scholarly journals First Report of Bacterial Spot Caused by Xanthomonas arboricola pv. pruni on Japanese Plum in Taiwan

Plant Disease ◽  
2013 ◽  
Vol 97 (6) ◽  
pp. 835-835 ◽  
Author(s):  
Y. M. Shen ◽  
T. C. Huang ◽  
C. H. Chao ◽  
H. L. Liu
Keyword(s):  
First Record ◽  
Tween 20 ◽  
Post Inoculation ◽  
Bacterial Spot ◽  
Japanese Plum ◽  
Specific Pcr ◽  
Leaf Spots ◽  
Plastic Bags ◽  
Xanthomonas Arboricola ◽  
Specific Pcr Assay

Prunus salicina Lindl., also known as Japanese plum, is a temperate-zone fruit tree grown in mountainous areas of Taiwan. The planted area in Taiwan is approximately 3,000 ha. In June 2011, more than 20% of plum fruits harvested in an orchard in Lishan (elevation about 2,000 m) showed black, mostly circular, sunken necrotic lesions. Leaves with a shot-hole appearance and cankered branches were found when investigating the orchard. Bacteria were isolated from symptomatic fruits, leaves, and branches. Isolation on nutrient agar detected colonies that were yellow, mucoid, gram-negative, Xanthomonas-like, and induced hypersensitive responses on tomatoes. Three voucher isolates, BCRC80476, BCRC80478, and BCRC80481, obtained from the fruit, leaf, and branch, respectively, were deposited in the Bioresource Collection and Research Center, Hsinchu, Taiwan. Molecular analyses were conducted for species identification. Sequences of the gyrB gene of the three voucher isolates (GenBank Accession Nos. KC202288, KC202289, and KC202287) were 100% identical to that of Xanthomonas arboricola pv. pruni pathotype strain ICMP51 (2). In addition, DNA fragments of the xopE3 gene (an X. arboricola pv. pruni specific T3E gene, approximately 381 bp) were PCR amplified using the primer pair fw-5′CCGACATTGCCGTCAGCGATCACG3′ and rv-5′AGCGTTCTTGGGTGTGTTGAGCATTTG3′ (1). The bacterial isolates were identified as X. arboricola pv. pruni on the basis of the colony characteristics, sequence homology, and the specific PCR assay. Pathogenicity was confirmed by inoculation of greenhouse-potted P. salicina plants with strains BCRC80476, BCRC80478, and BCRC80481 using bacterial suspensions (6.7 × 108 CFU per ml) in 0.01% Tween 20. Five plants were evenly sprayed with inoculum of each bacterial isolate and covered with plastic bags for 3 days. One week post inoculation, at an average temperature of 19°C, the 15 inoculated plants produced brown-purple spots delimited by a chlorotic margin on the leaves. Three weeks post inoculation, the necrotic leaf spots completely deteriorated, leaving a shot-hole appearance, and the branches showed lesions similar to those observed in the fields. The pathogen was reisolated from the symptomatic tissues, fulfilling Koch's postulates. Control plants sprayed with 0.01% Tween 20 remained symptomless. To our knowledge, this is the first record of X. arboricola pv. pruni causing bacterial spot on P. salicina in Taiwan. References: (1) A. Hajri et al. Appl. Environ. Microbiol. 78:371, 2012. (2) J. M. Young et al. Syst. Appl. Microbiol. 31:366, 2008.

scholarly journals First Report of Alternaria heveae Causing Black Leaf Spot of Rubber Tree in China

Plant Disease ◽  
2014 ◽  
Vol 98 (7) ◽  
pp. 1011-1011 ◽  
Author(s):  
Z. Y. Cai ◽  
Y. X. Liu ◽  
G. X. Huang ◽  
M. Zhou ◽  
G. Z. Jiang ◽  
...  
Keyword(s):  
Rubber Tree ◽  
Morphological Characteristics ◽  
Black Spot ◽  
Its Region ◽  
Post Inoculation ◽  
First Report ◽  
Leaf Spots ◽  
Plastic Bags ◽  
Manual Pressure ◽  
Tree Leaf

