Occurrence of Fusarium Wilt on Canola Caused by Fusarium oxysporum f. sp. conglutinans in Argentina

Canola (Brassica napus) is a developing oleaginous crop grown commercially in Argentina, primarily in the southeastern region of Buenos Aires Province. Since 2002, plants exhibiting symptoms of wilt and xylem discoloration were observed in canola plants in experimental field plots located at the University of Buenos Aires, Buenos Aires, Argentina. Average disease incidence in 5- to 6-month-old canola cultivars developed in different countries was 18% (range = 9 to 27%). Disease symptoms that included yellowing, wilting, stunting, and necrosis of leaf tissue and suppressed root development appeared in irregular-shaped patches following the rows of plants. The first symptom observed was leaf yellowing followed by an irregular, brown necrosis of the leaf margins. Lesions coalesced to form large necrotic areas that led to severe defoliation beginning with the lower leaves. As the disease developed, a pale brown discoloration girdled the stems that progressed from the basal tissues to the apex. Affected plants were stunted and had small pods with no seeds. Diseased plants eventually collapsed and died. From June to July 2003, six samples consisting of five affected plants per sample were randomly collected from experimental field plots. Pieces (1 cm long) of disease basal stem tissue were thoroughly washed, surface sterilized in 1% sodium hypochlorite for 1 min, rinsed in sterile distilled water, blotted dry on sterile Whatman's filter paper, and incubated on potato dextrose agar in the dark at 26°C for 10 days. Ten resulting colonies were examined microscopically and identified as Fusarium oxysporum Schlechtend.:Fr. f. sp. conglutinans (Wollenweb.) W.C. Snyder & H.N.Hans. (3). Pathogenicity tests for three single-spore isolates of the fungus were performed on 6-week-old canola plants of cvs. Impulse, Master, Mistral, Monty, Rivette, and Trooper. Koch's postulates were completed for each isolate by dipping the roots of seedlings in a conidial suspension (2 times; 105 conidia per ml) for 15 min. Plants were repotted in a sterilized soil mix (soil/sand, 2:1). The experiment, which included five inoculated plants and three noninoculated (roots dipped in sterile distilled water) control plants for each cultivar, was conducted in a greenhouse at 23 to 25°C and 75% relative humidity with no supplemental light. Characteristic symptoms, identical to the original observations, developed within 14 days after inoculation on 100% of the inoculated plants for all three isolates. The pathogen was successfully reisolated from internal diseased stem tissue in all instances. Symptoms included stunted seedlings, leaf necrosis, and external stem discoloration. None of the control plants developed disease. The experiment was repeated once with similar results. F. oxysporum f. sp. conglutinans, which has been reported to cause disease in canola in Canada (1) and the United States (2), represents a serious threat to the main canola cultivars grown in Argentina. To our knowledge, this is the first report of canola wilt incited by F. oxysporum f. sp. conglutinans in Argentina. References: (1) D. Bernard et al. Can. Plant Dis. Surv. 81:102, 2001. (2) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St. Paul, MN, 1989. (3) P. E. Nelson et al. Fusarium species. An Illustrated Manual for Identification. Pennsylvania State University Press. University Park, PA, 1983.

Download Full-text

Occurrence of Charcoal Rot Caused by Macrophomina phaseolina on Canola in Argentina

Plant Disease ◽

10.1094/pd-90-0524a ◽

2006 ◽

Vol 90 (4) ◽

pp. 524-524 ◽

Cited By ~ 11

Author(s):

S. A. Gaetán ◽

L. Fernandez ◽

M. Madia

Keyword(s):

