scholarly journals First Report of Impatiens necrotic spot virus on Begonia in Bosnia and Herzegovina

Plant Disease ◽  
2013 ◽  
Vol 97 (7) ◽  
pp. 1004-1004 ◽  
Author(s):  
V. Trkulja ◽  
J. Mihić Salapura ◽  
B. Ćurković ◽  
I. Stanković ◽  
A. Bulajić ◽  
...  
Keyword(s):  
Bosnia And Herzegovina ◽  
Ornamental Plants ◽  
N Gene ◽  
Impatiens Necrotic Spot Virus ◽  
Post Inoculation ◽  
Necrotic Spot ◽  
Rt Pcr ◽  
Spot Virus ◽  
First Report ◽  
Negative Controls

Impatiens necrotic spot virus (INSV) and Tomato spotted wilt virus (TSWV) are the most serious viral pathogens in the production of ornamental plants in Europe and North America (1). During a survey for the presence of tospoviruses in July 2012, potted begonia hybrids (Begonia × tuberhybrida Voss) exhibiting foliar chlorotic rings and zonal spots accompanied by leaf necrosis and distortion, were observed in a greenhouse in the vicinity of Banja Luka (Bosnia and Herzegovina). Leaf samples collected from 12 symptomatic plants were analyzed for the presence of INSV and TSWV by commercial double-antibody sandwich (DAS)-ELISA kits (Bioreba AG, Reinach, Switzerland). Commercial positive and negative controls and extracts from healthy begonia leaves were included in each ELISA. INSV was detected serologically in all 12 begonia samples and all tested samples were negative for TSWV. Five healthy plants of each Petunia × hybrida and Nicotiana benthamiana were mechanically inoculated with sap from an ELISA-positive sample (157-12) using chilled 0.01 M phosphate buffer (pH 7) containing 0.1% sodium sulphite. Local necrotic lesions on P. × hybrida and systemic chlorotic mottling on N. benthamiana were observed on all inoculated plants 4 and 10 days post-inoculation, respectively. For further confirmation of INSV infection, total RNAs were extracted from all ELISA-positive begonia plants as well as mechanically inoculated N. benthamiana plants with the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and used as template in reverse transcription (RT)-PCR. RT-PCR was performed with the OneStep RT-PCR Kit (Qiagen) using primer pair INSV-589 and TOS-R15 (3), specific to the partial INSV nucleocapsid (N) gene. Total RNA obtained from Serbian INSV isolate from a begonia (GenBank Accession No. HQ724289) and RNA extracts from healthy begonia plants were used as positive and negative controls, respectively. All naturally and mechanically infected plants as well as the positive control yielded an amplicon of the expected size (589 bp), while no amplification products were obtained from the healthy controls. The RT-PCR product derived from the isolate 157-12 was sequenced directly after purification with QIAquick PCR Purification Kit (Qiagen) and submitted to GenBank (KC494869). Pairwise comparison of the 157-12 isolate N sequence with other homologous sequences available in GenBank, conducted using MEGA5 software (2), revealed that begonia isolate from Bosnia and Herzegovina showed the highest nucleotide identity of 99.7% (100% amino acid identity) with the Chinese INSV isolate (FN400772) originating from Oncidium sp. To our knowledge, this is the first report of INSV on begonia in Bosnia and Herzegovina. Begonias are very popular and widely grown ornamentals in Bosnia and Herzegovina and the presence of a new and devastating pathogen could represent a serious threat for its production. Since begonia is commonly grown together with numerous ornamental plants susceptible to INSV, further investigations are needed in order to prevent spread of this potentially harmful pathogen to new hosts in Bosnia and Herzegovina. References: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997. (2) K. Tamura et al. Mol. Biol. Evol. 28:2731, 2011. (3) H. Uga and S. Tsuda. Phytopathology 95:166, 2005.

scholarly journals First Report of Iris yellow spot virus Infecting Onion in Bosnia and Herzegovina

Plant Disease ◽  
2013 ◽  
Vol 97 (3) ◽  
pp. 430-430 ◽  
Author(s):  
V. Trkulja ◽  
J. Mihić Salapura ◽  
D. Kovačić ◽  
I. Stanković ◽  
A. Bulajić ◽  
...  
Keyword(s):  
Bosnia And Herzegovina ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
N Gene ◽  
Post Inoculation ◽  
Rt Pcr ◽  
Spot Virus ◽  
Susceptible Host ◽  
First Report ◽  
Negative Controls

