scholarly journals The RT-PCR identification and sequence analysis of Apple chlorotic leaf spot virus from apple cultivars in Jiaodong Peninsula, China

2014 ◽  
Vol 28 (2) ◽  
pp. 238-241 ◽  
Author(s):  
Dechang Hu ◽  
Lei Wang ◽  
Xiaoman Jiang ◽  
Ning Wang ◽  
Liang Gu
Keyword(s):  
Sequence Analysis ◽  
Leaf Spot ◽  
Rt Pcr ◽  
Spot Virus ◽  
Jiaodong Peninsula ◽  
Pcr Identification ◽  
Chlorotic Leaf ◽  
Apple Cultivars

scholarly journals First Report of Apple chlorotic leaf spot virus, Cherry green ring mottle virus, and Cherry necrotic rusty mottle virus on Peach in Montenegro

Plant Disease ◽  
2014 ◽  
Vol 98 (7) ◽  
pp. 1014-1014 ◽  
Author(s):  
J. Zindović ◽  
M. Dall'Ara ◽  
C. Rubies Autonell ◽  
C. Ratti
Keyword(s):  
Sequence Analysis ◽  
Leaf Spot ◽  
Mottle Virus ◽  
Virus Infectivity ◽  
Post Inoculation ◽  
Rt Pcr ◽  
Spot Virus ◽  
First Report ◽  
Green Ring ◽  
Chlorotic Leaf

The sanitary status of peach fruit trees was assessed in central and coastal regions of Montenegro during a survey in September and October of 2011 and 2012. Leaf samples were collected from 58 (2011) and 47 (2012) trees showing chlorotic rings and spots, mosaic, necrosis, leaf distortion, and stunting. Total RNAs was extracted from each sample by RNeasy Plant Mini kit (Qiagen, Germany) and used as a template in PDO (polyvalent degenerate oligonucleotides) nested reverse transcription (RT)-PCR for the detection of fruit tree viruses belonging to the genera Trichovirus, Capillovirus, and Foveavirus (family Betaflexiviridae). PDO primer sets PDO-F1i/PDO-R3i/PDO-R4i and PDO-F2i/PDO-R1i (2) were used in the first RT-PCR and nested PCR, respectively. Total RNAs obtained from Italian Apple chlorotic leaf spot virus (ACLSV)-infected isolate and healthy peach leaves were used as positive and negative controls, respectively. A nested set of primers amplified a 362-bp product from 6 samples collected in 2011 (10.3%) and 13 samples collected in 2012 (27.7%). Sequence analysis included three isolates (367/11, 133/12, and 168/12) chosen from different peach cultivars (Ritastar, Spring Belle, and Redhaven, respectively). Amplified products of expected size of the partial RNA-dependent RNA polymerase from three positive samples were cloned into p-GEM-T Easy Vector (Promega, Madison, WI) and sequenced (MWG-Biotech AG, Germany). Sequences were deposited in GenBank under accession nos. KF534757, KF534769, and KF534766, respectively. BLAST analysis showed that the sequence of isolate 367/11 (KF534757) shared high nucleotide similarity (78.9 to 87.2%) with ACLSV isolates from GenBank, showing highest identity with isolate PBM1 (AJ243438) from Germany. Sequence analysis of isolate 133/12 (KF534769) proved that it is 90.5 to 93.3% identical to Cherry green ring mottle virus (CGRMV) isolates reported from other parts of the world. In particular, the highest nucleotide similarity was showed with isolate P1C124 (AJ291761) from France. Finally, analysis of sequence from the isolate 168/12 (KF534766) revealed high degree of identity (86.1 to 96.1%) with the corresponding nucleotide sequences of the Cherry necrotic rusty mottle virus (CNRMV) isolates, showing highest similarity with isolate 120/86 (AF237816) from Switzerland. To confirm virus infectivity, according to the FAO/IPGRI Technical Guidelines (1), budwood from 367/11, 133/12, and 168/12 samples were grafted into seedlings of peach (GF305), Prunus serrulata (cv. Shirofugen) and P. avium (cv. Sam) then maintained in a greenhouse with controlled conditions. Six months post inoculation, GF305 indexed with 367/11 sample reacts with a green depressed mottle on leaves typical of ACLSV infection. Cherry tree of cv. Shirofugen indexed with sample 133/12 showed symptoms attributable to CGRMV such as epinasty, twisting and curling of leaves while a tree of cv. Sam indexed with 168/12 sample exhibited classical necrotic shot holes in leaves induced by CNRMV infection (1). Sequence analysis of PCR products obtained from indicator plants by RT-PCR as described above showed full nucleotide identity with KF534757, KF534769, and KF534766 sequences and confirmed the presence of previous described viral agents. To our knowledge, this is the first report of ACLSV, CGRMV, and CNRMV occurrence on peach in Montenegro. Due to the economic importance of this crop, sanitation measures should be adopted to improve the control of imported plants and the use of virus-tested propagation material in order to prevent spreading of these viruses. References: (1) M. Diekmann and C. A. J. Putter. FAO/IPGRI Technical Guidelines for the Safe Movement of Germplasm. No. 16. Stone Fruits, 1996. (2) X. Foissac et al. Phytopathology 95:617, 2005.