United States ◽

Buenos Aires ◽

Vascular Tissue ◽

Disease Incidence ◽

Pathogenic Fungi ◽

Macrophomina Phaseolina ◽

The United States ◽

Buenos Aires Province ◽

Charcoal Rot ◽

Experimental Plots

Canola (Brassica napus) is an important oleaginous crop in Argentina. Approximately 16,000 ha are grown commercially in the southern region of Buenos Aires Province. In 2003, typical symptoms and signs of charcoal rot were observed on canola plants in experimental plots located at the School of Agricultural Sciences, University of Buenos Aires in Buenos Aires. Average disease incidence across three 5- to 6-month-old plants (cvs. Monty, Rivette, and Trooper) was 12% (range = 7 to 17%). Affected plants appeared in patches following the rows at pod-filling stage. Symptoms included wilted foliage, premature senescence, and death of plants. Black, spherical microsclerotia 78 to 95 μm in diameter were present in vascular tissue of basal stems and taproots. The affected plants were stunted and had unfilled pods. In advanced phases of the disease, areas of silver gray-to-black discoloration were observed in the stem cortex; many plants were killed during late-grain fill, and plants could be pulled easily from the ground because basal stems were shredded. Four samples consisting of five symptomatic plants per sample were randomly collected from experimental plots. Pieces (1-cm long) taken from taproots and basal stems of diseased plants were surface sterilized with 1% NaOCl for 2 min and then placed on potato dextrose agar (PDA). Plates were incubated in the dark at 26°C for 4 days and then exposed to 12-h NUV light/12-h dark for 6 days. Five resulting isolates were identified as Macrophomina phaseolina (Tassi) Goidanich (1) based on the gray color of the colony and the presence of microsclerotia 71 to 94 μm in diameter. Two colonies developed globose pycnidia with one-celled, hyaline, and elliptic conidia. Pathogenicity tests were conducted using four inoculated and three non-inoculated control plants potted in a sterilized soil mix (soil/sand, 3:1) in a greenhouse at 25°C and 75% relative humidity with no supplemental light. Crown inoculations were carried out by placing a disk taken from an actively growing culture of M. phaseolina into wounds made with a sterile scalpel. Control plants received disks of sterile PDA. Inoculated and control plants were covered with polyethylene bags for 48 h after inoculation. Three isolates caused disease on 7-week-old canola plants (cvs. Master, Mistral, Rivette, and Trooper). Characteristic symptoms similar to the original observations developed for all three isolates within 21 days after inoculation on 80% of inoculated plants. The pathogen was successfully reisolated from diseased stem tissue in all instances. Symptoms included leaf necrosis, stunting, decay and collapse of seedlings, and plant death. Control plants remained asymptomatic. The experiment was repeated once with similar results. To our knowledge, this is the first report of the occurrence of M. phaseolina causing charcoal rot on canola in Argentina. This pathogen has been previously reported in the United States (2,3). The results demonstrate the potential importance of this pathogen in Argentina, since two commercial cultivars (Master and Mistral) were apparently susceptible to M. phaseolina. More studies are needed to determine the presence of charcoal rot in canola-growing areas of Argentina. References: (1) Anonymous. Macrophomina phaseolina. No. 275 in: Descriptions of Plant Pathogenic Fungi and Bacteria. CMI, Kew, Surrey, UK, 1970. (2) R. E. Baird et al. Plant Dis. 78:316, 1994. (3) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St. Paul, MN, 1989.

Download Full-text

Occurrence of Stem Rot on Canola Caused by Sclerotinia sclerotiorum in Argentina

Plant Disease ◽

10.1094/pd-89-0530b ◽

2005 ◽

Vol 89 (5) ◽

pp. 530-530 ◽

Cited By ~ 1

Author(s):

S. Gaetán ◽

M. Madia

Keyword(s):

