scholarly journals DNA extraction and amplification of the rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit) gene of red seaweed Gracilaria sp. from Bahoi Waters, North Minahasa Regency

2019 ◽  
Vol 6 (2) ◽  
pp. 33
Author(s):  
Irvan R Hengkengbala ◽  
Grevo S Gerung ◽  
Stenly Wullur
Keyword(s):  
Dna Extraction ◽  
Large Subunit ◽  
Extraction Procedure ◽  
Ammonium Bromide ◽  
Subunit Gene ◽  
Cetyltrimethyl Ammonium Bromide ◽  
Bisphosphate Carboxylase ◽  
Plant Dna ◽  
Cetyltrimethyl Ammonium ◽  
Solis Biodyne

Title (Bahasa Indonesia): Ekstraksi DNA dan Amplifikasi gen rbcL(ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit) Alga Merah Gracilaria sp. dari Perairan Desa Bahoi, Kabupaten Minahasa Utara The quality of DNA extraction and gene amplification in algae are influenced by several factors includingthe characters and components of the algal cell wall. Therefore, extraction procedure that successfully works in one species of algae mayfail for another type of algae.  The present study was aimed to examine several DNA extraction techniquesand rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit)gene amplifications of Gracilaria sp. collected inBahoi, North Minahasa (126043’48’’N 12501’33”E). DNA genom of Gracilariasp. was extracted using conventional method (CTAB, Cetyltrimethyl ammonium Bromide), and commercial extraction kits (innuPrep Plant DNA Kit and Geneaid Genomic Plant Mini Kit). Amplification of rbcLgene employed 2 primers (rbcL-aF; ATGTCACCACAAACAGAGACTA AAGC, rbcL-aR; GTAAAATC-AAGT CCACCRCG, and rbcL-1F ATGTCACCACAAACAGAAAC, rbcL-724R TCGCATGTA-CC TGCAGTAGC under 2 different annealing temperatures (45 and 500C). Genomic DNA of Gracilariasp. was successfully extracted using Geneaid DNA Mini Kit (Plant) indicated by a DNA band on the agarose gel. RbcLgene of Gracilaria sp. could be amplified using primer 1F-724R and annealing temperature at 500C indicated bya sharp DNA band at 300-400 bp (1kb marker, Solis Biodyne) as a partial amplification of the target gene.Kualitas hasil ekstraksi DNA dan amplifikasi gen pada alga dipengaruhi oleh beberapa faktor diantaranya adalah karakter dan komponen penyususun dinding sel alga itu sendiri. Oleh karena itu, prosedur ekstraksi yang berhasil dilakukan pada pada satu jenis alga dapat saja gagal dilakukan untuk jenis alga lainnya.  Penelitian ini dilakukan untuk mengkaji beberapa teknik ekstraksi DNA dan kondisi amplifikasi gen rbcL(ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit) pada alga jenis Gracilariasp. dari perairan Bahoi, Minahasa Utara (126043’48’’N 12501’33”E).  Ekstraksi DNA Gracilaria sp. dilakukan menggunakan metode konvensional (CTAB, Cetyltrimethyl ammonium Bromide), dan menggunakan kit ekstraksi komersil (innuPrep Plant DNA Kitdan Geneaid Genomic Plant Mini Kit). Amplifikasi gen rbcLdilakukkan menggunakan 2 pasang primer (rbcL-aF; ATGTCACCACAAACAGAGACTA AAGC, rbcL-aR; GTAAAATCAAGTCCACCRCG, dan rbcL-1F ATGTCACCACA AACAGAAAC, rbcL-724R TCGCATGTACCTGCAGTAGC dan 2 kondisi suhu annealingberbeda(45 dan 500C). DNA genom alga (Gracilariasp.) dapat diekstraksi menggunakan prosedur Geneaid DNA Mini Kit (Plant) yang ditandai adanya pita DNA pada gel agarose. Gen rbcLof Gracilaria sp. dapat diamplifikasi menggunakan pasangan primer rbcL1F dan 724R pada suhu annealing 500C yang ditandai dengan adanya pita DNA tebal pada posisi sekitar 300-400 bp (1kb marker, Solis Biodyne).  Munculnya pita DNA target pada posisi tersebut mengindikasikan keberhasilan amplifikasi gen target secara parsial.

scholarly journals DNA Isolation And Amplification of the rbcL (ribulose-1,5- bisphosphate carboxylase/oxygenase large subunit) gene of Caulerpa sp., Gracilaria sp., And Sargassum sp.

