Spinach (Spinacia oleracea) is a New Natural Host of Impatiens necrotic spot virus in California

Spinach (Spinacia oleracea) plants exhibiting severe stunting and leaves that showed interveinal yellowing, thickening, and deformation were found in an experimental trial adjacent to an artichoke field in Monterey County, CA in October of 2008. Percent incidence of symptomatic plants ranged from 20 to 39% in cvs. Bordeaux, Lazio, and Tigercat. Symptomatic plants were positive for Impatiens necrotic spot virus (INSV; family Bunyaviridae, genus Tospovirus) and were negative for Tomato spotted wilt virus, Cucumber mosaic virus, and Tobacco mosaic virus when tested with immunostrips (Agdia Inc., Elkhart, IN). The INSV-positive spinach was used for mechanical transmission to Nicotiana benthamiana, Chenopodium quinoa, and spinach. All inoculated plants were positive for INSV with immunostrips. To further confirm the presence of INSV, reverse transcription (RT)-PCR was conducted. Total RNA was extracted from the symptomatic spinach plants using a RNeasy Plant Kit (Qiagen Inc., Valencia, CA) and used as a template in RT-PCR using forward (5′-GGATGTAAGCCCTTCTTTGTAGTGG-3′) and reverse (5′-CCTTCCAAGTCACCCTCTGATTG-3′) primers specific to the INSV nucleoprotein (N) gene (GenBank Accession No. DQ425096). Amplicons of the expected size (approximately 364 bp) were obtained from both field-infected and mechanically inoculated spinach plants. Four amplicons were sequenced and compared with INSV N gene sequence in GenBank to confirm the identity of the products. Sequences obtained had 99% nucleotide identity with INSV sequences available under the GenBank Accession Nos. L20885, DQ523597, DQ523598, X66872, L20886, D00914, AB109100, and DQ425096. INSV can be one of the most serious viral pathogens of ornamental plants in North America and Europe. The host range of INSV is expanding and recent reports of INSV infection of vegetables include lettuce, peppers, peanut, and potato (1–4). To our knowledge, this is the first report of natural occurrence of INSV in spinach in California. Since INSV is vectored by thrips, its expanding natural host could make it an economically important problem in California and the United States. References: (1) S. T. Koike et al. Plant Dis. 92:1248, 2008. (2) R. A. Naidu et al. Online publication. doi:10.1094/PHP-2005-0727-01-HN, Plant Health Progress, 2005. (3) S. S Pappu et al. Plant Dis. 83:966, 1999. (4) K. L. Perry et al. Plant Dis. 89:340, 2005.

Download Full-text

First Report of Impatiens necrotic spot virus in Gentiana macrophylla in China

Plant Disease ◽

10.1094/pdis-09-10-0685 ◽

2011 ◽

Vol 95 (3) ◽

pp. 357-357 ◽

Cited By ~ 1

Author(s):

M. Ding ◽

Y. Yin ◽

Q. Fang ◽

S. Li ◽

Z. Zhang

Keyword(s):