United States ◽

Sclerotinia Sclerotiorum ◽

Buenos Aires ◽

Disease Incidence ◽

Fungal Growth ◽

Ground Level ◽

The United States ◽

Stem Rot ◽

Buenos Aires Province ◽

Rot Disease

Canola (Brassica napus) was introduced as an alternative crop for wheat in Argentina. During 2003, typical symptoms of stem rot disease were observed on canola plants in two commercial fields located at Bragado, in northern Buenos Aires Province in Argentina. Average disease incidence across four canola cultivars was 21% (range = 13 to 29%). Symptoms included chlorosis and wilting of foliage and necrosis of basal stems. The disease appeared singly or in patches consisting of 4- to 5-month-old plants. The first visible symptom noticed was chlorosis and wilting of the foliage beginning from the basal leaves. Infection of the main stem at ground level typically was followed by a grayish white discoloration that progressed above the soil line to the apex. In advanced stages of the disease, stems and branches became bleached and eventually died. Black and irregularly shaped sclerotia (average size 5.5 × 2.8 mm) inside necrotic stem tissue were the typical signs of the pathogen. From September to October 2003, four samples consisting of six affected plants per sample were arbitrarily collected from two commercial fields located at Bragado. Sclerotia were taken from diseased stems, dipped in 70% ethanol, surface sterilized with 1% sodium hypochlorite for 1 min, and rinsed in sterile water. Each sclerotium was blotted dry on sterile Whatman's filter paper and placed on potato dextrose agar. Plates were incubated in the dark at 25°C for 2 to 3 days, followed by incubation under 12-h NUV light/12-h dark for 6 to 8 days. Six resulting colonies were identified as Sclerotinia sclerotiorum (Lib.) de Bary on the basis of taxonomic characteristics of the plant pathogenic species of Sclerotinia (3). Koch's postulates for three fungal isolates from infected plants were carried out on 6-week-old canola plants (cvs. Eclipse, Impulse, Master, and Mistral) by placing a colonized agar disk into wounds made in the basal stem region with a sterile scalpel. Pathogenicity tests, which included five inoculated and three control plants potted in a sterilized soil mix (soil/sand, 3:1), were conducted in a greenhouse at 23 to 26°C and 75% relative humidity with no supplemental light. Characteristic symptoms identical to the original observations developed within 12 days after inoculation on 100% of the inoculated plants for three isolates. Symptoms included wilted foliage, collapsed plants, and plant death. White mycelium and sclerotia developed on infected tissues, and the pathogen was successfully reisolated from symptomatic plants in all instances. Control plants, which were treated similarly except that the agar disk did not contain fungal growth, remained healthy. The experiment was repeated, and the results were identical to the first inoculations. Canola stem rot disease incited by S. sclerotiorum was first reported in Argentina during 1995 at experimental field plots in Buenos Aires. S. sclerotiorum, which has been reported to cause disease in canola in Canada (2) and the United States (1,4), currently represents a serious problem to the main canola cultivars grown in Argentina. To our knowledge, this is the first report of the occurrence of S. sclerotiorum causing a high incidence of stem rot in commercial crops of canola in Argentina. References: (1) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St. Paul, MN, 1989. (2) L. B. Jamaux et al. Plant Pathol. 44:22, 1995. (3) L. M. Kohn. Phytopathology 69:881, 1979. (4) D. V. Phillips et al. Phytopathology 92:785, 2002.

Download Full-text

First Report of Anthracnose Caused by Elsinoe ampelina on Muscadine Grapes (Vitis rotundifolia) in Northern Florida

Plant Disease ◽

10.1094/pdis-91-7-0905b ◽

2007 ◽

Vol 91 (7) ◽

pp. 905-905 ◽

Cited By ~ 7

Author(s):

H. K. Yun ◽

C. Louime ◽

J. Lu

Keyword(s):