Simultaneous detection of Apple Chlorotic Leaf Spot Virus and Apple mosaic virus in crab apples and apple rootstocks by duplex RT-PCR

2013 ◽  
Vol 164 ◽  
pp. 88-93 ◽  
Author(s):  
Santosh Watpade ◽  
Baswaraj Raigond ◽  
K.K. Pramanick ◽  
Neeraj Sharma ◽  
Anil Handa ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Leaf Spot ◽  
Simultaneous Detection ◽  
Rt Pcr ◽  
Apple Rootstocks ◽  
Spot Virus ◽  
Chlorotic Leaf

scholarly journals First Report of Apricot pseudo-chlorotic leaf spot virus Infecting Plum (Prunus domestica) in the Czech Republic

Plant Disease ◽  
2012 ◽  
Vol 96 (3) ◽  
pp. 461-461 ◽  
Author(s):  
D. Šafářová ◽  
M. Navrátil ◽  
C. Faure ◽  
T. Candresse ◽  
A. Marais
Keyword(s):  
Czech Republic ◽  
Amino Acid ◽  
Leaf Spot ◽  
Fruit Trees ◽  
Stone Fruit ◽  
Prunus Domestica ◽  
Rt Pcr ◽  
Spot Virus ◽  
The Czech Republic ◽  
Chlorotic Leaf

Apricot pseudo-chlorotic leaf spot virus (APCLSV) is a novel, still poorly known Trichovirus in the family Betaflexiviridae. It is most closely related to Apple chlorotic leaf spot virus (ACLSV) (2,4) and infects stone fruit trees of the Prunus genus. Its presence has so far been detected in apricot, plum, Japanese plum, and peach trees in Italy, Spain, France, Hungary, Turkey, Jordan, and Australia (1,2,4). During the summers of 2008 and 2010, leaf samples of old Czech local plum cultivars were obtained from the Holovousy collection and assessed for the presence of viruses belonging to the Capillovirus, Trichovirus, and Foveavirus genera using the polyvalent degenerate oligonucleotides (PDO) nested reverse transcription (RT)-PCR test (3). Following amplification from total RNAs extracts, the amplicons were cloned and several clones were sequenced for each plant sample. In plum (Prunus domestica) cv. Babce, a mixture of amplicons was observed and BlastN and BlastX analyses of the obtained sequences revealed the presence of ACLSV and APCLSV. The 310-bp APCLSV amplicon (GenBank Accession No. JN790294) showed highest identity (82.9% in nucleotide sequence and 97.1% in amino acid sequence) with the Sus2 isolate of APCLSV (4) and clustered with APCLSV isolates in a phylogenetic analysis. APCLSV infection was further confirmed with an APCLSV-specific RT-PCR assay (4), which yielded a product of the expected 205-bp size (GenBank Accession No. JN653070) with closest homology again to the Sus2 APCLSV isolate (83.4 and 94.3% nucleotide and amino acid identity, respectively). To our knowledge, this finding represents the first detection of APCLSV in domestic plums in the Czech Republic, extending our vision of APCLSV diversity and its geographic distribution. For unknown reasons, APCLSV has almost always been reported in mixed infection with ACLSV (1,2,4) and the situation in cv. Babce does not deviate from this trend. This has greatly hindered the analysis of the pathogenicity of APCLSV, a situation further complicated in the current case because the Babce cultivar was also infected by Plum pox virus. References: (1) M. Barone et al. Acta Hortic. 781:53, 2008. (2) T. Candresse et al. Virus and Virus-Like Diseases of Pome and Stone Fruit Trees. A. Hadidi et al., eds. The American Phytopathological Society, St. Paul, MN, 2011. (3) X. Foissac et al. Phytopathology 95:617, 2005. (4) D. Liberti et al. Phytopathology 95:420, 2005.