Sandwich Elisa ◽

N Gene ◽

Impatiens Necrotic Spot Virus ◽

Natural Occurrence ◽

Necrotic Spot ◽

Rt Pcr ◽

Spot Virus ◽

First Report ◽

Severe Stunting ◽

Gentiana Macrophylla

Large leaf gentian, Gentiana macrophylla Pall., known as Qin Jiao in Chinese, is a medicinal herb. Its root is most commonly used in Chinese traditional medicine to relieve rheumatic conditions and to remove damp-heat. During a survey in July 2009, large leaf gentian plants exhibiting foliar chlorotic and necrotic spots as well as severe stunting were collected in Lijiang County, Yunnan Province of China. Incidence of symptomatic plants ranged from 10 to 30% in the field. Symptomatic leaves from five different G. macrophylla plants were collected and tested for Impatiens necrotic spot virus (INSV), Tomato spotted wilt virus, Watermelon silver mottle virus, Groundnut bud necrosis virus, Tomato chlorotic spot virus, and Groundnut ringspot virus by double-antibody sandwich-ELISA kits (Agdia Inc., Elkhart, IN). All tested samples were positive only for INSV. To further confirm the presence of INSV, reverse transcription (RT)-PCR was conducted. Total RNA was extracted from the symptomatic large leaf gentian plants leaves with a RNeasy Plant Kit (Qiagen Inc., Valencia, CA) and used as a template in RT-PCR using forward (5′-CTT TGC TTT TTA GAA CTG TGC A-3′) and reverse (5′-AGA GCA ATT GTG TCA CGA ATA T-3′) primers specific to the partial INSV nucleoprotein (N) gene (GenBank No. DQ425096). Amplicons of the expected size (approximately 760 bp) were obtained from all ELISA-positive samples. Three clones were sequenced and the partial nucleocapsid protein genes consensus sequences of these isolates were determined (GenBank No. HQ317133). Nucleotide sequences of large leaf gentian isolates shared 98 to 99% nucleotide identity with INSV sequences of isolates from China, Italy, Japan, United States, and the Netherlands (GenBank Nos. FN400772, GQ336989, DQ425096, AB109100, D00914, AB109100, and X66972). INSV is one of the most serious viral pathogens of ornamental plants in North America, Europe, and Asia (1–3). To our knowledge, this is the first report of natural occurrence of INSV in G. macrophylla in China. References: (1) S. T. Koike. Plant Dis. 92:1248, 2008. (2) E. K. Tóth et al. Plant Dis. 91:331, 2007. (3) Q. Zhang et al. Plant Dis. 94:915, 2010.

Download Full-text

First Report of Impatiens necrotic spot virus on Hiemalis Begonia (Begonia × hiemalis) in Canada

Plant Disease ◽

10.1094/pdis-09-12-0868-pdn ◽

2013 ◽

Vol 97 (2) ◽

pp. 291-291 ◽

Cited By ~ 1

Author(s):

X. Tian ◽

Y. Zheng ◽

K. Chintaluri ◽

B. Meng

Keyword(s):

The United States ◽

Economic Losses ◽

N Gene ◽

Impatiens Necrotic Spot Virus ◽

Necrotic Spot ◽

Spot Virus ◽

First Report ◽

Initial Symptoms ◽

Necrotic Spots ◽

The Impact

Impatiens necrotic spot virus (INSV) is a member of the genus Tospovirus, and one of the prevalent viruses infecting ornamental plants, including begonia. Since the late 1980s, it has caused dramatic and unusual diseases on many flower crops, leading to considerable economic losses to the greenhouse floriculture industry (1). The western flower thrips, Frankliniella occidentalis (Pergande), is the only species currently known to vector INSV (1). In spring 2012, stunted plant growth and necrotic spots were observed on leaves of all Hiemalis begonias (Begonia × hiemalis Fotsch.) in a greenhouse in southwest Ontario, Canada. Initial symptoms were mosaic patterns, followed by necrotic spots on leaves, concentric rings, then necrotic areas on flowers, stem and vein necrosis, and finally stunting and burning of foliage similar to damage caused by sunburn or chemical injury. Thrips were observed colonizing nearby begonia plants. Leaf tissue from five symptomatic plants tested positive for INSV in a double-antibody sandwich (DAS)-ELISA with INSV-specific ImmunoStrips (Agdia Inc., Elkhart, IN). To confirm this, five of the leaf samples that were found to be positive for INSV in ELISA tests were mechanically inoculated to 10 plants of Hiemalis Begonia. Out of the 10 inoculated plants, eight produced necrotic local lesions and necrotic spots that are typical of INSV infection, followed by systemic infection of upper leaves 30 days after inoculation. The presence of INSV in the eight symptomatic plants was confirmed using the commercial INSV Pocket Diagnostic Kit (Forsite Diagnostics Ltd., York, UK) according to the manufacturer's instructions. Results showed that all eight symptomatic plants were positive for INSV. The other two plants were asymptomatic and tested negative for INSV. To further confirm the identity of this virus, total RNAs were isolated from symptomatic leave of begonia plants using TRIzol reagent (Invitrogen, Life Technologies Grand Island, NY) and amplified using reverse transcription (RT)-PCR analysis. A pair of primers was designed based on the consensus sequence of the N gene for a number of isolates retrieved from GenBank. These primers were INSV-F2286 (5′CCAAGCTCAACATGTTTAGC 3′, nt positions 2286 to 2305 of AB109100) and INSV-R2604 (5′ACTGCATCTTGCCTATCCTT 3′, nt positions 2664 to 2683 of AB109100). The expected amplification product of 398 bp was obtained, and was cloned into the vector pGEM-T Easy (Promega Corp., Madison, WI). Two clones were sequenced using the vector primer M13Forward. The sequences of these two clones were identical and the sequence was deposited in GenBank (Accession No. JX846907). BLAST analysis indicated that the sequence was 98 to 99% identical to INSV isolates from Japan (AB109100), the United States (D00914), and the Netherlands (X66972). To our knowledge, this is the first report of INSV infection in Begonia × hiemalis in Canada. This finding provides further evidence for the spread of the virus within North America. Further studies are required to determine the impact of INSV on the begonia industry in Canada and to determine viable management strategies, if necessary. Reference: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997.