United States ◽

Pcr Primers ◽

The United States ◽

Causal Agent ◽

Distilled Water ◽

Conidial Suspension ◽

Single Spore ◽

First Report ◽

Elsinoe Ampelina ◽

Muscadine Grapes

Anthracnose of grapes is an economically devastating disease caused by Elsinoe ampelina (2). Warm, humid weather favors disease development, and therefore in the United States, it is generally restricted to grape-growing areas east of the Rocky Mountains. Vitis vinifera is highly susceptible to the disease, which is one of the principal factors preventing the development of an industry with this high-quality grape in the southeastern United States. Growers in this area produce local species-such as muscadine grapes (V. rotundifolia Michx.) and hybrids. Muscadine grapes are known for their resistance or “immunity” to many diseases found in bunch (Euvitis spp. Planch.) grape species (1). As yet, there has been no formal report of anthracnose or its causal agent on muscadine grapes. E. ampelina was detected on muscadine leaves for the first time in the experimental vineyard at the Center for Viticulture and Small Fruit Research during the summer of 2006. Approximately 40% of the 52 muscadine cultivars in the collection showed circular or irregular black spots typical of anthracnose mainly on young leaves and tendrils. However, no symptoms were observed on fruits, shoot tips, or any other plant part. To confirm the causal agent, infected leaves were surface sterilized with 75% ethanol, dipped in 2% sodium hypochlorite for 15 s, rinsed in distilled water, dissected into small 0.5-cm leaf discs, and plated on potato dextrose agar (PDA) and incubated at 28°C. Single-spore isolates were grown on PDA. Colonies were slow growing and appeared as dark red mounds with some mycelia. Conidia were cylindrical and hyaline with pointed ends consistent with previous reports for E. ampelina (2). The identity was also confirmed by using the following PCR primers to the 18S RNA: left primer; TCCGTAGGTGAACCTGCGGA and right primer; TCCTACCTGAT CCGAGGTCA designed on the basis of the alignment of E. ampelina sequences deposited in NCBI database. To fulfill Koch's postulates, symptoms were reproduced by artificial inoculation onto young muscadines (cv. Carlos) and bunch (cv. Cabernet Sauvignon) grapevines. A conidial suspension was prepared from single-conidial cultures, and three experimental vines of each species were sprayed with 0.5 ml of suspension (2 × 105 conidia per ml), whereas three control plants were sprayed with distilled water. The plants were incubated in a moist chamber at 28°C with 16 h of light. The first typical symptoms appeared on V. vinifera 4 days postinoculation and on the muscadines 6 days postinoculation. To our knowledge, this is the first report confirming anthracnose disease on muscadine grapes. References: (1) J. Lu et al. Acta Hortic. 528:479, 2000. (2) R. C. Pearson and A. C. Gohen. Anthracnose. Pages 18–19 in: Compendium of Grape Diseases. The American Phytopathological Society. St. Paul, MN, 1994.

Download Full-text

First Report of Basal Stem Rot of Apple Cactus (Cereus peruvianus monstruosus) Caused by Fusarium oxysporum in Italy

Plant Disease ◽

10.1094/pdis-03-11-0216 ◽

2011 ◽

Vol 95 (7) ◽

pp. 877-877

Author(s):

A. Garibaldi ◽

P. Pensa ◽

D. Bertetti ◽

A. Poli ◽

M. L. Gullino

Keyword(s):

United States ◽

Fusarium Oxysporum ◽

The United States ◽

Stem Rot ◽

Fluorescent Light ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Single Spore ◽

Basal Stem Rot ◽

First Report

During the summer of 2010, 20% of 7,000 4-month-old plants of apple cactus (Cereus peruvianus monstruosus) showed symptoms of a basal stem rot in a commercial nursery located in Liguria (northern Italy). Affected plants showed yellow orange-to-pale brown color from the crown level to the stem apex and a water-soaked rot was observed on the stem starting from the base. Brown discoloration was observed in the vascular system. Eventually stems bent, plants collapsed and died, and affected tissues dried out. A Fusarium sp. was consistently and readily isolated from symptomatic tissue on Komada selective medium. Isolates were purified and subcultured on potato dextrose agar (PDA). Single-spore cultures on PDA, Spezieller Nährstoffarmer agar (SNA) (3), and carnation leaf-piece agar (CLA) (2) were incubated at 26 ± 1°C (12-h fluorescent light, 12-h dark). On PDA, cultures produced a thick growth of white-to-pink mycelium and pale pink pigments in the agar. On SNA, cultures produced short monophialides with unicellular, ovoid-elliptical microconidia measuring 4.3 to 8.2 × 2.3 to 3.8 (average 6.0 × 2.8) μm. Chlamydospores were abundant, single or paired, terminal and intercalary, rough walled, and 6 to 8 μm in diameter. On CLA, cultures produced orange sporodochia with macroconidia that were 3 to 4 septate, nearly straight with a foot-shaped basal cell and a short apical cell, and measured 31.1 to 51.5 × 4.4 to 3.5 (average 43.2 × 3.8) μm. Such characteristics are typical of Fusarium oxysporum (3). Amplification of the ITS (internal transcribed spacer) of the rDNA using primers ITS1/ITS4 (4) yielded a 498-bp band. Sequencing and BLASTn analysis of this band showed an E-value of 0.0 with F. oxysporum. The nucleotide sequence has been assigned GenBank Accession No. JF422071. To confirm pathogenicity, five 6-month-old healthy plants of C. peruvianus monstruosus were inoculated by dipping roots in a conidial suspension (2.4 × 106 CFU/ml) of F. oxysporum isolated from affected plants. Inoculum was obtained from pure cultures of three single-spore isolates grown for 10 days on casein hydrolysate liquid medium. Roots were not wounded before the inoculation. Plants were transplanted into pots filled with steam-sterilized substrate (sphagnum peat/perlite/pine bark/clay 50:20:20:10). Five noninoculated plants served as a control. Plants were placed in a climatic chamber at 25 ± 1°C (12-h fluorescent light, 12 h-dark). Basal stem rot and vascular discoloration in the crown and stem developed within 30 days on each inoculated plant. Noninoculated plants remained healthy. F. oxysporum was consistently isolated from symptomatic plants. The pathogenicity test was conducted twice. F. oxysporum has been reported on Cereus spp. in the United States (1). To our knowledge, this is the first report of F. oxysporum on C. peruvianus monstruosus in Italy as well as in Europe. Currently, this disease is present in a few nurseries in Liguria. References: (1) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St Paul, MN, 1989. (2) N. L. Fisher et al. Phytopathology 72:151, 1982. (3) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell, Ames, IA, 2006. (4) T. J. White et al. PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, San Diego, 1990.

