scholarly journals Cooperative interaction of oestrogen receptor ‘zinc finger’ domain polypeptides on DNA binding

1995 ◽  
Vol 305 (3) ◽  
pp. 805-810 ◽  
Author(s):  
P F Predki ◽  
B Sarkar
Keyword(s):  
Retinoic Acid ◽  
Dna Binding ◽  
Oestrogen Receptor ◽  
Binding Domain ◽  
The Other ◽  
Cooperative Interaction ◽  
Dna Binding Domain ◽  
Response Element ◽  
Response Elements ◽  
Half Site

The consensus oestrogen response element (ERE) contains two inverted copies of an AGGTCA consensus hexameric half-site, spaced by three base pairs. It differs from many other hormone response elements, such as consensus thyroid (TREp) and retinoic acid (DR-5 RARE) response elements, only in the relative spacing and orientation of these sequences. In the present study we report values for cooperativity (omega) of an oestrogen receptor DNA-binding domain polypeptide upon binding to these sequences. The polypeptide binds with negative cooperativity, or without cooperativity to retinoic acid and thyroid response elements respectively, but with high cooperativity to the ERE. We have also examined cooperativity upon binding of the polypeptide to an ERE variant. Since naturally occurring EREs commonly contain one hexamer which is considerably more degenerate than the other, we designed a hybrid response element in which one hexamer is a consensus ERE, while specific mutations were introduced into the other. We chose to mutate the second half-site to a glucocorticoid response element (GRE) half-site sequence (AGAACA), since normally no binding of the DNA-binding domain polypeptide to a GRE hexamer alone can be detected. In the hybrid response element, however, the GRE half-site is recognized with relatively high affinity, although binding to this sequence is dependent on the previous binding of a polypeptide to the ERE hexamer. Thus, cooperative interactions are capable of mediating the recognition of ERE sequence degeneracy. The ability of protein-protein interactions to mediate recognition of DNA sequence degeneracy may also have implications for transcription factors in general.

scholarly journals Open Reading Frame 50 Protein of Kaposi's Sarcoma-Associated Herpesvirus Directly Activates the Viral PAN and K12 Genes by Binding to Related Response Elements

2002 ◽  
Vol 76 (7) ◽  
pp. 3168-3178 ◽  
Author(s):  
Pey-Jium Chang ◽  
Duane Shedd ◽  
Lyn Gradoville ◽  
Myung-Sam Cho ◽  
Lee-Wen Chen ◽  
...  
Keyword(s):  
Dna Binding ◽  
Binding Domain ◽  
Open Reading Frame ◽  
Lytic Cycle ◽  
Cellular Proteins ◽  
Dna Binding Domain ◽  
Response Element ◽  
Reading Frame ◽  
Response Elements ◽  
Related Response