Download Full-text

First Report of Impatiens necrotic spot virus in Mexico in Tomatillo and Pepper Plants

Plant Disease ◽

10.1094/pdis-01-13-0092-pdn ◽

2013 ◽

Vol 97 (8) ◽

pp. 1124-1124 ◽

Cited By ~ 5

Author(s):

B. E. González-Pacheco ◽

L. Silva-Rosales

Keyword(s):

Mosaic Virus ◽

Ringspot Virus ◽

Impatiens Necrotic Spot Virus ◽

Post Inoculation ◽

Necrotic Spot ◽

Rt Pcr ◽

Spot Virus ◽

First Report ◽

True Leaf ◽

Necrotic Spots

Mexico contributes 20% of the total worldwide pepper exports (1). Impatiens necrotic spot virus (INSV) (genus Tospovirus; family Bunyaviridae) has emerged and has possibly caused diseases in various crops and ornamentals in Mexico. INSV was treated as a quarantine virus in Mexico (2) but not anymore. During the growing seasons of 2009 to 2011, surveys were conducted in the counties of Guanajuato and Querétaro in the states of the same names. Sampling included tomatillo (Physalis ixocarpa) and pepper (Capsicum spp.) plantations where plants with possible viral symptoms were observed. The symptoms observed were dark necrotic spots on some leaves and on the stems. These were similar to those observed elsewhere (3). Leaf spots further developed into localized necrotic areas. Using ELISA (Agdia, Elkhart, IN) with polyclonal antibodies, all collected samples showing symptoms tested positive for INSV and negative for Alfalfa mosaic virus (AMV), Cucumber mosaic virus (CMV), Potato X virus (PVX), Potato Y virus (PVY), Tobacco mosaic virus (TMV), Tomato spotted wilt virus (TSWV), Tobacco ringspot virus (TRSV), and Tomato ringspot virus (ToRSV). In order to identify the causal agent of these symptoms, INSV-specific sequences available for the S genomic fragments were obtained from NCBI GenBank. They were aligned and used to design primers to amplify a 250-bp fragment from total extracted RNA from healthy and symptomatic plants using reverse transcription (RT)-PCR. Primers used were INSVF (5′CCCAACTGCCTCTTTAGTGC3′) and INSVR (5′GGACAATGGATCTGCTCTGA3′). Three extracted plasmids, each containing an amplified and cloned fragment for the pepper and tomatillo isolates, were sequenced (GenBank Accession Nos. KC503051 and KC503052, respectively). Both nucleotide sequences showed 95% identity with the Chinese, Italian, and Japanese INSV sequences (FN400773, DQ425096, and AB207803, respectively) and 94% identity to other INSV isolates (4). The putative Mexican INSV pepper isolate, derived from a necrotic spot, was mechanically inoculated to other experimental host plants after grinding 1 g of symptomatic leaf tissue in 3 ml of a buffer with quaternary ammonium salts at 0.5%, pH 7.8. Ten plants, at the second true-leaf stage, of each Capsicum annuum cv. cannon and Citrullus lanatus were inoculated after carborundum abrasion of the second true leaf. At 15 days post inoculation, systemic chlorotic necrotic spots, stunting, and apical malformation were observed in capsicum plants while wilting was shown in watermelon plants. RT-PCR analyses and nucleotide sequence of the amplified product confirmed the presence and identity of both virus isolates. To our knowledge, this is the first report of INSV in Mexico found naturally in tomatillo and pepper and experimentally in watermelon plants. Derived from this report, INSV distribution in Mexico should be studied due to its potential impact on these two economically important crops. References: (1) Food and Agriculture Organization of the United Nations. FAOSTAT, retrieved online at http://faostat.fao.org , 2013. (2) DGSV-CNRF. Impatiens necrotic spot virus (INSV). SAGARPA-SENASICA. México, 2011. (3) M. Ding et al. Plant Dis. 95:357, 2011. (4) I. Mavrič et al. Plant Dis. 85:12, 2001.