Download Full-text

First Report of Fusarium Wilt of Strawberry Caused by Fusarium oxysporum in South Carolina

Plant Disease ◽

10.1094/pdis-02-12-0164-pdn ◽

2012 ◽

Vol 96 (6) ◽

pp. 911-911 ◽

Cited By ~ 4

Author(s):

M. Williamson ◽

D. Fernández-Ortuño ◽

G. Schnabel

Keyword(s):

South Carolina ◽

Fusarium Oxysporum ◽

Fusarium Wilt ◽

The United States ◽

Crown Rot ◽

Distilled Water ◽

Conidial Suspension ◽

Internal Transcribed Spacer Region ◽

Clemson University ◽

First Report

During October 2011, wilted and dead strawberry (Fragaria × ananassa cv. Albion) plants from two commercial fields in South Carolina were sent to the Clemson University Plant Problem Clinic in Pendleton, SC. Symptoms consisted of wilting and chlorosis of foliage, scorch and dieback of older leaves, and stunting of plants. Internal vascular and cortical tissues of plant crowns showed a distinct reddish brown discoloration. To isolate the causal agent, necrotic crown tissue selected from two symptomatic plants from one location and four symptomatic plants from the other were placed on acidified potato dextrose agar (APDA) and on quarter strength acidified PDA (QPDA). Colonies with light purple mycelia and beige or orange reverse colony colors developed on APDA after 5 days of incubation at 25°C. Colonies on QPDA were light purple. Morphology, growth, and development of macroconidia and microconida were consistent with descriptions of Fusarium oxysporum Schlechtend emend. Snyder & Hansen (3). Genomic DNA from 3 isolates (11-1246A, 11-1247A, and 11-1247B) was extracted and purified according to Chi et al. (1). The internal transcribed spacer region comprising ITS1, ITS2, and 5.8S rRNA was amplified by primers ITS1 and ITS4 (4). The sequence comparison revealed a 100% match with F. oxysporum sequences in GenBank. To confirm the pathogenicity of the fungus, roots of 15 strawberry plants (cv. Albion) were cut and then five plants were soaked for 10 min in either 500 ml of conidial suspension (104 conidia/ml) of one of the two isolates or in sterile distilled water. All were then potted in 15-cm pots with artificial peat-based soil mix and maintained at 25°C in the greenhouse. After 6 weeks, all plants inoculated with isolates 1247A and B were stunted and developed wilt symptoms similar to those observed in the field, while the control plants remained healthy. Support roots on all affected plants were soft and flaccid and new feeder roots had brown lesions. Crowns of three plants inoculated with isolate 1247A and four plants inoculated with 1247B showed vascular discoloration. To reisolate, crowns were plated as above and roots were surface sterilized in 10% bleach for 1 min and rinsed in sterile distilled water prior to plating on QPDA. F. oxysporum was isolated at frequencies of 70 and 100% from crowns and 100% from roots of all inoculated plants. To our knowledge, this is the first report of the occurrence of Fusarium wilt caused by F. oxysporum on strawberry plants in South Carolina. The presence of Fusarium wilt in South Carolina should alert growers, county agents, and specialists to properly identify Fusarium wilt symptoms, which may be confused with Anthracnose or Phytophthora crown rot of strawberry. The disease has been reported previously in other countries including the United States (2). References: (1) M. H. Chi et al. Plant Pathol. J. 25:108, 2009. (2) S. T. Koike et al. Plant Dis. 93:1077, 2009. (3) W. C. Snyder and H. N. Hansen. Am. J. Bot. 27:64, 1940. (4) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Application. Academic Press, NY, 1993.

