríguez-Martínez ◽  
J. Vera-Graziano

Lettuce (Lactuca sativa) is a common consumed vegetable and a major source of income and nutrition for small farmers in Mexico. This crop is infected with at least nine viruses: Mirafiori lettuce big-vein virus (MiLBVV), Lettuce big-vein associated virus (LBVaV), both transmitted by the soil-borne fungus Olpidium brassicae; Tomato spotted wilt virus (TSWV), Tomato chlorotic spot virus (TCSV), Groundnut ringspot virus (GRSV), Lettuce mottle virus (LMoV), Cucumber mosaic virus (CMV), Bidens mosaic virus (BiMV), and Lettuce mosaic virus (LMV) (1). From March to May 2012, a disease on lettuce was observed in the south region of Mexico City displaying mild to severe mosaic, leaf deformation, reduced growth, slight thickening of the main vein, and plant death. At the beginning of the epidemic there were just a few plants with visible symptoms and 7 days later the entire crop was affected, causing a loss of 93% of the plants. It was estimated by counting the number of severely affected or dead plants in three plots. No thrips, aphids, or whiteflies were observed in the crop during this time. Twenty plants with similar symptoms were collected and tested by RT-PCR using the primers LBVaVF 5′-AACACTATGGGCATCCACAT-3′ and LBVaVR 5′-GCATGTCAGCAATCAGAGGA-3′ specific for the coat protein gene of LBVaV, amplifying a 322-bp fragment. Primers CP829F 5′-CCWACTTCATCAGTTGAGCGCTG-3′ and CP1418R 5′-TATCAGCTCCCTACACTATCCTCGC-3′ were used to detect MiLBVV (2). No amplification was obtained for MiLBVaV in any plants tested. PCR products of approximately 300 bp were obtained from four out of 20 symptomatic lettuce samples tested for LBVaV, but not from healthy plant and water controls. These results suggest the presence of another virus in symptomatic lettuce plants. Amplicons were gel-purified and sequenced using LBVaVF and LBVaVR primers. A consensus sequence was generated using the Bioedit v. 5 program. Both sequences of these Mexican lettuce isolates were 100% identical (Accession Nos. KC776266.1 and KC776267.1) and had identities between 94 and 99% to all sequences of LBVaV available in GenBank. Additionally, when alignments were made using ClustalW, these sequences showed identities of 99.7% to Almeria-Spanish isolate (Accession No. AY581686.1); 99.4% to Granada-Spanish isolate (AY581689.1); 99.1% to Dutch isolate (JN710441.1), Iranian isolate (JN400921.1), Australian isolate (GU220725.1), Brazilian isolate (DQ530354.1), England isolate (AY581690.1), and American isolate (AY496053.1); 96.2% to Australian isolate (GU220722.1); 96.3% to Japanese isolate (AB190527.1); and 92.8% to Murcia-Spanish isolate (AY581691.1). Twenty lettuce plants were mechanically inoculated with leaf tissue taken from the four plants collected in the field and tested positive for LBVaV by RT-PCR; 12 days after inoculation, mosaic symptoms were observed in all inoculated plants and six of them were analyzed individually by RT-PCR obtaining a fragment of the expected size. To our knowledge, this is the first report of LBVaV infecting lettuce in Mexico. Further surveys and monitoring of LBVaV incidence and distribution in the region, vector competence of olpidium species, and impact on the crop quality are in progress. References: (1) P. M. Agenor et al. Plant Viruses 2:35, 2008. (2) R. J. Hayes et al. Plant Dis. 90:233, 2006.


2008 ◽  
Vol 190 (9) ◽  
pp. 3353-3361 ◽  
Author(s):  
Carlos R. Osorio ◽  
Joeli Marrero ◽  
Rachel A. F. Wozniak ◽  
Manuel L. Lemos ◽  
Vincent Burrus ◽  
...  

ABSTRACT Integrating conjugative elements (ICEs) are self-transmissible mobile elements that transfer between bacteria via conjugation and integrate into the host chromosome. SXT and related ICEs became prevalent in Asian Vibrio cholerae populations in the 1990s and play an important role in the dissemination of antibiotic resistance genes in V. cholerae. Here, we carried out genomic and functional analyses of ICEPdaSpa1, an SXT-related ICE derived from a Spanish isolate of Photobacterium damselae subsp. piscicida, the causative agent of fish pasteurellosis. The ∼102-kb DNA sequence of ICEPdaSpa1 shows nearly 97% DNA sequence identity to SXT in genes that encode essential ICE functions, including integration and excision, conjugal transfer, and regulation. However, ∼25 kb of ICEPdaSpa1 DNA, including a tetracycline resistance locus, is not present in SXT. Most ICEPdaSpa1-specific DNA is inserted at loci where other SXT-related ICEs harbor element-specific DNA. ICEPdaSpa1 excises itself from the chromosome and is transmissible to other Photobacterium strains, as well as to Escherichia coli, in which it integrates into prfC. Interestingly, the P. damselae virulence plasmid pPHDP10 could be mobilized from E. coli in an ICEPdaSpa1-dependent fashion via the formation of a cointegrate between pPHDP10 and ICEPdaSpa1. pPHDP10-Cm integrated into ICEPdaSpa1 in a non-site-specific fashion independently of RecA. The ICEPdaSpa1::pPHDP10 cointegrates were stable, and markers from both elements became transmissible at frequencies similar to those observed for the transfer of ICEPdaSpa1 alone. Our findings reveal the plasticity of ICE genomes and demonstrate that ICEs can enable virulence gene transfer.


2011 ◽  
Vol 156 (6) ◽  
pp. 1049-1052 ◽  
Author(s):  
Giuseppe Parrella ◽  
Nadia Acanfora ◽  
Anelise F. Orílio ◽  
Jesús Navas-Castillo

2008 ◽  
Vol 18 (6) ◽  
pp. 313-317 ◽  
Author(s):  
Rafael Tabarés-Seisdedos ◽  
Ignacio Mata ◽  
Teresa Escámez ◽  
Eduard Vieta ◽  
Jose M. López-Ilundain ◽  
...  

Virus Genes ◽  
2009 ◽  
Vol 39 (2) ◽  
pp. 256-260 ◽  
Author(s):  
Luis Galipienso ◽  
Luis Rubio ◽  
Carmelo López ◽  
Salvador Soler ◽  
José Aramburu

Sign in / Sign up

Export Citation Format

Share Document