In July 2012, a survey was conducted to determine the presence of tospoviruses in Bosnia and Herzegovina, symptoms resembling those caused by Iris yellow spot virus (IYSV; genus Tospovirus, family Bunyaviridae) were observed in an onion (Allium cepa) seed crop in the Gornji Karajzovci locality (Region of Banja Luka). Symptoms included chlorotic to necrotic, straw-colored, spindle- and diamond-shaped lesions, variable in size and randomly distributed on the leaves and particularly on the scapes. Later the lesions enlarged and coalesced, causing scape breakage. Affected plants occurred throughout the field and disease incidence was estimated at 20%. Symptomatic plants were sampled and assayed by double-antibody sandwich (DAS)-ELISA test using commercial polyclonal antisera (Bioreba AG, Reinach, Switzerland) against IYSV and two other tospoviruses, Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV). Commercial positive and negative controls were included in each test. IYSV was detected serologically in 19 of 20 screened samples and none of the samples tested positive for TSWV or INSV. The virus was mechanically transmitted from an ELISA-positive sample (302-12) to five of each Petunia × hybrida and Nicotiana benthamiana using chilled 0.01 M phosphate buffer (pH 7) containing 0.1% sodium sulfite (1). All inoculated P. × hybrida showed local necrotic spots, while N. benthamiana developed mild mosaic 4 and 10 days post-inoculation, respectively. However, difficulties were encountered in reproducing the disease symptoms on mechanically inoculated onion plants corroborating a previous study (2). Serological findings were verified with reverse transcription (RT)-PCR. Total RNAs from all naturally infected onion plants as well as mechanically infected N. benthamiana plants were extracted with the RNease Plant Mini Kit (Qiagen, Hilden, Germany). RT-PCR was performed with One-Step RT-PCR Kit (Qiagen) using IYSV-specific primers IYSV56U/IYSV917L (3), designed to amplify an 896-bp fragment of the S RNA which includes whole nucleocapsid (N) gene. Total RNAs from Serbian IYSV isolate from onion (GenBank Accession No. EU586203) and from healthy onion plants were used as positive and negative controls, respectively. An amplicon of the expected size was obtained from each of the plants assayed as well as from positive control, but not from the negative control. The amplified products derived from onion isolate 302-12 was purified (QIAquick PCR Purification Kit, Qiagen), sequenced directly (JX861126), and compared with known IYSV isolates. Sequence analysis of the complete N gene, conducted with MEGA5 software (4), revealed the highest nucleotide identity of 99.5% (100% amino acid identity) with IYSV onion isolate (DQ658242) from Texas. To our knowledge, this is the first report of IYSV in Bosnia and Herzegovina. Onion is an important and traditionally grown vegetable crop in Bosnia and Herzegovina and the presence of IYSV could represent an important constraint to onion and other susceptible host production. The discovery of IYSV on onion should prompt more detailed surveys, thorough inspections and subsequent testing to establish the distribution and incidence of IYSV in Bosnia and Herzegovina. References: (1) A. Kritzman et al. Plant Dis. 85:838, 2001. (2) L. Pozzer et al. Plant Dis. 83:345, 1999. (3) I. Robène-Soustrade et al. Plant Pathol. 55:288, 2006. (4) K. Tamura et al. Mol. Biol. Evol. 28:2731, 2011.

scholarly journals First Report of Impatiens necrotic spot virus in Gentiana macrophylla in China

Plant Disease ◽  
2011 ◽  
Vol 95 (3) ◽  
pp. 357-357 ◽  
Author(s):  
M. Ding ◽  
Y. Yin ◽  
Q. Fang ◽  
S. Li ◽  
Z. Zhang
Keyword(s):  
Sandwich Elisa ◽  
N Gene ◽  
Impatiens Necrotic Spot Virus ◽  
Natural Occurrence ◽  
Necrotic Spot ◽  
Rt Pcr ◽  
Spot Virus ◽  
First Report ◽  
Severe Stunting ◽  
Gentiana Macrophylla

Large leaf gentian, Gentiana macrophylla Pall., known as Qin Jiao in Chinese, is a medicinal herb. Its root is most commonly used in Chinese traditional medicine to relieve rheumatic conditions and to remove damp-heat. During a survey in July 2009, large leaf gentian plants exhibiting foliar chlorotic and necrotic spots as well as severe stunting were collected in Lijiang County, Yunnan Province of China. Incidence of symptomatic plants ranged from 10 to 30% in the field. Symptomatic leaves from five different G. macrophylla plants were collected and tested for Impatiens necrotic spot virus (INSV), Tomato spotted wilt virus, Watermelon silver mottle virus, Groundnut bud necrosis virus, Tomato chlorotic spot virus, and Groundnut ringspot virus by double-antibody sandwich-ELISA kits (Agdia Inc., Elkhart, IN). All tested samples were positive only for INSV. To further confirm the presence of INSV, reverse transcription (RT)-PCR was conducted. Total RNA was extracted from the symptomatic large leaf gentian plants leaves with a RNeasy Plant Kit (Qiagen Inc., Valencia, CA) and used as a template in RT-PCR using forward (5′-CTT TGC TTT TTA GAA CTG TGC A-3′) and reverse (5′-AGA GCA ATT GTG TCA CGA ATA T-3′) primers specific to the partial INSV nucleoprotein (N) gene (GenBank No. DQ425096). Amplicons of the expected size (approximately 760 bp) were obtained from all ELISA-positive samples. Three clones were sequenced and the partial nucleocapsid protein genes consensus sequences of these isolates were determined (GenBank No. HQ317133). Nucleotide sequences of large leaf gentian isolates shared 98 to 99% nucleotide identity with INSV sequences of isolates from China, Italy, Japan, United States, and the Netherlands (GenBank Nos. FN400772, GQ336989, DQ425096, AB109100, D00914, AB109100, and X66972). INSV is one of the most serious viral pathogens of ornamental plants in North America, Europe, and Asia (1–3). To our knowledge, this is the first report of natural occurrence of INSV in G. macrophylla in China. References: (1) S. T. Koike. Plant Dis. 92:1248, 2008. (2) E. K. Tóth et al. Plant Dis. 91:331, 2007. (3) Q. Zhang et al. Plant Dis. 94:915, 2010.

