Ppe.XapF: High Throughput KASP Assays to Identify Fruit Response to Xanthomonas arboricola pv. pruni (Xap) in Peach

Abstract Bacterial spot, caused by Xanthomonas arboricola pv. pruni (Xap), is a serious peach disease with symptoms that traverse severe defoliation and black surface pitting, cracking or blemishes on peach fruit with global economic impacts. A management option for control and meeting consumer demand for chemical-free, environmentally friendly fruit production is the development of resistant or tolerant cultivars. We developed simple, accurate, and efficient DNA assays (Ppe.XapF) based on SNP genotyping with KASP technology to quickly test for bacterial spot resistance alleles in peach fruit that allows breeders to cull seedlings at the greenhouse stage. The objective of this research was to validate newly developed DNA tests that target the two major QTLs for fruit resistance in peach with diagnostic utility in predicting fruit response to bacterial spot infection. Our study confirms that only two Ppe.XapF DNA tests, Ppe.XapF1-1 and Ppe.XapF6-2, are needed to distinguish between susceptible and resistant alleles. Use of these efficient and accurate Ppe.XapF KASP tests resulted in 44% reduction in seedling planting rate in the Clemson University peach breeding program.

Download Full-text

Ppe.XapF: High Throughput KASP Assays to Identify Fruit Response to Xanthomonas Arboricola pv. pruni (Xap) in Peach

10.21203/rs.3.rs-452756/v1 ◽

2021 ◽

Author(s):

Margaret B. Fleming ◽

Texanna Miller ◽

Wanfang Fu ◽

Zhigang Li ◽

Ksenija Gasic ◽

...

Keyword(s):

Fruit Production ◽

Diagnostic Utility ◽

Management Option ◽

Bacterial Spot ◽

Peach Fruit ◽

Clemson University ◽

Peach Breeding ◽

Black Surface ◽

Xanthomonas Arboricola ◽

Bacterial Spot Resistance

Abstract Background Bacterial spot, caused by Xanthomonas arboricola pv. pruni (Xap), is a serious peach disease with symptoms that traverse severe defoliation and black surface pitting, cracking or blemishes on peach fruit with global economic impacts. A management option for control and meeting consumer demand for chemical-free, environmentally friendly fruit production is the development of resistant or tolerant cultivars. Results We developed simple, accurate, and efficient Ppe.XapF DNA tests based on SNP genotyping with KASP technology to quickly test for bacterial spot resistance alleles in peach fruit and cull at the greenhouse stage. The objective of this research was to validate newly developed Ppe.XapF DNA tests that target the two major QTLs for fruit resistance in peach with diagnostic utility in predicting fruit response to bacterial spot infection. Conclusion Our study confirms that only two Ppe.XapF DNA tests, Ppe.XapF1-1 and Ppe.XapF6-2, are needed to distinguish between susceptible and resistant haplotypes. Use of these efficient and accurate Ppe.XapF KASP tests resulted in 44% reduction in seedling planting rate in the Clemson University peach breeding program.

Download Full-text

A subunit gene of sucrose non-fermenting 1 related kinase, PpSnRK1γ, confers flat fruit abortion in peach by regulating sugar and starch metabolism

10.21203/rs.3.rs-117876/v1 ◽

2020 ◽

Author(s):

Jian Guo ◽

Ke Cao ◽

Jia-long Yao ◽

Cecilia Deng ◽

Yong Li ◽

...

Keyword(s):

Candidate Gene ◽

Fruit Production ◽

Fruit Shape ◽

Limiting Factor ◽

Peach Fruit ◽

Physiological Factors ◽

Peach Breeding ◽

A Subunit ◽

Fruit Abortion ◽

Transient Overexpression

Abstract Background: Fruit abortion is a major limiting factor for fruit production. In flat peach, fruit abortion is present in the whole tree of some accessions during early fruit development. However, the physiological factors and genetic mechanism underlying flat fruit abortion remain largely elusive. Results: In this study, we have revealed that the fertilization process was accomplished and the reduction of sucrose and starch contents might result in flat fruit abortion. By combining association and gene expression analysis, a key candidate gene, PpSnRK1γ, was identified. A 1.67-Mb inversion co-segregated with flat fruit shape altered the promoter activity of PpSnRK1γ, resulting in much lower expression in aborting flat peach. Ectopic transformation in tomato and transient overexpression in peach fruit have shown that PpSnRK1γ could increase sugar and starch contents. Comparative transcriptome analysis further confirmed that PpSnRK1γ participated in carbohydrate metabolism. Subcellular localization found that PpSnRK1γ was located in nucleus. Conclusions: This study clarified the reason for flat fruit abortion and identified a critical candidate gene, PpSnRK1γ, responsible for fruit abortion in peach. The results would provide great help in peach breeding and facilitate gene identification for fruit abortion in other plant species.

Download Full-text

Reduced expression of a subunit gene of sucrose non-fermenting 1 related kinase, PpSnRK1βγ, confers flat fruit abortion in peach by regulating sugar and starch metabolism

BMC Plant Biology ◽

10.1186/s12870-021-02850-9 ◽

2021 ◽

Vol 21 (1) ◽

Author(s):

Jian Guo ◽

Ke Cao ◽

Jia-Long Yao ◽

Cecilia Deng ◽

Yong Li ◽

...