Rubber tree (Hevea brasiliensis Muell. Arg.) is an important industrial crop of tropical areas for natural rubber production. In October 2013, foliar spots (0.1 to 0.4 mm in diameter), black surrounded by a yellow halo, and with lesions slightly sunken were observed on the rubber tree leaf in a growing area in Heikou County of Yunnan Province. Lesion tissues removed from the border between symptomatic and healthy tissue were surface sterilized in 75% ethanol and air-dried, plated on PDA plates, and incubated at 28°C with alternating day/night cycles of light. The pathogen was observed growing out of many of the leaf pieces, and produced abundant conidia. Colonies 6.1 cm in diameter developed on potato carrot agar (PCA) after 7 days, with well-defined concentric rings of growth. Colonies on PCA were composed of fine, dark, radiating, surface and subsurface hyphae. Conidia produced in PCA culture were mostly solitary or in short chains of 2 to 5 spores, long ovoid to clavate, and light brown, 40 to 81.25 × 8 to 20 μm (200 colonies were measured), with 3 to 6 transverse septa and 0 to 2 longitudinal or oblique septa. Morphological characteristics were similar to those described for Alternaria heveae (3,4). A disease of rubber tree caused by Alternaria sp. had been reported in Mexico in 1947 (2). DNA of Ah01HK13 isolate was extracted for PCR and sequencing of the ITS region with ITS1 and ITS4 primers was completed. From the BLAST analysis, the sequence of Ah01HK13 (GenBank Accession No. KF953884), had 97% similarity to A. dauci, 96% identical to A. macrospora (AY154701.1 and DQ156342.1, respectively), indicating the pathogen belonged to Alternaria genus. According to morphological characteristics, this pathogen was identified as A. heveae. Pathogenicity of representative isolate, Ah01HK13 was confirmed using a field rubber tree inoculation method. Three rubber plants (the clone of rubber tree Yunyan77-4) were grown to the copper-colored leaf stage and inoculated by spraying spore suspension (concentration = 104 conidia/ml) to the copper-colored leaves until drops were equally distributed on it using manual pressure sprayer. Three rubber plants sprayed with sterile distilled water were used as controls. After inoculation, the plants were covered with plastic bags. The plastic bags were removed after 2 days post-inoculation (dpi) and monitored daily for symptom development (1). The experiment was repeated three times. The typical 0.1 to 0.4 mm black leaf spots were observed 7 dpi. No symptoms were observed on control plants. A fungus with the same colony and conidial morphology as A. heveae were re-isolated from leaf lesions on inoculated rubber plants, but not from asymptomatic leaves of control plants, fulfilling Koch's postulates. Based on these results, the disease was identified as black spot of rubber tree caused by A. heveae. To our knowledge, this is the first report of A. heveae on rubber tree in China. References: (1) Z. Y. Cai et al. Microbiol Res. 168:340, 2013. (2) W. J. Martin. Plant Dis. Rep. 31:155, 1947. (3) E. G. Simmons. Mycotaxon 50:262, 1994. (4) T. Y. Zhang. Page 111 in: Flora Fungorum Sinicorum: Alternaria, Science Press, Beijing, 2003.

scholarly journals Litchi anthracnose caused by Colletotrichum karstii in Guangxi, China

Plant Disease ◽  
2021 ◽  
Author(s):  
Jiang Zhao ◽  
Zhihe Yu ◽  
Yun Wang ◽  
Qili Li ◽  
Lihua Tang ◽  
...  
Keyword(s):  
Species Complex ◽  
Southern China ◽  
Pcr Amplification ◽  
Spore Suspension ◽  
Fruit Rot ◽  
Tween 20 ◽  
Healthy Plant ◽  
Leaf Spots ◽  
Plastic Bags ◽  
Medicinal Value