scholarly journals An Apple Chlorotic Leaf Spot Virus Isolate from Ornamental Dwarf Flowering Almond (Prunus glandulosa 'Sinensis'): Detection and Characterization

HortScience ◽  
2005 ◽  
Vol 40 (5) ◽  
pp. 1401-1404 ◽  
Author(s):  
Sara Spiegel ◽  
Dan Thompson ◽  
Aniko Varga ◽  
Delano James
Keyword(s):  
Leaf Spot ◽  
Amino Acid Level ◽  
Infected Plant ◽  
Rt Pcr ◽  
Spot Virus ◽  
Coding Regions ◽  
Planting Material ◽  
Limited Host Range ◽  
Chlorotic Leaf ◽  
Root Grafts

An apple chlorotic leaf spot virus (ACLSV) isolate was detected by TAS-ELISA and RT-PCR in an ornamental dwarf flowering almond (Prunus glandulosa Thunb.). This plant, maintained at the Centre for Plant Health, Sidney, B.C., Canada, has been showing transient leaf symptoms during the spring seasons. A 390-bp fragment and a 1,350-bp product, in the RNA polymerase and the coat protein viral coding regions, respectively, were amplified by RT-PCR from the infected plant. A sequence comparison of the 390-bp fragment of this ACLSV isolate (designated as AL1292) with other published isolates, revealed a similarity of 81% to 84% at the nucleotide level and 88% to 100% at the amino acid level. In contrast to other ACLSV isolates, AL1292 has an exceptionally narrow range of experimental herbaceous and woody hosts, as determined by mechanical and graft inoculation assays. These standard bioassays may not be effective for the detection of the AL1292 isolate because of its limited host range. The results we report in this paper confirm P. glandulosa as a natural host of this virus. Currently it is not known how ACLSV is spread, other than by bud-grafting and possibly by root grafts. The use of virus-tested source plants for the preparation of planting material will minimize its spread.

scholarly journals First Report of Apple chlorotic leaf spot virus in Quince in Greece

Plant Disease ◽  
2007 ◽  
Vol 91 (4) ◽  
pp. 462-462 ◽  
Author(s):  
M. M. Mathioudakis ◽  
T. Candresse ◽  
N. I. Katis
Keyword(s):  
Leaf Spot ◽  
Fruit Trees ◽  
Broad Host Range ◽  
Rt Pcr ◽  
Pcr Assay ◽  
Spot Virus ◽  
First Report ◽  
Embl Accession ◽  
Two Samples ◽  
Chlorotic Leaf

