Tetra-primer ARMS-PCR identifies the novel genetic variations of bovine HNF-4α gene associating with growth traits

Abstract. The paired-like homeodomain 2 (PITX2) gene plays a critical role in regulating development, reproduction, and growth traits in ruminants. Hence, the objective of this study was to explore the polymorphisms of this gene and to evaluate their associations with quantitative traits. Herein, a novel insertion in the promoter region of the PITX2 gene was reported in Shaanbei white cashmere (SBWC) goats (n=1012). The genotype distributions between mothers of single-kid and multi-kid groups within SBWC goats were significantly different (P<0.01), implying that this indel mutation might affect the litter size. Furthermore, association analysis found that this indel mutation was significantly associated with litter size (P=0.001). Individuals with genotype DD had a significantly smaller litter size than those with other genotypes (P<0.01). Besides, this indel was significantly associated with the body length (P=0.042) and the chest width (P=0.031). Especially, the individuals with genotype DD had a significantly lower body length than those with genotype II (P<0.05), which was consistent with the trend in litter size. These findings suggested that the new 22 bp indel mutation within the PITX2 gene is significantly associated with litter size and growth traits; this can be utilized as a functional molecular marker in goat breeding.

Download Full-text

Effect of Genetic Variations of the POU1F1 Gene on Growth Traits of Nanyang Cattle

Acta Genetica Sinica ◽

10.1016/s0379-4172(06)60124-8 ◽

2006 ◽

Vol 33 (10) ◽

pp. 901-907 ◽

Cited By ~ 14

Author(s):

Kai XUE ◽

Hong CHEN ◽

Shan WANG ◽

Xin CAI ◽

Bo LIU ◽

...

Keyword(s):

Growth Traits ◽

Genetic Variations ◽

Pou1f1 Gene

Download Full-text

Identification of a novel 24 bp insertion–deletion (indel) of the androgen receptor gene and its association with growth traits in four indigenous cattle breeds

Archives Animal Breeding ◽

10.5194/aab-61-71-2018 ◽

2018 ◽

Vol 61 (1) ◽

pp. 71-78 ◽

Cited By ~ 4

Author(s):

Haidong Zhao ◽

Mingli Wu ◽

Shuhui Wang ◽

Xiaohui Yu ◽

Ze Li ◽

...

Keyword(s):

Androgen Receptor ◽

Growth Traits ◽

Receptor Gene ◽

Androgen Receptor Gene ◽

Vital Role ◽

The Novel ◽

Indigenous Cattle ◽

Phenotypic Differences ◽

Yellow Cattle

Abstract. During the past decades, insertions and deletions (indels) have become increasingly popular in animal breeding for understanding the relationship between genotypes and phenotypes. The androgen receptor (AR) plays the vital role of a bridge on the function of the androgen and has sexual size dimorphism. For this reason, the objective of this study was to explore the novel indel variants within the cattle AR gene and to detect their effects on growth traits in four breeds of Chinese yellow cattle. Herein, we first confirmed a novel 24 bp indel (AC_000187.1g.4187270-4187293delAATTTATTGGGAGATTATTGAATT) within the intron of the cattle AR gene. This is consistent with the results predicted from the NCBI SNP database. The distribution of the indel genotypes of four Chinese yellow cattle were significantly different from each other (P < 0.01). After significant correlation analysis, many remarkable phenotypic differences among the three genotypes were found (P < 0.05). In conclusion, a novel 24 bp indel within the AR gene significantly affected growth traits, suggesting that this indel may be a useful DNA marker for the elimination or selection of excellent individuals for cattle breeding.

Download Full-text