ABSTRACT Open reading frame (ORF) 50 protein is capable of activating the entire lytic cycle of Kaposi's sarcoma-associated herpesvirus (KSHV), but its mechanism of action is not well characterized. Here we demonstrate that ORF 50 protein activates two KSHV lytic cycle genes, PAN (polyadenylated nuclear RNA) and K12, by binding to closely related response elements located approximately 60 to 100 nucleotides (nt) upstream of the start of transcription of the two genes. The 25-nt sequence 5′ AAATGGGTGGCTAACCTGTCCAAAA from the PAN promoter (PANp) confers a response to ORF 50 protein in both epithelial cells and B cells in the absence of other KSHV proteins. The responsive region of DNA can be transferred to a heterologous minimal promoter. Extensive point mutagenesis showed that a span of at least 20 nt is essential for a response to ORF 50 protein. However, a minimum of six positions within this region were ambiguous. The related 26-nt responsive element in the K12 promoter (K12p), 5′ GGAAATGGGTGGCTAACCCCTACATA, shares 20 nt (underlined) with the comparable region of PANp. The divergence is primarily at the 3′ end. The DNA binding domain of ORF 50 protein, encompassing amino acids 1 to 490, fused to a heterologous activation domain from herpes simplex virus VP16 [ORF 50(1-490)+VP] can mediate activation of reporter constructs bearing these response elements. Most importantly, ORF 50(1-490)+VP can induce PAN RNA and K12 transcripts in transfected cells. ORF 50(1-490)+VP expressed in human cells binds specifically to duplex oligonucleotides containing the responsive regions from PANp and K12p. These DNA-protein complexes were supershifted by antibody to VP16. ORF 50(1-490) without a VP16 tag also bound to the response element. There was a strong correlation between DNA binding by ORF 50 and transcriptional activation. Mutations within PANp and K12p that impaired transactivation by ORF 50 or ORF 50(1-490)+VP also abolished DNA binding. Only one of eight related complexes formed on PANp and K12p oligonucleotides was due to ORF 50(1-490)+VP. The other complexes were due to cellular proteins. Two KSHV lytic-cycle promoters are activated by a similar mechanism that involves direct recognition of a homologous response element by the DNA binding domain of ORF 50 protein in the context of related cellular proteins.

Production and characterization of a retinoic acid receptor RARγ construction encompassing the DNA binding domain and the disordered N-terminal proline rich domain

2014 ◽  
Vol 95 ◽  
pp. 113-120 ◽  
Author(s):  
Denise Martinez-Zapien ◽  
Marc-André Delsuc ◽  
Gilles Travé ◽  
Régis Lutzing ◽  
Cécile Rochette-Egly ◽  
...  
Keyword(s):  
Retinoic Acid ◽  
Dna Binding ◽  
Retinoic Acid Receptor ◽  
Binding Domain ◽  
Dna Binding Domain ◽  
Acid Receptor ◽  
Rich Domain

scholarly journals Structural basis for DNA recognition and allosteric control of the retinoic acid receptors RAR–RXR

2020 ◽  
Vol 48 (17) ◽  
pp. 9969-9985
Author(s):  
Judit Osz ◽  
Alastair G McEwen ◽  
Maxime Bourguet ◽  
Frédéric Przybilla ◽  
Carole Peluso-Iltis ◽  
...  
Keyword(s):  
Retinoic Acid ◽  
Dna Binding ◽  
Structural Dynamics ◽  
Binding Domain ◽  
Retinoic Acid Receptors ◽  
Structural Basis ◽  
Dna Binding Domain ◽  
Binding Modes ◽  
Dna Complexes ◽  
X Ray

Abstract Retinoic acid receptors (RARs) as a functional heterodimer with retinoid X receptors (RXRs), bind a diverse series of RA-response elements (RAREs) in regulated genes. Among them, the non-canonical DR0 elements are bound by RXR–RAR with comparable affinities to DR5 elements but DR0 elements do not act transcriptionally as independent RAREs. In this work, we present structural insights for the recognition of DR5 and DR0 elements by RXR–RAR heterodimer using x-ray crystallography, small angle x-ray scattering, and hydrogen/deuterium exchange coupled to mass spectrometry. We solved the crystal structures of RXR–RAR DNA-binding domain in complex with the Rarb2 DR5 and RXR–RXR DNA-binding domain in complex with Hoxb13 DR0. While cooperative binding was observed on DR5, the two molecules bound non-cooperatively on DR0 on opposite sides of the DNA. In addition, our data unveil the structural organization and dynamics of the multi-domain RXR–RAR DNA complexes providing evidence for DNA-dependent allosteric communication between domains. Differential binding modes between DR0 and DR5 were observed leading to differences in conformation and structural dynamics of the multi-domain RXR–RAR DNA complexes. These results reveal that the topological organization of the RAR binding element confer regulatory information by modulating the overall topology and structural dynamics of the RXR–RAR heterodimers.

Sign in / Sign up

Export Citation Format

Share Document