Litchi (Litchi chinensis Sonn.), a native fruit tree from southern China, has been planted in many subtropical and tropical countries for its fruit which are considered delicious and of medicinal value (Anderson et al. 2013). Anthracnose, one of the most important diseases on litchi, can cause flower drop, fruit drop, and fruit rot. Infected leaves form dark brown spots which turn to reddish brown with gray-white edges. Infected fruits formed dark brown spots which developed eventually to entire black rotted fruits. On both tissues, small dots of acervuli appeared with high humidity (Lai et al. 2004). On 20 April 2019, two leaf spots samples of litchi from different plants were collected from a 2 ha litchi orchard in Xintang Town (N 22.38˚, E 108.61˚), Qinzhou City, Guangxi province. The incidence of leaf spots in the orchard was above 20%. Each sample was cut into multiple pieces targeting zone between symptomatic and healthy plant tissues, disinfected with 75% ethanol for 10 s and 1% sodium hypochlorite (NaClO) for 1 min, and then washed three times with sterilized distilled water. The sterilized leaf tissues were placed on potato dextrose agar (PDA) and incubated at 28°C in darkness for one week. The growing hyphae from each sample was transferred to fresh PDA. The pieces from each leaf yielded a similar fungal morphotype over 75% of the time, and a representative one from each leaf was retained and called LZ1-1 and LZ3-1. The resulting colonies were incubated on the PDA for 7 days with gray to white aerial tufted hyphae, and abundant colorless to pale orange conidia in center of colony. The conidia were smooth, apex obtuse, base truncate, straight, cylindrical, and the contents remained granular. The conidial size of LZ1-1 was 10.6 to 21.4 × 4.5 to 9.1 μm (n=100) and that of LZ3-1 was 12.7 to 16.7 × 5.5 to 8.0 μm (n=100). Appressoria of LZ1-1 (6.9 to 14.9 × 6.0 to 11.1 μm) (n=100) and LZ3-1 (6.5 to 15.4 × 5.4 to 11.4 μm) (n=100) were pale to medium brown, ovoid to bullet-shaped, not nodose, and smooth-walled to undulate. DNA was extracted from two isolates, followed by PCR amplification and sequencing using primers for the rDNA internal transcribed spacer (ITS), actin (ACT), calmodulin (CAL), chitin synthase (CHS-1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and β-tubulin (TUB2) (Damm et al. 2012). The resulting sequences were deposited in GenBank (ITS: MW494453 and MW494454, ACT: MW495034 and MW495035, CAL: MW495036 and MW495037, CHS-1: MW495038 and MW495039, GAPDH: MW495040 and MW495041, TUB2: MW495042 and MW495043). The concatenated sequences comprised of six genomic regions of LZ1-1, LZ3-1 and other sequences of Colletotrichum obtained from GenBank were used to construct a Neighbor-Joining (NJ) tree with 1000 bootstrap replicates using MEGA4 (Tamura et al. 2007). The results revealed both LZ1-1 and LZ3-1 were clustered with type strain of C. karstii with high bootstrap value. The pathogenicity of the two isolates was determined by inoculating on leaves of 1-year-old litchi saplings in the greenhouse. Slight scratches were made on the surface of healthy leaves and 10 μL of spore suspension (106 conidia/mL) in 0.1% Tween 20 were inoculated onto each wounded spot. The blank control groups were inoculated with 10 μL 0.1% Tween 20. Each isolate was inoculated onto at least 27 leaves of three saplings, with each leaf wounded at spots. The inoculated saplings were placed in a greenhouse (12 h/12 h light/dark, 25 ± 2°C), and humidity maintained by covering plastic bags. The leaves inoculated with spore suspension showed reddish-brown spots after one week, while no symptoms were observed in the control. Each fungal isolate was consistently reisolated from inoculated leaves, thus fulfilling Koch's postulates. It was reported that members of the C. acutatum species complex and the C. gloeosporioides species complex could cause anthracnose on litchi (Ling et al. 2019), including C. gloeosporioides, C. siamense, C. fioriniae, and C. simmondsii (Ling et al. 2019; 2020). To our knowledge, this is the first report of anthracnose on litchi in China caused by C. karstii, a member of the C. boninense species complex. This study expands the understanding of the pathogen of anthracnose on litchi which can lead to improved management and control.

scholarly journals Epidemiology and Management of Bacterial Spot of Almond Caused by Xanthomonas arboricola pv. pruni, a New Disease in California

