Infectivity of an Infectious Clone of Banana Streak CA Virus in A-Genome Bananas (Musa acuminata ssp.)

We have characterized the complete genome sequence of an Australian isolate of banana streak CA virus (BSCAV). A greater-than-full-length, cloned copy of the virus genome was assembled and agroinoculated into five tissue-cultured plants of nine different Musa acuminata banana accessions. BSCAV was highly infectious in all nine accessions. All five inoculated plants from eight accessions developed symptoms by 28 weeks post-inoculation, while all five plants of M. acuminata AA subsp. zebrina remained symptomless. Symptoms were mild in six accessions but were severe in Khae Phrae (M. acuminata subsp. siamea) and the East African Highland banana accession Igisahira Gisanzwe. This is the first full-length BSCAV genome sequence reported from Australia and the first report of the infectivity of an infectious clone of banana streak virus.

Molecular characterisation of Mycobacterium avium subsp. paratuberculosis in Australia

Background Mycobacterium avium subsp. paratuberculosis (Map) causes Johne’s disease (JD), a chronic enteritis widespread in ruminants, resulting in substantial economic losses, especially to the dairy industry. Understanding the genetic diversity of Map in Australia will assist epidemiological studies for tracking disease transmission and identify subtype characteristics for use in development of improved diagnostic typing methods. Here we investigated the phylogenetic relationships of 351 Map isolates and compared different subtyping methods to assess their suitability for use in diagnostics and accuracy. Results SNP-based phylogenetic analysis of 228 Australian isolates and 123 publicly available international isolates grouped Type S and Type C strains into two distinct lineages. Type C strains were highly monomorphic with only 20 SNP differences separating them. Type S strains, when aligned separately to the Telford strain, fell into two distinct clades: The first clade contained seven international isolates while the second clade contained one international isolate from Scotland and all 59 Australian isolates. The Australian Type B strain clustered with US bison strains. IS1311 PCR and Restriction Enzyme Analysis (REA) intermittently generated incorrect results when compared to Long Sequence Polymorphism (LSP) analysis, whole genome SNP-based phylogenetic analysis, IS1311 sequence alignment and average nucleotide identity (ANI). These alternative methods generated consistent Map typing results. A published SNP based assay for genotyping Map was found to be unsuitable for differentiating between Australian and international strain types of Map. Conclusion This is the first phylogenetic analysis of Australian Map isolates. The Type C lineage was highly monomorphic, and the Type S lineage clustered all Australian isolates into one clade with a single Scottish sheep strain. The Australian isolate classified as Type B by IS1311 PCR and REA is likely to be descended from bison and most closely related to US bison strains. Limitations of the current typing methods were identified in this study.

Reference genome assembly for Australian Ascochyta lentis isolate Al4

Ascochyta lentis causes ascochyta blight in lentil (Lens culinaris Medik.) and yield loss can be as high as 50%. With careful agronomic management practices, fungicide use, and advances in breeding resistant lentil varieties, disease severity and impact to farmers have been largely controlled. However, evidence from major lentil producing countries, Canada and Australia, suggests that A. lentis isolates can change their virulence profile and level of aggressiveness over time and under different selection pressures. In this paper, we describe the first genome assembly for A. lentis for the Australian isolate Al4, through the integration of data from Illumina and PacBio SMRT sequencing. The Al4 reference genome assembly is almost 42 Mb in size and encodes 11,638 predicted genes. The Al4 genome comprises 21 full-length and gapless chromosomal contigs and two partial chromosome contigs each with one telomere. We predicted 31 secondary metabolite clusters, and 38 putative protein effectors, many of which were classified as having an unknown function. Comparison of A. lentis genome features with the recently published reference assembly for closely related A. rabiei show that genome synteny between these species is highly conserved. However, there are several translocations and inversions of genome sequence. The location of secondary metabolite clusters near transposable element and repeat-rich genomic regions was common for A. lentis as has been reported for other fungal plant pathogens.

First report of grapevine rupestris vein feathering virus in grapevines from Washington State

Since the first report of grapevine rupestris vein feathering virus (GRVFV; genus Marafivirus, family Tymoviridae) in a Greek grapevine causing chlorotic discoloration of leaf veins (El Beaino et al., 2001), GRVFV was reported in some European countries, and in Australia, China, Korea, New Zealand, Uruguay, and Canada (Blouin et al., 2017; Cho et al., 2018; Reynard et al., 2017). In the USA, the virus was reported only from California in vines showing Syrah decline symptoms (Al Rwahnih et al., 2009). During virus surveys conducted between 2015 and 2019, 424 samples (petioles from individual or composite of five vines, with 4 petioles/vine) with and without discernible symptoms were collected randomly from 39 Vitis vinifera cultivars in vineyards and nurseries in eastern Washington State. Total RNA was isolated from these samples separately using SpectrumTM Plant Total RNA Kit (Sigma-Aldrich) and subjected individually to Illumina RNAseq (Huntsman Cancer Institute, Salt Lake City, UT). An average of ~28 million 120-base pair (bp) paired-end reads using HiSeq2500 platform and an average of ~18 million 145-bp paired-end reads using Novaseq 6000 platform were obtained per sample. The contigs from de novo assembly of quality-filtered reads from each sample (CLC Genomics workbench 12) were subjected to BLASTn analysis against the virus database from GenBank. In addition to grapevine viruses and viroids previously reported in Washington State, GRVFV-specific sequences were obtained in samples from 11 of the 39 cultivars; namely, Muscat Ottonel, Pinot gris and Sangiovese from vineyards and Aglianico, Bonarda, Cabernet Sauvignon, Chardonnay, Garnacha Tinta, Riesling, Tempranillo and Valdiguie from nurseries. BLASTn analysis of the 73 GRVFV-specific contigs, ranging in size between 500 nt and 6474 nt, showed sequence identity between 79.4% and 95.5% with GRVFV sequences deposited in GenBank. The data also revealed that GRVFV was always present as coinfection with one or more viruses and viroids (grapevine leafroll-associated virus 3, grapevine red blotch virus, grapevine virus A and B, grapevine rupestris stem pitting-associated virus, hop stunt viroid and grapevine yellow speckle viroid 1) making it difficult to correlate presence of the virus with specific symptoms. To confirm the presence of GRVFV, samples from cvs. Sangiovese (n = 45) and Pinot gris (n = 1) were tested by RT-PCR using custom designed primers SaF-215 (5’- TACAAGGTGAATTGCTCCACAC -3’) and SaR-1027 (5’-TCATTGGCGATGCGTTCG-3’) to amplify the 813 bp sequence covering partial replicase associated polyprotein region of the virus genome. Sanger sfour amplicons (MT782067-MT782070) showed identities from 86% (700 bp out of 813 bp) with an Australian isolate (MT084811.1) to 90.9% (738 bp out of 813 bp) with an isolate from New Zealand (MF000326.1). Additional studies are in progress to examine the etiology, genetic diversity and impact of GRVFV in Washington vineyards.