scholarly journals First Report of Impatiens necrotic spot virus in Mexico in Tomatillo and Pepper Plants

Plant Disease ◽  
2013 ◽  
Vol 97 (8) ◽  
pp. 1124-1124 ◽  
Author(s):  
B. E. González-Pacheco ◽  
L. Silva-Rosales
Keyword(s):  
Mosaic Virus ◽  
Ringspot Virus ◽  
Impatiens Necrotic Spot Virus ◽  
Post Inoculation ◽  
Necrotic Spot ◽  
Rt Pcr ◽  
Spot Virus ◽  
First Report ◽  
True Leaf ◽  
Necrotic Spots

Mexico contributes 20% of the total worldwide pepper exports (1). Impatiens necrotic spot virus (INSV) (genus Tospovirus; family Bunyaviridae) has emerged and has possibly caused diseases in various crops and ornamentals in Mexico. INSV was treated as a quarantine virus in Mexico (2) but not anymore. During the growing seasons of 2009 to 2011, surveys were conducted in the counties of Guanajuato and Querétaro in the states of the same names. Sampling included tomatillo (Physalis ixocarpa) and pepper (Capsicum spp.) plantations where plants with possible viral symptoms were observed. The symptoms observed were dark necrotic spots on some leaves and on the stems. These were similar to those observed elsewhere (3). Leaf spots further developed into localized necrotic areas. Using ELISA (Agdia, Elkhart, IN) with polyclonal antibodies, all collected samples showing symptoms tested positive for INSV and negative for Alfalfa mosaic virus (AMV), Cucumber mosaic virus (CMV), Potato X virus (PVX), Potato Y virus (PVY), Tobacco mosaic virus (TMV), Tomato spotted wilt virus (TSWV), Tobacco ringspot virus (TRSV), and Tomato ringspot virus (ToRSV). In order to identify the causal agent of these symptoms, INSV-specific sequences available for the S genomic fragments were obtained from NCBI GenBank. They were aligned and used to design primers to amplify a 250-bp fragment from total extracted RNA from healthy and symptomatic plants using reverse transcription (RT)-PCR. Primers used were INSVF (5′CCCAACTGCCTCTTTAGTGC3′) and INSVR (5′GGACAATGGATCTGCTCTGA3′). Three extracted plasmids, each containing an amplified and cloned fragment for the pepper and tomatillo isolates, were sequenced (GenBank Accession Nos. KC503051 and KC503052, respectively). Both nucleotide sequences showed 95% identity with the Chinese, Italian, and Japanese INSV sequences (FN400773, DQ425096, and AB207803, respectively) and 94% identity to other INSV isolates (4). The putative Mexican INSV pepper isolate, derived from a necrotic spot, was mechanically inoculated to other experimental host plants after grinding 1 g of symptomatic leaf tissue in 3 ml of a buffer with quaternary ammonium salts at 0.5%, pH 7.8. Ten plants, at the second true-leaf stage, of each Capsicum annuum cv. cannon and Citrullus lanatus were inoculated after carborundum abrasion of the second true leaf. At 15 days post inoculation, systemic chlorotic necrotic spots, stunting, and apical malformation were observed in capsicum plants while wilting was shown in watermelon plants. RT-PCR analyses and nucleotide sequence of the amplified product confirmed the presence and identity of both virus isolates. To our knowledge, this is the first report of INSV in Mexico found naturally in tomatillo and pepper and experimentally in watermelon plants. Derived from this report, INSV distribution in Mexico should be studied due to its potential impact on these two economically important crops. References: (1) Food and Agriculture Organization of the United Nations. FAOSTAT, retrieved online at http://faostat.fao.org , 2013. (2) DGSV-CNRF. Impatiens necrotic spot virus (INSV). SAGARPA-SENASICA. México, 2011. (3) M. Ding et al. Plant Dis. 95:357, 2011. (4) I. Mavrič et al. Plant Dis. 85:12, 2001.

scholarly journals First Report of Tomato spotted wilt virus on Gloxinia in Bosnia and Herzegovina

Plant Disease ◽  
2013 ◽  
Vol 97 (3) ◽  
pp. 429-429 ◽  
Author(s):  
V. Trkulja ◽  
J. Mihić Salapura ◽  
B. Ćurković ◽  
I. Stanković ◽  
A. Bulajić ◽  
...  
Keyword(s):  
Bosnia And Herzegovina ◽  
Tomato Spotted Wilt Virus ◽  
Amino Acid Identity ◽  
N Gene ◽  
Impatiens Necrotic Spot Virus ◽  
Post Inoculation ◽  
Rt Pcr ◽  
First Report ◽  
Tomato Spotted Wilt ◽  
Wilt Virus