2020 ◽  
Vol 8 (2) ◽  
pp. 214
Author(s):  
Biondi Tampanguma ◽  
Grevo S. Gerung ◽  
Veibe Warouw ◽  
Billy Th Wagey ◽  
Stenly Wulllur ◽  
...  
Keyword(s):  
Target Gene ◽  
Dna Isolation ◽  
Large Subunit ◽  
Dna Amplification ◽  
Ammonium Bromide ◽  
Rbcl Gene ◽  
Bisphosphate Carboxylase ◽  
Plant Dna ◽  
Ctab Method ◽  
Amplification Process

DNA isolation and gene amplification of algae are significantly influenced by various factors such as characteristics and components of the algae cell wall. Therefore techniques and methods of DNA isolation in certain algae, sometimes only succeed in one particular species and can not be applied to another algae species. Based on that issue, this study was conducted with the aims to determine the succeed of DNA isolation and amplify the rbcL gene as a target gene for identification. Algae DNA was isolated by using innuPrep Plant DNA commercial kit, and the second one with a modified conventional Cetyl Trimetyl Ammonium Bromide (CTAB) method,  for the amplification process was using rbcL gene (ribulose-1,5-bisphosphate carboxylase / oxygenase large subunit) with two pairs of primers : rbcL 7F-753R and rbcL 577F-rbcSR. The results showed that the DNA of Gracilaria sp was succeed isolated by using CTAB method and it was denoted by the presence of DNA bands in agarose gel. Meanwhile DNA amplification for Gracilaria sp., and Sargassum sp., were succeed amplified with the appearance of DNA bands. But in algae Caulerpa sp., was only succeed on 1 pair of primary rbcL 7F and 7.Keywords : DNA, gene rbcL, algae Caulerpa sp., Sargassum sp., Gracilaria sp;AbstrakIsolasi DNA dan amplifikasi gen pada alga sangat dipengaruhi oleh beberapa faktor seperti karakter dan komponen pada dinding sel alga. Oleh karena itu proses isolasi DNA terkadang bisa berhasil pada satu jenis alga, namun tidak berhasil pada jenis alga lainnya. Oleh karena alasan tersebut, maka penelitian ini dilakukan untuk menentukan keberhasilan Isolasi DNA dan mengamplifikasi gen rbcL sebagai gen target identifikasi. Penelitian ini dilakukan dengan tahapan awal Isolasi DNA yang menggunakan kit komersil innuPrep Plant DNA Kit, dan metode konvensional Cetyl Trimetyl Ammonium Bromide (CTAB) yang telah dimodifikasi. Sedangkan untuk proses amplifikasi, menggunakan gen rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit) digunakan dua pasang primer yaitu rbcL 7F-753R dan rbcL 577F-rbcSR. Hasil isolasi DNA dari alga Gracilaria sp berhasil diisolasi menggunakan metode CTAB yang ditandai dengan adanya pita DNA pada gel agarose. Amplifikasi DNA pada alga Gracilaria sp., dan Sargassum sp., berhasil diamplifikasi dengan munculnya pita DNA. Namun pada alga Caulerpa sp. hanya berhasil pada 1 pasang primer rbcL 7F dan753R.Kata kunci : DNA, gen rbcL, alga Caulerpa sp., Sargassum sp., Gracilaria sp.

Scheelite (CaWO4)-type microphosphors: Facile synthesis, structural characterization and photoluminescence properties

2016 ◽  
Vol 30 (32n33) ◽  
pp. 1650400 ◽  
Author(s):  
Yuanyuan Han ◽  
Dan Wang ◽  
Danyang Liang ◽  
Shiqi Wang ◽  
Guoxin Lu ◽  
...  
Keyword(s):  
Luminescence Decay ◽  
Precipitation Method ◽  
Ammonium Bromide ◽  
Photoluminescence Properties ◽  
Facile Synthesis ◽  
Cetyltrimethyl Ammonium Bromide ◽  
Broad Emission ◽  
Transition Formula ◽  
Cetyltrimethyl Ammonium ◽  
Uv Excitation

Scheelite (CaWO4)-type microphosphors were synthesized by the precipitation method assisted with cetyltrimethyl ammonium bromide (CTAB). All compounds crystallized in the tetragonal structure with space group [Formula: see text] (No. 88). FE-SEM micrographs illustrate the spherical-like morphologies and rough surface. PL spectra indicate the broad emission peak maximum at 613 nm under UV excitation. Luminescence decay curves monitored by [Formula: see text] transition ([Formula: see text] nm) of Eu[Formula: see text] in doped CaWO4 are presented, the curves exhibit a single-exponential feature and the lifetime for doped CaWO4 is 0.61 ms.

Sign in / Sign up

Export Citation Format

Share Document