Plant Disease ◽  
2020 ◽  
Vol 104 (6) ◽  
pp. 1685-1693 ◽  
Author(s):  
Stacey E. Haack ◽  
Layne Wade ◽  
Helga Förster ◽  
James E. Adaskaveg
Keyword(s):  
Disease Incidence ◽  
Management Strategies ◽  
Pcr Primers ◽  
Host Susceptibility ◽  
New Disease ◽  
Bacterial Spot ◽  
Immature Fruit ◽  
Specific Pcr ◽  
Xanthomonas Arboricola ◽  
Species Specific

Bacterial spot caused by Xanthomonas arboricola pv. pruni was first detected on almond in California in 2013, and it is reported herein as a new disease in California based on fulfilling Koch’s postulates and identification of the pathogen using species-specific PCR primers. Infected mummified fruit from the previous growing season and their peduncles were identified as primary overwintering sites of the bacterium on the tree. Twig cankers were not observed, and the pathogen was not recovered from dormant buds. Isolation from flowers and emerging leaves was only successful when they were collected within 20 cm of an infected, mummified fruit on the tree. Inoculation of flowers and immature fruit as well as immature and mature leaves resulted in disease development, indicating a long period of host susceptibility in the spring, but disease incidence was highest in fruit inoculations. In split-plot trials over 3 years, dormant applications in December or January with copper or copper-mancozeb significantly reduced the disease compared with untreated controls in seasons with high rainfall, but they had no effect in seasons with low rainfall. In-season applications of copper-mancozeb at petal fall or at full bloom and petal fall were also effective in reducing the disease. Phytotoxicity was observed after repeated applications of copper bactericides, especially in low-rainfall seasons. Dormant and in-season treatments of copper-mancozeb mixtures integrated with removal of mummified fruit are currently the best management strategies for bacterial spot of almond in California.

scholarly journals First Report of Alternaria alternata Causing Black Leaf Spot of Rubber Tree in China

Plant Disease ◽  
2015 ◽  
Vol 99 (2) ◽  
pp. 290-290 ◽  
Author(s):  
Z. Y. Cai ◽  
Y. X. Liu ◽  
G. H. Li ◽  
Y. F. Wang ◽  
M. Zhou
Keyword(s):  
Alternaria Alternata ◽  
Leaf Spot ◽  
Rubber Tree ◽  
Morphological Characteristics ◽  
Correct Identification ◽  
Post Inoculation ◽  
First Report ◽  
Leaf Spots ◽  
Plastic Bags ◽  
Black Leaf Spot

We first reported Alternaria heveae (E.G. Simmons ) to be the pathogen that caused black leaf spot of rubber tree (Hevea brasiliensis Muell. Arg) in Heikou county in July 2014 (1). Black leaf spots that resembled the symptoms caused by A. heveae were observed on the leaves of rubber trees of the whole propagule collection nursery in Jingping County (22°68′ N and 103°05′ E) of Yunnan Province. Black foliar spots (0.1 to 2 mm in diameter) surrounded by a yellow halo with lesions slightly sunken on the leaf surface were observed. To confirm whether the disease was caused by the same pathogen, 5-mm2 sections were removed from the leading edge of the lesion and were surface-sterilized in 75% ethanol, air-dried, plated on potato carrot agar (PCA), and incubated at 28°C in the dark. Colonies of the fungus on PCA had round margins and little aerial mycelia with gray-black coloration after 6 days of growth on PCA (2). Medium brown conidia were found to be in short chains of two to eight spores, ovoid, obclavate, and obpyriform, with or without a short conical or cylindrical-shaped apical beak. Conidia ranged from 22.5 to 67.5 μm long (mean 39.9 μm) × 10 to 15 μm wide (mean 12.5 μm; 100 colodia were measured), with three to six transverse septa and zero to three longitudinal or oblique septa. Morphological characteristics matched the descriptions of A. alternata [(Fries) Keissler] (4).The ITS1-5.8S-ITS2 region of one single-spore isolate, Ah02JP1, was amplified with primers ITS1 and ITS4. The PCR product was sequenced directly and deposited in GenBank (Accession No. KM111289). A BLAST search of the GenBank database revealed 100% similarity with A. alternata isolates KJ829535.1, KJ677246.1, and KF813070.1. Therefore, the pathogen was identified as A. alternata on the basis of its morphological characteristics and ITS sequence. Pathogenicity of a representative isolate, Ah02JP1 was confirmed using a field rubber tree inoculation method. Three rubber plants (the clone of rubber tree Yunyan77-4) were grown to the copper-colored leaf stage. Leaves were spray-inoculated (104 conidia per milliliter spore suspension) until drops were equally distributed using a manual pressure sprayer. Three rubber plants sprayed with sterile distilled water were used as controls. After inoculation, the plants were covered with plastic bags to maintain high relative humidity. The plastic bags were removed 2 days post-inoculation (dpi), and the plants were monitored daily for symptom development. Five days post-inoculation, spots similar to the original ones seen on the field trees developed on all inoculated leaves, while control leaves remained symptomless. A. alternata was re-isolated from spray-inoculated leaves, confirming Koch's postulates. A. alternata has been reported as the causal agent of leaf blight of rubber tree in India, which initially appeared as minute spots on leaves and enlarged with the growth of the leaves (3). However, in the present study, the symptoms (black leaf spots) remained small over time after inoculation. To our knowledge, this is the first report of A. alternata on rubber tree in China. Correct identification of pathogens is essential for disease management strategies. This report will establish a foundation for the further study of Alternaria alternata to address the disease effectively. References: (1) Z. Y. Cai et al. Plant Dis. 98:1011, 2014. (2) E. Mirkova. J. Phytopathol. 151:323, 2003. (3) C. B. Roy et al. J. Plantation Crops 34:499, 2006. (4) T. Y. Zhang. Page 32 in: Flora Fungorum Sinicorum, Vol. 16: Alternaria. Science Press, Beijing, 2003.