In June and July 2012, symptoms resembling those caused by a tospovirus infection were observed on the greenhouse-grown gloxinia (Sinningia speciosa Benth. and Hook.) in the Lijevče polje, in the vicinity of Banja Luka (Bosnia and Herzegovina). Infected plants exhibited chlorotic ring spots and chlorotic and necrotic patterns followed by necrosis and distortion of leaves. Disease symptom incidence was estimated at 30% out of 400 inspected plants. Symptomatic leaves were collected and tested by double-antibody sandwich (DAS)-ELISA test using commercial polyclonal antisera (Bioreba AG, Reinach, Switzerland) for two of the most important tospoviruses in the greenhouse production of ornamentals: Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) (2). TSWV was detected serologically in 27 out of 30 tested gloxinia samples, and all were negative for INSV. Symptomatic leaves of five selected ELISA-positive gloxinia plants were separately ground in chilled 0.01 M phosphate buffer (pH 7) containing 0.1% w/v sodium sulphite and were mechanically inoculated on five plants of Petunia × hybrida. All inoculated plants produced typical symptoms of TSWV (1), necrotic spots on inoculated leaves in 2 to 5 days post-inoculation. For further confirmation of TSWV infection, total RNAs were extracted using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) from all 27 infected gloxinia plants and tested by reverse transcription (RT)-PCR assay. A 738-bp fragment of TSWV nucleocapsid (N) gene was amplified with One-Step RT-PCR Kit (Qiagen) using primer pairs TSWV CP-f and TSWV CP-r (4). Total RNAs from Serbian tobacco TSWV isolate (GenBank Accession No. GQ373173) and RNA extract from healthy gloxinia plants were used as positive and negative controls, respectively. Amplicons of the expected size were obtained from all 27 naturally infected gloxinia plants, while no amplification products were obtained from the healthy control. After the purification with QIAquick PCR Purification Kit (Qiagen), the RT-PCR product obtained from one selected isolate 160-12 was sequenced directly in both directions and submitted to GenBank (JX468079). Sequence analysis of the partial N gene, conducted by MEGA5 software (3), from isolate 160-12 showed the highest nucleotide identity of 99.7% (100% amino acid identity) with eight pepper isolates of TSWV from Spain (FR693229, FR693231, FR693152-153, FR693078, FR693081, FR693089, and FR693092). To our knowledge, this is the first report on the occurrence of TSWV in Bosnia and Herzegovina. The presence of this harmful pathogen into a new area could have a serious threat to intensive and increasing production of ornamentals and numerous other TSWV susceptible species in Bosnia and Herzegovina. The discovery of TSWV on gloxinia should prompt more surveys, thorough inspections, and subsequent testing of other TSWV susceptible plants cultivated in Bosnia and Herzegovina. References: (1) Anonymous. OEPP/EPPO Bull. 34:271, 2004. (2) Daughtrey et al. Plant Dis. 81:1220, 1997. (3) K. Tamura et al. Mol. Biol. Evol. 28:2731, 2011. (4) A. Vučurović et al. Eur. J. Plant Pathol. 133:935, 2012.

scholarly journals First Report of Tomato spotted wilt virus on Chrysanthemum in Serbia

Plant Disease ◽  
2013 ◽  
Vol 97 (1) ◽  
pp. 150-150 ◽  
Author(s):  
I. Stanković ◽  
A. Bulajić ◽  
A. Vučurović ◽  
D. Ristić ◽  
K. Milojević ◽  
...  
Keyword(s):  
Tomato Spotted Wilt Virus ◽  
Disease Incidence ◽  
N Gene ◽  
Impatiens Necrotic Spot Virus ◽  
Maximum Parsimony Tree ◽  
Rt Pcr ◽  
First Report ◽  
Tomato Spotted Wilt ◽  
Negative Controls ◽  
Wilt Virus

