A Modified CTAB Protocol for Plant DNA Extraction

2013 ◽  
Vol 48 (1) ◽  
pp. 72-78 ◽  
Author(s):  
Li Jinlu ◽  
Wang Shuo ◽  
Yu Jing ◽  
Wang Ling ◽  
Zhou Shiliang
Keyword(s):  
BioTechniques ◽  
2020 ◽  
Vol 69 (4) ◽  
pp. 270-280 ◽  
Author(s):  
Mustafa Ahmad Munawar ◽  
Frank Martin ◽  
Anna Toljamo ◽  
Harri Kokko ◽  
Elina Oksanen

DNA extraction can be lengthy and sometimes ends up with amplification inhibitors. We present the potential of recombinase polymerase amplification (RPA) to replace plant DNA extraction. In our rapid ‘RPA-PCR couple’ concept, RPA is tuned to slower reaction kinetics to promote amplification of long targets. RPA primers amplify target and some flanking regions directly from simple plant macerates. Then PCR primers exponentially amplify the target directly from the RPA reaction. We present the coupling of RPA with conventional, TaqMan and SYBR Green PCR assays. We applied the concept to strawberry Phytophthora pathogens and the Phytophthora identification marker atp9-nad9. We found RPA-PCR couple specific, sensitive and reliable. The approach may also benefit other difficult samples such as food, feces and ancient samples.


2000 ◽  
Vol 278 (2) ◽  
pp. 228-230 ◽  
Author(s):  
Filippo Geuna ◽  
Hans Hartings ◽  
Attilio Scienza
Keyword(s):  

2019 ◽  
Vol 6 (2) ◽  
pp. 33
Author(s):  
Irvan R Hengkengbala ◽  
Grevo S Gerung ◽  
Stenly Wullur

Title (Bahasa Indonesia): Ekstraksi DNA dan Amplifikasi gen rbcL(ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit) Alga Merah Gracilaria sp. dari Perairan Desa Bahoi, Kabupaten Minahasa Utara The quality of DNA extraction and gene amplification in algae are influenced by several factors includingthe characters and components of the algal cell wall. Therefore, extraction procedure that successfully works in one species of algae mayfail for another type of algae.  The present study was aimed to examine several DNA extraction techniquesand rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit)gene amplifications of Gracilaria sp. collected inBahoi, North Minahasa (126043’48’’N 12501’33”E). DNA genom of Gracilariasp. was extracted using conventional method (CTAB, Cetyltrimethyl ammonium Bromide), and commercial extraction kits (innuPrep Plant DNA Kit and Geneaid Genomic Plant Mini Kit). Amplification of rbcLgene employed 2 primers (rbcL-aF; ATGTCACCACAAACAGAGACTA AAGC, rbcL-aR; GTAAAATC-AAGT CCACCRCG, and rbcL-1F ATGTCACCACAAACAGAAAC, rbcL-724R TCGCATGTA-CC TGCAGTAGC under 2 different annealing temperatures (45 and 500C). Genomic DNA of Gracilariasp. was successfully extracted using Geneaid DNA Mini Kit (Plant) indicated by a DNA band on the agarose gel. RbcLgene of Gracilaria sp. could be amplified using primer 1F-724R and annealing temperature at 500C indicated bya sharp DNA band at 300-400 bp (1kb marker, Solis Biodyne) as a partial amplification of the target gene.Kualitas hasil ekstraksi DNA dan amplifikasi gen pada alga dipengaruhi oleh beberapa faktor diantaranya adalah karakter dan komponen penyususun dinding sel alga itu sendiri. Oleh karena itu, prosedur ekstraksi yang berhasil dilakukan pada pada satu jenis alga dapat saja gagal dilakukan untuk jenis alga lainnya.  Penelitian ini dilakukan untuk mengkaji beberapa teknik ekstraksi DNA dan kondisi amplifikasi gen rbcL(ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit) pada alga jenis Gracilariasp. dari perairan Bahoi, Minahasa Utara (126043’48’’N 12501’33”E).  Ekstraksi DNA Gracilaria sp. dilakukan menggunakan metode konvensional (CTAB, Cetyltrimethyl ammonium Bromide), dan menggunakan kit ekstraksi komersil (innuPrep Plant DNA Kitdan Geneaid Genomic Plant Mini Kit). Amplifikasi gen rbcLdilakukkan menggunakan 2 pasang primer (rbcL-aF; ATGTCACCACAAACAGAGACTA AAGC, rbcL-aR; GTAAAATCAAGTCCACCRCG, dan rbcL-1F ATGTCACCACA AACAGAAAC, rbcL-724R TCGCATGTACCTGCAGTAGC dan 2 kondisi suhu annealingberbeda(45 dan 500C). DNA genom alga (Gracilariasp.) dapat diekstraksi menggunakan prosedur Geneaid DNA Mini Kit (Plant) yang ditandai adanya pita DNA pada gel agarose. Gen rbcLof Gracilaria sp. dapat diamplifikasi menggunakan pasangan primer rbcL1F dan 724R pada suhu annealing 500C yang ditandai dengan adanya pita DNA tebal pada posisi sekitar 300-400 bp (1kb marker, Solis Biodyne).  Munculnya pita DNA target pada posisi tersebut mengindikasikan keberhasilan amplifikasi gen target secara parsial.


2014 ◽  
Vol 63 (3) ◽  
pp. 269-273
Author(s):  
Hitomi S. KIKKAWA ◽  
Ritsuko SUGITA ◽  
Yasuo SETO
Keyword(s):  

2020 ◽  
Author(s):  
Wei Hu ◽  
J. Clark Lagarias

AbstractBackgroundConsistent isolation of high quality plant genomic DNA is a prerequisite for successful PCR analysis. Time consumption, ease of operation and procedure cost are important secondary considerations for selecting an effective DNA extraction method. The simple, reliable and rapid DNA extraction method developed by Edwards and colleagues in 1991 [1] has proven to be the gold standard.ResultsThrough modification of the Edwards method of extraction, we have developed a one-tube protocol that greatly improves the efficiency of plant DNA extraction and reduces the potential for sample contamination while simultaneously yielding high quality DNA suitable for PCR analysis. We further show that DNA extracts prepared with this method are stable at room temperature for at least three months.ConclusionThe one-tube extraction method yields high quality plant DNA with improved efficiency while greatly minimizing the potential for cross contamination. This low-cost and environment-friendly method is widely applicable for plant molecular biology research.


Sign in / Sign up

Export Citation Format

Share Document