scholarly journals First Report of Leaf Spot and Shoot Blight Caused by Cylindrocladium scoparium on Mallee Honeymyrtle in Italy

Plant Disease ◽  
2009 ◽  
Vol 93 (10) ◽  
pp. 1078-1078 ◽  
Author(s):  
G. Polizzi ◽  
D. Aiello ◽  
V. Guarnaccia ◽  
G. Parlavecchio ◽  
A. Vitale
Keyword(s):  
South African ◽  
Leaf Spot ◽  
First Record ◽  
Crown Rot ◽  
Single Spore ◽  
Centraalbureau Voor ◽  
Leaf Spots ◽  
Plastic Bags ◽  
Shoot Blight ◽  
Twig Blight

In December of 2008, a widespread disease was observed on several blocks of approximately 15,000 plants (6-month to 2-year-old) of mallee honeymyrtle (Melaleuca acuminata F. Muell.). The plants were grown in two nurseries in eastern Sicily where high diffusion of diseases caused by Cylindrocladium pauciramosum and C. scoparium was previously detected. The plants exhibited leaf spots, defoliation, and apical blight of shoots. Crown rot and root rot were not present. Leaf spots were detected on all plants, whereas shoot blight was observed on approximately 3% of the plants. A Cylindrocladium sp. was consistently isolated from the diseased portions of plants onto potato dextrose agar. To determine the species, 20 single-conidia isolates of the fungus obtained from symptomatic tissues from different blocks and nurseries were cultured on carnation leaf agar (CLA) for 7 days at 25°C under 12-h light/dark conditions. Mycelia and spores growing on the carnation leaves were examined with a light microscope and the isolates were identified as C scoparium Morgan (teleomorph Calonectria morganii Crous, Alfenas & M.J. Wingf.) on the basis of their pyriform to broadly ellipsoidal terminal vesicles, conidiophore branching pattern, and conidia (1). In addition, the ability of the isolates to mate with South African and Italian opposite tester strains of C. scoparium (2,4) confirmed the identification of all the isolates. Koch's postulates were fulfilled by inoculating 30 6-month-old plants of mallee honeymyrtle with a spore suspension (105 conidia per ml) of one isolate of the pathogen (DISTEF-MA1) obtained from 14-day-old single-spore colonies grown on CLA at 24°C under fluorescent cool white lights on a 12-h light/dark regimen. Following inoculation, all plants were maintained in plastic bags in a growth chamber at 25 ± 1°C and 90 to 95% relative humidity. The same number of mallee honeymyrtle plants was used as uninoculated controls. Leaf spots, defoliation, and apical shoot blight identical to those observed in the nurseries appeared within 4 to 25 days. No symptoms were detected on the control plants. C. scoparium was reisolated from the artificially infected tissues and was identified as previously described. The isolate used in the pathogenicity proof was deposited at the Fungal Biodiversity Centre, Centraalbureau voor Schimmelcultures (Accession No. CBS 124658). In Italy, C. scoparium was detected for the first time on Pistacia lentiscus in 2005 (3). Another report confirmed the spread of the pathogen in Sicilian ornamental nurseries (4). To our knowledge, this is the first record in the world of C. scoparium causing disease on mallee honeymyrtle. The data demonstrate the high susceptibility of this species to the C. scoparium leaf spot and twig blight especially when environmental conditions (heavy rains and mild temperatures) are conductive to the infections. References: (1) P. W. Crous. Taxonomy and Pathology of Cylindrocladium (Calonectria) and Allied Genera. The American Phytopathological Society, St. Paul MN, 2002. (2) P. W. Crous and M. J. Wingfield. Mycotaxon 51:341, 1994. (3) G. Polizzi et al. Plant Dis. 90:1110, 2006. (4) G. Polizzi et al. Plant Dis. 91:769, 2007.