Keyword(s):

Candidate Gene ◽

Fruit Production ◽

Fruit Shape ◽

Limiting Factor ◽

Peach Fruit ◽

Physiological Factors ◽

Peach Breeding ◽

A Subunit ◽

Fruit Abortion ◽

Transient Overexpression

Abstract Background Fruit abortion is a major limiting factor for fruit production. In flat peach, fruit abortion is present in the whole tree of some accessions during early fruit development. However, the physiological factors and genetic mechanism underlying flat fruit abortion remain largely elusive. Results In this study, we have revealed that the fertilization process was accomplished and the reduction of sucrose and starch contents might result in flat fruit abortion. By combining association and gene expression analysis, a key candidate gene, PpSnRK1βγ, was identified. A 1.67-Mb inversion co-segregated with flat fruit shape altered the promoter activity of PpSnRK1βγ, resulting in much lower expression in aborting flat peach. Ectopic transformation in tomato and transient overexpression in peach fruit have shown that PpSnRK1βγ could increase sugar and starch contents. Comparative transcriptome analysis further confirmed that PpSnRK1βγ participated in carbohydrate metabolism. Subcellular localization found that PpSnRK1βγ was located in nucleus. Conclusions This study provides a possible reason for flat fruit abortion and identified a critical candidate gene, PpSnRK1βγ, that might be responsible for flat fruit abortion in peach. The results will provide great help in peach breeding and facilitate gene identification for fruit abortion in other plant species.

Download Full-text

Protecting vegetable cultivars in Brazil: a chili pepper case-study research

Horticultura Brasileira ◽

10.1590/s0102-053620160000200003 ◽

2016 ◽

Vol 34 (2) ◽

pp. 161-167 ◽

Cited By ~ 1

Author(s):

Samy Pimenta ◽

Rosana Rodrigues ◽

Cláudia P Sudré ◽

João GT Moraes ◽

Cíntia S Bento ◽

...

Keyword(s):

Recombinant Inbred Lines ◽

Block Design ◽

Case Study Research ◽

Fruit Shape ◽

Bacterial Spot ◽

Randomized Block Design ◽

Dus Testing ◽

Bacterial Spot Resistance ◽

Test Requirements ◽

L1 And L2

ABSTRACT: In all countries, members of the UPOV (Union Internationale pour la Protection des Obtentions Végétales), of which Brazil is a signatory, to protect a new plant variety is necessary to carry out DUS (Distinctness, Uniformity and Stability) tests. DUS testing forCapsicum spp. is based on 48 descriptors, which involve qualitative and quantitative traits, observed from germination to fruit harvest. This paper describes the performance of DUS tests on lines of chili peppers, which are candidates for protection; we discuss the main aspects related to operational difficulties, the relevance of some descriptors for the protection process and highlight the importance of protecting new plant varieties as national intellectual property. Four C. annuum var.annuum recombinant inbred lines were tested. The Capsicum Breeding Program of the Universidade Estadual do Norte Fluminense Darcy Ribeiro developed the lines, which are resistant to bacterial spot. They were tested under greenhouse conditions from June to November 2013; and from January to July 2014 in Campos dos Goytacazes, Rio de Janeiro State, Brazil. The 'Jalapeño M' commercial genotype was used as control and treatments were arranged in a randomized block design with seven plants per plot with five replications. Besides the 48 descriptors, stipulated by legislation for Capsicum DUS testing, we included a descriptor for bacterial spot resistance. The descriptors that enabled distinction varied with each line. Although being distinctive for some descriptors, L1 and L2 lines were neither homogeneous nor stable. L6 and L8 recombined lines were characterized by homogeneity and stability. Fruit shape, capsaicin presence, number of days for flowering and bacterial spot resistance were descriptors that allowed for differentiation between treatments. In conclusion, the L6 and L8 recombined lines met the DUS test requirements; therefore, they may be subjected to the protection process with the Brazilian Ministry of Agriculture, Livestock and Food Supply.

Download Full-text

First Report of Bacterial Spot Caused by Xanthomonas arboricola pv. pruni on Japanese Plum in Taiwan

Plant Disease ◽

10.1094/pdis-11-12-1094-pdn ◽

2013 ◽

Vol 97 (6) ◽

pp. 835-835 ◽

Cited By ~ 4

Author(s):

Y. M. Shen ◽

T. C. Huang ◽

C. H. Chao ◽

H. L. Liu

Keyword(s):