Download Full-text

Occurrence of Fusarium Wilt Caused by Fusarium oxysporum on Common Sage in Argentina

Plant Disease ◽

10.1094/pd-90-0833a ◽

2006 ◽

Vol 90 (6) ◽

pp. 833-833

Author(s):

S. A. Gaetán ◽

M. Madia

Keyword(s):

Fusarium Oxysporum ◽

Fusarium Wilt ◽

Buenos Aires ◽

Disease Incidence ◽

Wilt Disease ◽

Buenos Aires Province ◽

Conidial Suspension ◽

Koch’S Postulates ◽

Koch's Postulates ◽

Open Fields

Common sage (Salvia officinalis L.) is being increasingly grown commercially in Argentina for its medicinal properties and as ornamental plants. Although the crop can be produced in greenhouses, most of the crop production is in open fields in Buenos Aires, Córdoba, and Santa Fe provinces. During the last 3 years, common sage has repeatedly shown decline symptoms in several production fields in the southern region of Buenos Aires Province. In the spring of 2004, a serious common sage wilt disease developed under field conditions resulting in as much as 15% loss of plants. The disease, affecting 10-month-old common sage plants, was observed in this region in two commercial fields located at Sierra de la Ventana. Affected plants appeared in irregular patches throughout the rows. Diseased plants exhibited symptoms of chlorosis, wilting, and death. Lower leaves on wilted plants showed gradual yellowing, apical necrosis, and premature defoliation. At advanced stages of the disease, irregular, brown, necrotic areas on the leaves occurred. The necroses on affected leaf parts occasionally expanded and coalesced to form large necrotic lesions that turned the entire leaf brown. Other symptoms included stunting, black streaking on stems, and rotting of roots. Longitudinal sections through stems and roots showed severely necrotic vascular tissue. Pieces taken from stems and roots of diseased plants were plated on potato dextrose agar after surface sterilization with 1% NaOCl for 3 min. The plates were incubated in the dark for 2 days and then kept under 12-h alternations of NUV light/dark for 8 days. On the basis of morphological and cultural characteristics, two fungal colonies were identified as Fusarium oxysporum Schlechtend.:Fr. (1) and used in the following studies. Pathogenicity tests were carried out on 4-month-old healthy common sage plants. Koch's postulates were completed for two isolates by dipping the roots of seedlings in a conidial suspension (2 × 105 conidia/ml) of a single-spore isolate for 25 min. Plants were repotted in a sterilized soil mix (soil/sand, 2:1). The experiment was conducted in a greenhouse at 23 to 25°C and 75% relative humidity with no supplemental light. Within 14 days, all inoculated plants showed typical Fusarium wilt symptoms similar to that observed in the field. Plants exhibited yellowing followed by wilting of foliage, rotting of roots, brown vascular discoloration, and then eventually collapsed. Four weeks postinoculation, 90% of the plants were dead. No symptoms were observed on control plants dipped only in distilled water. The fungus was successfully reisolated from the symptomatic plants, fulfilling Koch's postulates in all instances. F. oxysporum had been previously reported in 1995 to cause a wilt disease in clary sage (Salvia sclarea L.) fields in North Carolina; the disease was detected at seedling stage, reducing plant stand as much as 40 to 50% (2). In Argentina, the pathogen that caused wilt symptoms on common sage had also been observed in 2002 in greenhouses on the outskirts of Buenos Aires, although the disease incidence was low. At this time, the disease could become a limiting factor in common sage production and further information regarding this pathogen within the region is needed. To our knowledge, this is the first report of the occurrence of Fusarium wilt caused by F. oxysporum on commercial S. officinalis in open fields in Argentina. References: (1) P. E. Nelson et al. Fusarium species. An Illustrated Manual for Identification. Pennsylvania State University Press. University Park, PA, 1983. (2) V. P. Subbiah et al. Plant Dis. 80:1080, 1996.