In July 2011, greenhouse-grown chrysanthemum hybrid plants (Chrysanthemum × morifolium) with symptoms resembling those associated with tospoviruses were observed in the Kupusina locality (West Bačka District, Serbia). Disease incidence was estimated at 40%. Symptomatic plants with chlorotic ring spots and line patterns were sampled and tested by double antibody sandwich (DAS)-ELISA using polyclonal antisera (Bioreba AG, Reinach, Switzerland) against the two of the most devastating tospoviruses in the greenhouse floriculture industry: Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) (2). Commercial positive and negative controls and extracts from healthy chrysanthemum tissue were included in each ELISA. TSWV was detected serologically in 16 of 20 chrysanthemum samples and all tested samples were negative for INSV. The virus was mechanically transmitted from ELISA-positive chrysanthemum samples to five plants each of both Petunia × hybrida and Nicotiana tabacum ‘Samsun’ using chilled 0.01 M phosphate buffer (pH 7) containing 0.1% sodium sulfite. Inoculated plants produced local necrotic spots and systemic chlorotic/necrotic concentric rings, consistent with symptoms caused by TSWV (1). The presence of TSWV in ELISA-positive chrysanthemum plants and N. tabacum‘Samsun’ was further confirmed by conventional reverse transcription (RT)-PCR. Total RNAs were extracted with an RNeasy Plant Mini Kit (Qiagen, Hilden, Germany). RT-PCR was performed with the One-Step RT-PCR Kit (Qiagen) using primers TSWVCP-f/TSWVCP-r specific to the nucleocapsid protein (N) gene (4). A Serbian isolate of TSWV from tobacco (GenBank Accession No. GQ373173) and RNA extracted from a healthy chrysanthemum plant were used as positive and negative controls, respectively. An amplicon of the correct predicted size (738-bp) was obtained from each of the plants assayed, and that derived from chrysanthemum isolate 529-11 was purified (QIAqick PCR Purification Kit, Qiagen) and sequenced (JQ692106). Sequence analysis of the partial N gene, conducted with MEGA5 software, revealed the highest nucleotide identity of 99.6% (99% amino acid identity) with 12 TSWV isolates deposited in GenBank originating from different hosts from Italy (HQ830186-87, DQ431237-38, DQ398945), Montenegro (GU355939-40, GU339506, GU339508), France (FR693055-56), and the Czech Republic (AJ296599). The consensus maximum parsimony tree obtained on a 705-bp partial N gene sequence of TSWV isolates available in GenBank revealed that Serbian TSWV isolate 529-11 from chrysanthemum was clustered in the European subpopulation 2, while the Serbian isolates from tomato (GU369723) and tobacco (GQ373172-73 and GQ355467) were clustered in the European subpopulation 1 denoted previously (3). The distribution of TSWV in commercial chrysanthemum crops is wide (2). To our knowledge, this is the first report of TSWV infecting chrysanthemum in Serbia. Since chrysanthemum popularity and returns have been rising rapidly, the presence of TSWV may significantly reduce quality of crops in Serbia. References: (1) Anonymous. OEPP/EPPO Bull. 34:271, 2004. (2) Daughtrey et al. Plant Dis. 81:1220, 1997. (3) I. Stanković et al. Acta Virol. 55:337, 2011. (4) A. Vučurović et al. Eur. J. Plant Pathol. 133:935, 2012.

scholarly journals First Report of Impatiens necrotic spot virus Infecting Lettuce in California

Plant Disease ◽  
2008 ◽  
Vol 92 (8) ◽  
pp. 1248-1248 ◽  
Author(s):  
S. T. Koike ◽  
Y.-W. Kuo ◽  
M. R. Rojas ◽  
R. L. Gilbertson
Keyword(s):  
Frankliniella Occidentalis ◽  
Disease Incidence ◽  
Pcr Analysis ◽  
Impatiens Necrotic Spot Virus ◽  
Vegetable Crops ◽  
Necrotic Spot ◽  
Rt Pcr ◽  
Spot Virus ◽  
First Report ◽  
Monterey County

Impatiens necrotic spot virus (INSV; family Bunyaviridae, genus Tospovirus) is an important pathogen of ornamental plants in North America and Europe, particularly in the greenhouse industry (2,3). However, INSV is now emerging as a pathogen of vegetable crops. During the 2006 and 2007 growing seasons, lettuce (Lactuca sativa) in Monterey County, CA showed necrotic spotting, leaf chlorosis, and plant stunting typical of symptoms induced by Tomato spotted wilt virus (TSWV). Significant and damaging outbreaks of these disease symptoms were found in numerous romaine, greenleaf, redleaf, butterhead, and iceberg lettuce fields in Monterey and San Benito counties. Samples from symptomatic plants from 21 of 27 fields in Monterey County were negative when tested with TSWV immunostrips (Agdia, Elkhart, IN); however, tests of the TSWV-negative samples with INSV immunostrips were positive. In most fields where INSV was detected, disease development was limited to the edges of fields and disease incidence was <5%; however, some fields had incidences >50% and crop loss was experienced. The virus causing the tospovirus symptoms in the TSWV-negative lettuce was sap transmitted to Nicotiana benthamiana and lettuce, where it induced chlorosis and necrosis. Symptoms in N. benthamiana were consistent with INSV infection, and those in lettuce were similar to symptoms observed in the field. Immunostrip tests confirmed that symptomatic N. benthamiana and lettuce plants were infected with INSV. To further confirm the identity of this virus, reverse transcription (RT)-PCR analysis was conducted with an INSV primer pair that directs the amplification of a ~1.3-kb fragment from the small RNA of INSV (4). The 1.3-kb fragment was amplified from RNA from symptomatic lettuce plants that were INSV positive with immunostrips, and not from asymptomatic lettuce. A total of 38 of 54 samples showing tospovirus-like symptoms were confirmed to be infected with INSV by RT-PCR. Sequences of two representative 1.3-kb DNA fragments were 98 to 99% identical with sequences of INSV isolates from Japan, Italy, and The Netherlands (GenBank Accession Nos. AB109100, DQ425096, and X66972). Taken together with the previous identification of the INSV vector, the western flower thrips (Frankliniella occidentalis), in central California lettuce (1), these results confirm that INSV induced tospovirus symptoms in lettuce fields in Monterey County in 2007. To our knowledge, this is the first report of the occurrence of INSV infecting lettuce in California. References: (1) W. E. Chaney. Annu. Rep. California Lettuce Res. Board. 2006. (2) M. Daughtrey et al. Plant Dis. 81:1220, 1997. (3) M. D. Law and J. W. Moyer. J. Gen. Virol. 71:933, 1990. (4) R. A. Naidu et al. Online publication. doi: 10.1094/PHP-2005-0727-01-HN. Plant Health Progress, 2005.