The sanitary status of pome fruit trees was evaluated in central and northern Greece during a survey in the autumn of 2004 and spring of 2005. Twenty-six leaf samples were collected from five symptomless and 21 symptomatic quince trees showing fruit deformation (FD) symptoms and diffuse chlorotic leaf spots. All samples were tested for the presence of Apple chlorotic leaf spot virus (ACLSV), a member of the Trichovirus genus, initially by ELISA and then by a specific reverse transcription (RT)-PCR assay reported previously (1). ACLSV has a broad host range that includes most, if not all, Prunoidae (peach, apricot, plum, and cherry) and Maloidae (apple, pear, and quince) fruit tree species. Although it has been tentatively linked with fruit, leaf, bark, and growth retardation symptoms in quince (2,3), its geographic distribution and association with specific symptoms is still poorly determined. ACLSV was initially detected by serology in two plants, one symptomless and one showing FD symptoms. ACLSV presence in these two samples and in an additional symptomless plant was confirmed by the ACLSV-specific RT-PCR assay. Sequencing of the RT-PCR amplicon from the symptomatic isolate (EMBL Accession No. AM292923), which was positive in both assays, confirmed the identification of ACLSV. The obtained sequence shows 93% nucleotide identity with an apple isolate of ACLSV (EMBL Accession No. AY677103). To our knowledge, these findings represent the first report of the presence of ACLSV in quince in Greece. They further indicate that at least for some host-cultivar/virus isolate combinations, ACLSV may be asymptomatic in quince and that the symptoms observed in the plants sampled are unrelated to ACLSV infection. References: (1) T. Candresse et al. Acta Hortic. 386:136, 1995. (2) J. C. Desvignes. Page 202 in: Virus Diseases of Fruit Trees. CTIFL Publishing, 1999. (3) S. Paunovic and M. Rankovic. Jugosl. Vocarstvo 31:231, 1997.

scholarly journals First Report of Apple chlorotic leaf spot virus in Hawthorn in China

Plant Disease ◽  
2015 ◽  
Vol 99 (1) ◽  
pp. 164-164 ◽  
Author(s):  
M. Wang ◽  
H. Dai
Keyword(s):  
Leaf Spot ◽  
De Novo ◽  
Genomic Sequence ◽  
Nucleotide Identity ◽  
Rna Seq ◽  
Rt Pcr ◽  
Spot Virus ◽  
First Report ◽  
Chlorotic Leaf ◽  
Rosaceae Family

Apple chlorotic leaf spot virus (ACLSV) is the type species of the genus Trichovirus in the Betaflexiviridae family (1). ACLSV is distributed worldwide in most pome and stone fruit trees of the Rosaceae family, including apple, pear, peach, plum, cherry, apricot, and hawthorn (3). In 2012, a de novo assembly of the fruit transcriptome of a hawthorn (Crataegus pinnatifida) accession maintained in the National Hawthorn Germplasm Repository at Shenyang was conducted using Illumina-based RNA-seq data, and it resulted that a 7,543 nt of the genomic sequence of ACLSV was assembled. To confirm the result of Illumina RNA-Seq analysis, nine pairs of primers were designed according to the assembled sequence of ACLSV to amplify the genomic sequence of ACLSV by RT-PCR with total RNA extracted from hawthorn leaves as template (2). The full-length sequence of the isolate of ACLSV from hawthorn assembled with the sequences of the RT-PCR fragments was also 7,543 nt (GenBank Accession No. KM207212), which shows 99.5% nucleotide identity with the sequence assembled from Illumina RNA-seq data. The isolate of ACLSV from hawthorn was named SY01, which shows about 75% nucleotide identity with the sequences of ACLSV isolated from apple (GenBank Accession No. KJ522693), peach (JN634760), and plum (M58152). The nucleotide sequences of coat protein and RNA polymerase genes of SY01 are about 83 and 88% identical with those of ACLSV isolates in GenBank, respectively. A pair of primers HF/HR (ACCGGCGTCTTTTGCAAACT/TGGGTTCCAGAGTTTGAATGCA), which amplified a 210-bp fragment, was designed according to the sequence of SY01 to detect ACLSV in hawthorns. With RT-PCR, ACLSV was detected in 6 of the 30 accessions of hawthorn, and the nucleotide identity among PCR fragments was 92%. In addition, leaves from six RT-PCR positive plants reacted positively when tested by DAS-ELISA with polyclonal antisera (X-Y Biotechnology, Shanghai, China) raised against ACLSV. These findings, representing the first report of the presence of ACLSV in hawthorn in China, illustrate the need to develop virus-free trees of hawthorn for cultivation and germplasm distribution of this important Rosaceae family plant. References: (1) E. B. Carstens. Arch. Virol. 155:133, 2010. (2) H. Dai et al. PLoS ONE 8(9):e72910, 2013. (3) A. T. Katsiani et al. Plant Pathol. 63:63, 2014.

Sign in / Sign up

Export Citation Format

Share Document