scholarly journals Veronica sibirica Leaf Spots Caused by Phacellium veronicae, a New Disease in China

Plant Disease ◽  
2013 ◽  
Vol 97 (12) ◽  
pp. 1662-1662 ◽  
Author(s):  
Q. R. Bai ◽  
S. Han ◽  
Y. Y. Xie ◽  
J. Gao ◽  
Y. Li
Keyword(s):  
Morphological Characteristics ◽  
Its Region ◽  
Control Treatment ◽  
Perennial Herb ◽  
Conidial Suspension ◽  
New Disease ◽  
Medical College ◽  
Leaf Spots ◽  
Plastic Bags ◽  
Insect Bites

Veronica sibirica (Veronicastrum sibiricum) is an erect perennial herb, an ornamental, and a traditional Chinese medicine plant distributed mostly in northeastern, northern, and northwestern China. It has dehumidifying and detoxifying properties, and is mainly used for the treatment of cold, sore throat, mumps, rheumatism, and insect bites (4). In June 2008 through 2012, leaf spots of V. sibirica were observed in the Medicinal Herb Garden of Jilin Agricultural University (43°48′N, 125°23′E) and the medicinal plantations of Antu County (43°6′N, 128°53′E), Jilin Province. Leaf spots were amphigenous, subcircular, angular-irregular, brown, and 1 to 10 mm in diameter; they occasionally merged into a larger spot with an indefinite margin or with a pale center and dark border. Pale conidiomata were hypophyllous and scattered on the spots. The conidiophores were 100 to 400 μm high and clustered together to form synnemata 20 to 50 μm in diameter, which splayed out apically and formed loose to dense capitula. Conidiophores occasionally emerged through the stomata individually and produced conidia on the surface of the infected leaves. The conidiogenous cell terminal was geniculate-sinuous with somewhat thickened and darkened conidial scars. Conidia were solitary or catenulate, ellipsoid-ovoid or subcylindric-fusiform, hyaline and spinulose, 4.01 to 7.18 × 11.16 to 20.62 μm with obtuse to somewhat attenuated ends, and slightly thickened, darkened hila. Six isolates were obtained from necrotic tissue of leaf spots and cultured on potato dextrose agar at 25°C. After incubation for 14 days, colony surfaces were white to pinkish. The colony diameter increased by 12 mm after 21 days' incubation. Hyphae were hyaline, septate, and branched. Conidiophores grew individually or fascicularly. The symptoms and morphological characteristics were consistent with previous descriptions (1,2), and the fungus was identified as Phacellium veronicae (Pass.) (U. Braun 1990). The internal transcribed spacer (ITS) region of the nuclear rDNA was amplified using primers ITS4/ITS5 (3). The ITS was identical among all six isolates (HE995799) and 98% identical to that of P. veronicae (JQ920427, HQ690097). Pathogenicity was confirmed by spraying five 1-year-old V. sibirica seedlings with a conidial suspension (106 conidia/ml) of each isolate and five seedlings with sterile water as a control treatment. Plants were grown in the greenhouse at 20 to 25°C and were covered with plastic bags to maintain humidity on the foliage for 72 h. After 15 days, the same symptoms appeared on the leaves as described earlier for the field-grown plants; the control plants remained healthy. The same fungus was reisolated from the leaf spots of inoculated plants. Currently, the economic importance of this disease is limited, but it may become a more significant problem, as the cultivated area of V. sibirica is increasing. To our knowledge, although P. veronicae was recorded on the other species of Veronica (V. austriaca, V. chamaedrys, V. grandis, V. longifolia, V. paniculata, and V. spicata ssp. incana) in Europe (Germany, Denmark, Ireland, Romania) and V. wormskjoldii in North America (Canada) (1), this is the first report of V. sibirica leaf spots caused by P. veronicae in the world, and it is a new disease in China. References: (1) U. Braun. A monograph of Cercosporella, Ramularia and allied genera (phytopathogenic Hyphomycetes) 2, IHW-Verlag, Germany, 1998. (2) U. Braun. Nova Hedwigia 50:499, 1990. (3) D. E. L. Cooke et al. Mycol. Res. 101:667, 1997. (4) Jiangsu New Medical College. Dictionary of Chinese Materia Medica. Shanghai: Shanghai Scientific and Technical Publishers, China, 1977.