scholarly journals First Report of Impatiens necrotic spot virus Infecting Phalaenopsis and Dendrobium Orchids in Yunnan Province, China

Plant Disease ◽  
2010 ◽  
Vol 94 (7) ◽  
pp. 915-915 ◽  
Author(s):  
Q. Zhang ◽  
Y.-M. Ding ◽  
M. Li
Keyword(s):  
Tissue Culture ◽  
Yunnan Province ◽  
N Gene ◽  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Spot Virus ◽  
First Report ◽  
Chlorotic Spot ◽  
Consensus Sequences ◽  
Groundnut Bud Necrosis Virus

In November 2007, leaves of 79 Phalaenopsis and two Dendrobium orchid plants in a nursery in Yunnan Province showed large chlorotic/necrotic ringspot symptoms. Eight symptomatic leaves from Phalaenopsis and two from Dendrobium were sampled and tested for Impatiens necrotic spot virus (INSV), Tomato spotted wilt virus (TSWV), Watermelon silver mottle virus (WSMoV), Groundnut bud necrosis virus (GBNV), Tomato chlorotic spot virus (TCSV), and Groundnut ringspot virus (GRSV) with double-antibody sandwich (DAS)-ELISA kits (Agdia Inc., Elkhart, IN). All samples were positive for INSV and negative for TSWV, WSMoV, GBNV, TCSV, and GRSV. Total RNA extracts were prepared from all ELISA-positive samples with the RNeasy extraction kit (Huashun Inc., Shanghai, China). Reverse transcription (RT)-PCR was carried out with specific primers to the INSV N gene (ZI2F, 5′-GTTTAGCCTTACCAAT-3′ and ZI2R, 5′-TACCAACAACCGTGAA-3′), designed from a sequence of GenBank Accession No. AB109100. All ELISA-positive samples yielded an amplification product of the expected 539 bp as observed by gel electrophoresis in 1% agarose. Three clones from each isolate were sequenced and two N gene consensus sequences of the isolates from Phalaenopsis and Dendrobium were determined (GenBank Nos. GU289904 and GU289905, respectively). Nucleotide sequences of these two Chinese orchid isolates were 98 to 99% identical with sequences of isolates from the Netherlands, United States, Italy, and Japan (GenBank Nos. X66972, D00914, DQ425096 and AB109100, respectively). To our knowledge, this is the first report of INSV infecting Phalaenopsis and Dendrobium in Yunnan Province, although INSV has been reported in Oncidium in Yunnan Province previously (2), and the first time that INSV has been detected in Dendrobium. An investigation of the orchid nurseries looking for the thrips vector (1) of INSV was performed and a few thrips were found, suggesting that thrips may not be responsible for the observed prevalence of INSV in these nurseries. The orchids were imported from Taiwan and reproduced by tissue culture and it is possible that INSV found to be infecting orchids in these Yunnan nurseries may be from the infected source plant and was not eradicated completely through tissue culture. To reduce spread of INSV, virus-free tissue culture should be a priority for orchid production. References: (1). S. T. Koike and D. E. Mayhew. Orchids. Mag. Am. Orchid Soc. 70:746, 2001. (2). Q. Zhang et al. Plant Quarantine. 22:348, 2008.

scholarly journals First Report of Impatiens necrotic spot virus on Hiemalis Begonia (Begonia × hiemalis) in Canada

Plant Disease ◽  
2013 ◽  
Vol 97 (2) ◽  
pp. 291-291 ◽  
Author(s):  
X. Tian ◽  
Y. Zheng ◽  
K. Chintaluri ◽  
B. Meng
Keyword(s):  
The United States ◽  
Economic Losses ◽  
N Gene ◽  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Spot Virus ◽  
First Report ◽  
Initial Symptoms ◽  
Necrotic Spots ◽  
The Impact