Genetic Diversity of Nine Non-Recombinant Potato virus Y Isolates From Three Biological Strain Groups: Historical and Geographical Insights

Potato virus Y (PVY) isolates from potato currently exist as a complex of six biologically defined strain groups all containing nonrecombinant isolates and at least 14 recombinant minor phylogroups. Recent studies on eight historical UK potato PVY isolates preserved since 1984 found only nonrecombinants. Here, four of five PVY isolates from cultivated potato or wild Solanum spp. collected recently in Australia, Mexico, and the U.S.A. were typed by inoculation to tobacco plants and/or serological testing using monoclonal antibodies. Next, these five modern isolates and four additional historical UK isolates belonging to biological strain groups PVYC, PVYZ, or PVYN obtained from cultivated potato in 1943 to 1984 were sequenced. None of the nine complete PVY genomes obtained were recombinants. Phylogenetic analysis revealed that the four historical UK isolates were in minor phylogroups PVYC1 (YC-R), PVYO-O (YZ-CM1), PVYNA-N (YN-M), or PVYEu-N (YN-RM), Australian isolate YO-BL2 was in minor phylogroup PVYO-O5, and both Mexican isolate YN-Mex43 and U.S.A. isolates YN-MT12_Oth288, YN-MT12_Oth295, and YN-WWAA150131G42 were in minor phylogroup PVYEu-N. When combined, these new findings and those from the eight historical UK isolates sequenced earlier provide important historical insights concerning the diversity of early PVY populations in Europe and the appearance of recombinants in that part of the world. They and four recent Australian isolates sequenced earlier also provide geographical insights about the geographical distribution and diversity of PVY populations in Australia and North America.

Genome Sequence and Phylogeny of a Bean Yellow Mosaic Virus Isolate Obtained from a 14-Year-Old Australian Lentil Sample

Using RNA strand-specific sequencing followed by de novo assembly, a Bean yellow mosaic virus (BYMV) genome was obtained from a lentil sample (Aus14BY) collected in Victoria, Australia, in 2005. When compared with 51 BYMV genomes, it closely resembled the Western Australian isolate PN83A (Lupinus angustifolius), with 98.4% nucleotide identity.

De Novo Genome Assembly and Comparative Genomics of the Barley Leaf Rust Pathogen Puccinia hordei Identifies Candidates for Three Avirulence Genes

Puccinia hordei (Ph) is a damaging pathogen of barley throughout the world. Despite its importance, almost nothing is known about the genomics of this pathogen, and a reference genome is lacking. In this study, the first reference genome was assembled for an Australian isolate of Ph (“Ph560”) using long-read SMRT sequencing. A total of 838 contigs were assembled, with a total size of 207 Mbp. This included both haplotype collapsed and separated regions, consistent with an estimated haploid genome size of about 150Mbp. An annotation pipeline that combined RNA-Seq of Ph-infected host tissues and homology to proteins from four other Puccinia species predicted 25,543 gene models of which 1,450 genes were classified as encoding secreted proteins based on the prediction of a signal peptide and no transmembrane domain. Genome resequencing using short-read technology was conducted for four additional Australian strains, Ph612, Ph626, Ph608 and Ph584, which are considered to be simple mutational derivatives of Ph560 with added virulence to one or two of three barley leaf rust resistance genes (viz. Rph3, Rph13 and Rph19). To identify candidate genes for the corresponding avirulence genes AvrRph3, AvrRph13 and AvrRph19, genetic variation in predicted secreted protein genes between the strains was correlated to the virulence profiles of each, identifying 35, 29 and 46 candidates for AvrRph13, AvrRph3 and AvrRph19, respectively. The identification of these candidate genes provides a strong foundation for future efforts to isolate these three avirulence genes, investigate their biological properties, and develop new diagnostic tests for monitoring pathogen virulence.

Complete Nucleotide Sequence of Australian Tomato spotted wilt virus Isolate TSWV-QLD2

ABSTRACT The complete nucleotide (nt) sequence of an Australian isolate of Tomato spotted wilt virus was determined by deep RNA sequencing and deep small RNA sequencing. The tripartite genome consists of an 8,914-nt L segment, a 4,851-nt M segment, and a 2,987-nt S segment.