Identification of Klebsiella oxytoca using a specific PCR assay targeting the polygalacturonase pehX gene

2003 ◽  
Vol 154 (8) ◽  
pp. 587-592 ◽  
Author(s):  
Gennadiy Kovtunovych ◽  
Tetyana Lytvynenko ◽  
Valentyna Negrutska ◽  
Olena Lar ◽  
Sylvain Brisse ◽  
...  
Keyword(s):  
Klebsiella Oxytoca ◽  
Pcr Assay ◽  
Specific Pcr ◽  
Specific Pcr Assay

Multilocus Sequence Analysis and Copper Ion Resistance Detection of 60 Xanthomonas arboricola pv. juglandis Isolates from China

Plant Disease ◽  
2021 ◽  
Author(s):  
Benzhong Fu ◽  
Jieqian Zhu ◽  
Conard Lee ◽  
Lihua Wang
Keyword(s):  
Sequence Analysis ◽  
Copper Ion ◽  
Housekeeping Genes ◽  
Threshold Value ◽  
Pcr Primers ◽  
Multilocus Sequence Analysis ◽  
Nucleotide Polymorphisms ◽  
Specific Pcr ◽  
Resistant Strains ◽  
Xanthomonas Arboricola

Walnut bacterial blight caused by Xanthomonas arboricola pv. juglandis (Xaj) has serious repercussions for walnut production around the world. Between 2015 and 2017, disease samples were collected from six counties (Danjiangkou, Baokang, Suizhou, Shennongjia, Zigui, and Xingshan) in Hubei province, China. Fifty-nine Xaj strains were identified by morphology and specific PCR primers from 206 isolates. The genetic diversity of 60 Xaj strains (59 from Hubei plus one from Beijing) was evaluated by Multilocus Sequence Analysis (MLST), and their resistance to copper ion (Cu2+) treatment was determined. A Neighbor Joining phylogenetic dendrogram was constructed based on four sequences of housekeeping genes (atpD-dnaK-glnA-gyrB). Two groups of strains were identified whose clustering was consistent with that of glnA. The minimal inhibitory concentration of copper ion on representative Xaj strain DW3F3 (the first genome sequenced Xaj from China) was 115 μg/ml. Setting the copper resistant threshold value to 125 μg/ml, 47 and 13 strains were considered sensitive and resistant to Cu2+, respectively. Furthermore, five strains showed Cu2+ resistance at 270 μg/ml. Compared to the copB from sensitive strains, the copB gene in resistant strains had a 15-bp insertion and eight scattered single nucleotide polymorphisms. Interestingly, the clustering based on MLSA was distinct between Xaj copper ion resistant and sensitive strains.

Sign in / Sign up

Export Citation Format

Share Document