First Record ◽

Tween 20 ◽

Post Inoculation ◽

Bacterial Spot ◽

Japanese Plum ◽

Specific Pcr ◽

Leaf Spots ◽

Plastic Bags ◽

Xanthomonas Arboricola ◽

Specific Pcr Assay

Prunus salicina Lindl., also known as Japanese plum, is a temperate-zone fruit tree grown in mountainous areas of Taiwan. The planted area in Taiwan is approximately 3,000 ha. In June 2011, more than 20% of plum fruits harvested in an orchard in Lishan (elevation about 2,000 m) showed black, mostly circular, sunken necrotic lesions. Leaves with a shot-hole appearance and cankered branches were found when investigating the orchard. Bacteria were isolated from symptomatic fruits, leaves, and branches. Isolation on nutrient agar detected colonies that were yellow, mucoid, gram-negative, Xanthomonas-like, and induced hypersensitive responses on tomatoes. Three voucher isolates, BCRC80476, BCRC80478, and BCRC80481, obtained from the fruit, leaf, and branch, respectively, were deposited in the Bioresource Collection and Research Center, Hsinchu, Taiwan. Molecular analyses were conducted for species identification. Sequences of the gyrB gene of the three voucher isolates (GenBank Accession Nos. KC202288, KC202289, and KC202287) were 100% identical to that of Xanthomonas arboricola pv. pruni pathotype strain ICMP51 (2). In addition, DNA fragments of the xopE3 gene (an X. arboricola pv. pruni specific T3E gene, approximately 381 bp) were PCR amplified using the primer pair fw-5′CCGACATTGCCGTCAGCGATCACG3′ and rv-5′AGCGTTCTTGGGTGTGTTGAGCATTTG3′ (1). The bacterial isolates were identified as X. arboricola pv. pruni on the basis of the colony characteristics, sequence homology, and the specific PCR assay. Pathogenicity was confirmed by inoculation of greenhouse-potted P. salicina plants with strains BCRC80476, BCRC80478, and BCRC80481 using bacterial suspensions (6.7 × 108 CFU per ml) in 0.01% Tween 20. Five plants were evenly sprayed with inoculum of each bacterial isolate and covered with plastic bags for 3 days. One week post inoculation, at an average temperature of 19°C, the 15 inoculated plants produced brown-purple spots delimited by a chlorotic margin on the leaves. Three weeks post inoculation, the necrotic leaf spots completely deteriorated, leaving a shot-hole appearance, and the branches showed lesions similar to those observed in the fields. The pathogen was reisolated from the symptomatic tissues, fulfilling Koch's postulates. Control plants sprayed with 0.01% Tween 20 remained symptomless. To our knowledge, this is the first record of X. arboricola pv. pruni causing bacterial spot on P. salicina in Taiwan. References: (1) A. Hajri et al. Appl. Environ. Microbiol. 78:371, 2012. (2) J. M. Young et al. Syst. Appl. Microbiol. 31:366, 2008.

Download Full-text

Development of gene-based markers for the Bs2 bacterial spot resistance gene for marker-assisted selection in pepper (Capsicum spp.)

Horticulture Environment and Biotechnology ◽

10.1007/s13580-011-0142-4 ◽

2011 ◽

Vol 52 (1) ◽

pp. 65-73 ◽

Cited By ~ 3

Author(s):

Hai Thi Hong Truong ◽

Ki-Taek Kim ◽

Su Kim ◽

Myoung-Cheol Cho ◽

Hyun-Ran Kim ◽

...

Keyword(s):

Resistance Gene ◽

Marker Assisted Selection ◽

Bacterial Spot ◽

Capsicum Spp ◽

Gene Based Markers ◽

Bacterial Spot Resistance

Download Full-text

Comparison of Resistant Cultivars for Management of Bacterial Spot in Peppers

HortTechnology ◽

10.21273/horttech.9.4.645 ◽

1999 ◽

Vol 9 (4) ◽

pp. 645-655

Author(s):

Brent Rowell ◽

R. Terry Jones ◽

William Nesmith ◽

John C. Snyder

Keyword(s):

Capsicum Annuum ◽

Xanthomonas Campestris ◽

Bell Pepper ◽

Bacterial Spot ◽

Eastern Kentucky ◽

Breeding Lines ◽

Resistant Cultivars ◽

Bacterial Spot Resistance ◽

Free Environment

Bacterial spot epidemics, caused by Xanthomonas campestris pv. vesicatoria (Doidge) Dye, continue to plague bell pepper (Capsicum annuum L.) growers in a number of southern and midwestern states. A 3-year study designed to compare cultivars and breeding lines under induced bacterial spot epidemic and bacterial spot-free conditions began soon after the first release of cultivars having the Bs2 gene for resistance to races 1 to 3 of the pathogen. Bacterial spot epidemics were created by transplanting `Merlin' plants (inoculated with races 1 to 3) into plots of each test cultivar at an isolated location in eastern Kentucky. Plots of the same trial entries at a second location were kept free of bacterial spot for 2 of the 3 years of trials; however, a moderate natural epidemic occurred at this location in 1996. Bacterial spot resistance had the greatest impact on yields and returns per acre in the inoculated trials. Cultivars with only Bs1 or a combination of Bs1 and Bs3 were highly susceptible in the inoculated trials. There were statistically significant and economically important differences in resistance among cultivars and breeding lines having the Bs2 gene; some were nearly as susceptible as susceptible checks. Although many Bs2-gene cultivars showed satisfactory levels of resistance, only a few were highly resistant, horticulturally acceptable, and comparable in yields to the best susceptible hybrids in a bacterial spot-free environment.

Download Full-text