Impatiens necrotic spot virus (INSV) is a member of the genus Tospovirus, and one of the prevalent viruses infecting ornamental plants, including begonia. Since the late 1980s, it has caused dramatic and unusual diseases on many flower crops, leading to considerable economic losses to the greenhouse floriculture industry (1). The western flower thrips, Frankliniella occidentalis (Pergande), is the only species currently known to vector INSV (1). In spring 2012, stunted plant growth and necrotic spots were observed on leaves of all Hiemalis begonias (Begonia × hiemalis Fotsch.) in a greenhouse in southwest Ontario, Canada. Initial symptoms were mosaic patterns, followed by necrotic spots on leaves, concentric rings, then necrotic areas on flowers, stem and vein necrosis, and finally stunting and burning of foliage similar to damage caused by sunburn or chemical injury. Thrips were observed colonizing nearby begonia plants. Leaf tissue from five symptomatic plants tested positive for INSV in a double-antibody sandwich (DAS)-ELISA with INSV-specific ImmunoStrips (Agdia Inc., Elkhart, IN). To confirm this, five of the leaf samples that were found to be positive for INSV in ELISA tests were mechanically inoculated to 10 plants of Hiemalis Begonia. Out of the 10 inoculated plants, eight produced necrotic local lesions and necrotic spots that are typical of INSV infection, followed by systemic infection of upper leaves 30 days after inoculation. The presence of INSV in the eight symptomatic plants was confirmed using the commercial INSV Pocket Diagnostic Kit (Forsite Diagnostics Ltd., York, UK) according to the manufacturer's instructions. Results showed that all eight symptomatic plants were positive for INSV. The other two plants were asymptomatic and tested negative for INSV. To further confirm the identity of this virus, total RNAs were isolated from symptomatic leave of begonia plants using TRIzol reagent (Invitrogen, Life Technologies Grand Island, NY) and amplified using reverse transcription (RT)-PCR analysis. A pair of primers was designed based on the consensus sequence of the N gene for a number of isolates retrieved from GenBank. These primers were INSV-F2286 (5′CCAAGCTCAACATGTTTAGC 3′, nt positions 2286 to 2305 of AB109100) and INSV-R2604 (5′ACTGCATCTTGCCTATCCTT 3′, nt positions 2664 to 2683 of AB109100). The expected amplification product of 398 bp was obtained, and was cloned into the vector pGEM-T Easy (Promega Corp., Madison, WI). Two clones were sequenced using the vector primer M13Forward. The sequences of these two clones were identical and the sequence was deposited in GenBank (Accession No. JX846907). BLAST analysis indicated that the sequence was 98 to 99% identical to INSV isolates from Japan (AB109100), the United States (D00914), and the Netherlands (X66972). To our knowledge, this is the first report of INSV infection in Begonia × hiemalis in Canada. This finding provides further evidence for the spread of the virus within North America. Further studies are required to determine the impact of INSV on the begonia industry in Canada and to determine viable management strategies, if necessary. Reference: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997.

scholarly journals First Report of Watermelon mosaic virus Infecting Melon and Watermelon in Bosnia and Herzegovina

Plant Disease ◽  
2014 ◽  
Vol 98 (12) ◽  
pp. 1749-1749 ◽  
Author(s):  
V. Trkulja ◽  
J. Vasić ◽  
B. Vuković ◽  
I. Stanković ◽  
A. Vučurović ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Bosnia And Herzegovina ◽  
Citrullus Lanatus ◽  
Economic Losses ◽  
Watermelon Mosaic Virus ◽  
Post Inoculation ◽  
Rt Pcr ◽  
First Report ◽  
Leaf Deformation ◽  
Negative Controls