Download Full-text

International Convention For The Protection Of Trade MarksSigned at the Fourth International American Conference, Buenos Aires, August 20, 1910; ratified by the United States May 1, 1911; proclaimed September 16, 1916

The American Journal of International Law ◽

10.2307/2212487 ◽

1917 ◽

Vol 11 (S1) ◽

pp. 13-21

Keyword(s):

United States ◽

Buenos Aires ◽

The United States ◽

International Convention

Download Full-text

First Report of Seedborne Fusarium thapsinum and its Pathogenicity on Soybean (Glycine max) in the United States

Plant Disease ◽

10.1094/pdis-08-14-0806-pdn ◽

2014 ◽

Vol 98 (12) ◽

pp. 1745-1745 ◽

Cited By ~ 2

Author(s):

R. Pedrozo ◽

C. R. Little

Keyword(s):

United States ◽

The United States ◽

Soybean Plant ◽

Sodium Hypochlorite Solution ◽

Distilled Water ◽

Seedling Mortality ◽

Beta Tubulin ◽

First Report ◽

Significant Difference ◽

Germinated Seeds

A three-year survey from 2010 to 2012 was conducted in Kansas to investigate the identity and diversity of seedborne Fusarium spp. in soybean. A total of 408 soybean seed samples from 10 counties were tested. One hundred arbitrarily selected seeds from each sample were surface-sterilized for 10 min in a 1% sodium hypochlorite solution to avoid contaminants and promote the isolation of internal fusaria. Seeds were rinsed with sterile distilled water and dried overnight at room temperature (RT). Surface-sterilized seeds were plated on modified Nash-Snyder medium and incubated at 23 ± 2°C for 7 days. Fusarium isolates were single-spored and identified by morphological characteristics on carnation leaf agar (CLA) and potato dextrose agar (PDA) (3). From 276 seedborne Fusarium isolates, six were identified as F. thapsinum (2). On CLA, F. thapsinum isolates produced abundant mycelium and numerous chains of non-septate microconidia produced from monophialides. Microconidia were club-shaped and some were napiform. No chlamysdospores were found. On PDA, three of the isolates presented characteristic dark yellow pigmentation and three were light violet. Confirmation of the isolates to species was based on sequencing of an elongation factor gene (EF1-α) segment using primers EF1 and EF2 and the beta-tubulin gene using primers Beta1 and Beta2 (1). Sequence results (~680 bp, EF primers; ~600 bp, beta-tubulin primers) were confirmed by using the FUSARIUM-ID database (1). All isolates matched F. thapsinum for both genes sequenced (Accession No. FD01177) at 99% identity. Koch's postulates were completed for two isolates of F. thapsinum under greenhouse conditions. Soybean seeds (Asgrow AG3039) were imbibed with 2.5 × 105 conidia ml−1 for 48 h. After inoculation, seeds were dried for 48 h at RT. One isolate each of F. equiseti and F. oxysporum were used as the non-pathogenic and pathogenic inoculation controls, respectively. In addition, non-inoculated seeds and seeds imbibed in sterile distilled water (mock) were also used. Twenty-five seeds from each treatment were planted in pots (500 ml) with autoclaved soil and vermiculite (1:1). The experiment was a completely randomized design with three replicates (pots) per isolate. The entire experiment was repeated three times. After 21 days, aggressiveness of both F. thapsinum isolates was assessed using initial stand (%), final stand (%), and seed mortality (% of non-germinated seeds). Both seedborne F. thapsinum isolates caused reduced emergence and final stand, and increased seedling mortality when compared to the non-inoculated and F. equiseti controls (P< 0.0001). No significant difference was observed between F. thapsinum isolates and F. oxysporum. F. thapsinum isolates were re-isolated from wilted seedlings and non-germinated seeds, but not from the control treatments. Typically, F. thapsinum is considered a pathogen of sorghum, but it has also been recovered from bananas, peanuts, maize, and native grasses (3). However, its presence on soybean plant tissues and its pathogenicity has never been reported. To our knowledge, this is the first report of seedborne F. thapsinum and its pathogenicity on soybean in the United States. References: (1) D. M. Geiser et al. Eur. J. Plant Pathol. 110:473, 2004. (2) C. J. R. Klittich et al. Mycologia 89:644, 1997. (3) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Publishing, Oxford, UK, 2006.

Download Full-text