Hereby the expansion of host range of Watermelon mosaic virus (WMV, Potyvirus, Potyviridae), found previously on zucchini in Bosnia and Herzegovina (3), to two new hosts is reported. Also, this is the first finding of WMV “emerging” (EM) isolate causing more severe symptoms in some cucurbits than “classic” (CL) isolates (1). During a July 2013 survey to determine the presence of WMV on cucurbits in Bosnia and Herzegovina, in the Kosijerovo locality (Laktaši Municipality, Bosnia and Herzegovina), virus-like symptoms were observed on 10% of plants. Severe mosaic, puckering, and leaf deformation as well as necrosis and leaf distortion were observed in a melon (Cucumis melo L.) crop, while mosaic, green vein banding, and leaf curling with reduced leaf size were observed in watermelon (Citrullus lanatus [Thunb.] Matsum and Nakai). Sampled melon and watermelon plants were tested for the presence of WMV with commercial double-antibody sandwich (DAS)-ELISA kit (Bioreba, AG, Reinach, Switzerland). Commercial positive and negative controls were included in each assay. Out of the 30 melon and 25 watermelon plants tested, 24 and 23 samples were positive for WMV, respectively, while no other cucurbit viruses were detected. The virus was mechanically transmitted from one of each of ELISA-positive melon (309-13) and watermelon (314-13) samples to five plants of each Cucurbita pepo ‘Ezra F1’, C. melo ‘Ananas,’ and C. lanatus ‘Creamson sweet’ using 0.01 M phosphate buffer (pH 7). Mild to severe mosaic and bubbling followed by leaf deformation were observed in all inoculated plants 10 to 14 days post-inoculation, regardless the isolate. Serological detection was verified with reverse transcription (RT)-PCR using the One-Step RT-PCR Kit (Qiagen, Hilden, Germany) with primers WMV 5′ and WMV 3′ (1), designed to amplify a 402- to 408-bp fragment overlapping the N-terminal part of the coat protein (CP) gene. Total RNAs were extracted with the RNeasy Plant Mini Kit (Qiagen). Total RNAs from the Serbian WMV oil pumpkin isolate (GenBank Accession No. JF325890) and RNA from healthy melon and watermelon plants were used as positive and negative controls, respectively. An amplicon of the expected size was produced from all serologically positive melon and watermelon plants, but not from healthy tissues. The RT-PCR products derived from isolates 309-13 and 314-13 were sequenced directly (KJ603311 and KM212956, respectively) and compared with WMV sequences available in GenBank. Sequence analysis revealed 91.5% nucleotide (nt) identity (94.6% amino acid [aa] identity) between the two WMV isolates. The melon WMV isolate shared the highest nt identity of 100% with four WMV isolates from Slovakia (GQ241712 to 13), Serbia (FJ325890), and Bosnia and Herzegovina (KF517099), while the sequence of isolate 314-13 had the highest nt identity with three Serbian isolates (JX262104 to 05 and JX262114) of 99.7% (99.2% aa identity). Phylogenetic analyses placed isolate 309-13 with CL isolates, while isolate 314-13 clustered with EM isolates (1,2). To our knowledge, this is the first report of WMV on melon and watermelon and the first report on EM isolates in Bosnia and Herzegovina. This could cause significant economic losses and become a limiting factor for cucurbit production with the potential of EM isolates to rapidly replace CL (2). References: (1) C. Desbiez et al. Arch. Virol. 152:775, 2007. (2) C. Desbiez et al. Virus Res. 152:775, 2009. (3) V. Trkulja et al. Plant Dis. 98:573, 2014.

scholarly journals Spinach (Spinacia oleracea) is a New Natural Host of Impatiens necrotic spot virus in California

Plant Disease ◽  
2009 ◽  
Vol 93 (6) ◽  
pp. 673-673 ◽  
Author(s):  
H.-Y. Liu ◽  
J. L. Sears ◽  
B. Mou
Keyword(s):  
Mosaic Virus ◽  
Spinacia Oleracea ◽  
The United States ◽  
Natural Host ◽  
N Gene ◽  
Impatiens Necrotic Spot Virus ◽  
Mechanical Transmission ◽  
Necrotic Spot ◽  
Rt Pcr ◽  
Spot Virus

Spinach (Spinacia oleracea) plants exhibiting severe stunting and leaves that showed interveinal yellowing, thickening, and deformation were found in an experimental trial adjacent to an artichoke field in Monterey County, CA in October of 2008. Percent incidence of symptomatic plants ranged from 20 to 39% in cvs. Bordeaux, Lazio, and Tigercat. Symptomatic plants were positive for Impatiens necrotic spot virus (INSV; family Bunyaviridae, genus Tospovirus) and were negative for Tomato spotted wilt virus, Cucumber mosaic virus, and Tobacco mosaic virus when tested with immunostrips (Agdia Inc., Elkhart, IN). The INSV-positive spinach was used for mechanical transmission to Nicotiana benthamiana, Chenopodium quinoa, and spinach. All inoculated plants were positive for INSV with immunostrips. To further confirm the presence of INSV, reverse transcription (RT)-PCR was conducted. Total RNA was extracted from the symptomatic spinach plants using a RNeasy Plant Kit (Qiagen Inc., Valencia, CA) and used as a template in RT-PCR using forward (5′-GGATGTAAGCCCTTCTTTGTAGTGG-3′) and reverse (5′-CCTTCCAAGTCACCCTCTGATTG-3′) primers specific to the INSV nucleoprotein (N) gene (GenBank Accession No. DQ425096). Amplicons of the expected size (approximately 364 bp) were obtained from both field-infected and mechanically inoculated spinach plants. Four amplicons were sequenced and compared with INSV N gene sequence in GenBank to confirm the identity of the products. Sequences obtained had 99% nucleotide identity with INSV sequences available under the GenBank Accession Nos. L20885, DQ523597, DQ523598, X66872, L20886, D00914, AB109100, and DQ425096. INSV can be one of the most serious viral pathogens of ornamental plants in North America and Europe. The host range of INSV is expanding and recent reports of INSV infection of vegetables include lettuce, peppers, peanut, and potato (1–4). To our knowledge, this is the first report of natural occurrence of INSV in spinach in California. Since INSV is vectored by thrips, its expanding natural host could make it an economically important problem in California and the United States. References: (1) S. T. Koike et al. Plant Dis. 92:1248, 2008. (2) R. A. Naidu et al. Online publication. doi:10.1094/PHP-2005-0727-01-HN, Plant Health Progress, 2005. (3) S. S Pappu et al. Plant Dis. 83:966, 1999. (4) K. L. Perry et al. Plant Dis. 89:340, 2005.

Sign in / Sign up

Export Citation Format

Share Document