Download Full-text

First Report of Impatiens necrotic spot virus on Begonia in Bosnia and Herzegovina

Plant Disease ◽

10.1094/pdis-01-13-0088-pdn ◽

2013 ◽

Vol 97 (7) ◽

pp. 1004-1004 ◽

Cited By ~ 3

Author(s):

V. Trkulja ◽

J. Mihić Salapura ◽

B. Ćurković ◽

I. Stanković ◽

A. Bulajić ◽

...

Keyword(s):

Bosnia And Herzegovina ◽

Ornamental Plants ◽

N Gene ◽

Impatiens Necrotic Spot Virus ◽

Post Inoculation ◽

Necrotic Spot ◽

Rt Pcr ◽

Spot Virus ◽

First Report ◽

Negative Controls

Impatiens necrotic spot virus (INSV) and Tomato spotted wilt virus (TSWV) are the most serious viral pathogens in the production of ornamental plants in Europe and North America (1). During a survey for the presence of tospoviruses in July 2012, potted begonia hybrids (Begonia × tuberhybrida Voss) exhibiting foliar chlorotic rings and zonal spots accompanied by leaf necrosis and distortion, were observed in a greenhouse in the vicinity of Banja Luka (Bosnia and Herzegovina). Leaf samples collected from 12 symptomatic plants were analyzed for the presence of INSV and TSWV by commercial double-antibody sandwich (DAS)-ELISA kits (Bioreba AG, Reinach, Switzerland). Commercial positive and negative controls and extracts from healthy begonia leaves were included in each ELISA. INSV was detected serologically in all 12 begonia samples and all tested samples were negative for TSWV. Five healthy plants of each Petunia × hybrida and Nicotiana benthamiana were mechanically inoculated with sap from an ELISA-positive sample (157-12) using chilled 0.01 M phosphate buffer (pH 7) containing 0.1% sodium sulphite. Local necrotic lesions on P. × hybrida and systemic chlorotic mottling on N. benthamiana were observed on all inoculated plants 4 and 10 days post-inoculation, respectively. For further confirmation of INSV infection, total RNAs were extracted from all ELISA-positive begonia plants as well as mechanically inoculated N. benthamiana plants with the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and used as template in reverse transcription (RT)-PCR. RT-PCR was performed with the OneStep RT-PCR Kit (Qiagen) using primer pair INSV-589 and TOS-R15 (3), specific to the partial INSV nucleocapsid (N) gene. Total RNA obtained from Serbian INSV isolate from a begonia (GenBank Accession No. HQ724289) and RNA extracts from healthy begonia plants were used as positive and negative controls, respectively. All naturally and mechanically infected plants as well as the positive control yielded an amplicon of the expected size (589 bp), while no amplification products were obtained from the healthy controls. The RT-PCR product derived from the isolate 157-12 was sequenced directly after purification with QIAquick PCR Purification Kit (Qiagen) and submitted to GenBank (KC494869). Pairwise comparison of the 157-12 isolate N sequence with other homologous sequences available in GenBank, conducted using MEGA5 software (2), revealed that begonia isolate from Bosnia and Herzegovina showed the highest nucleotide identity of 99.7% (100% amino acid identity) with the Chinese INSV isolate (FN400772) originating from Oncidium sp. To our knowledge, this is the first report of INSV on begonia in Bosnia and Herzegovina. Begonias are very popular and widely grown ornamentals in Bosnia and Herzegovina and the presence of a new and devastating pathogen could represent a serious threat for its production. Since begonia is commonly grown together with numerous ornamental plants susceptible to INSV, further investigations are needed in order to prevent spread of this potentially harmful pathogen to new hosts in Bosnia and Herzegovina. References: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997. (2) K. Tamura et al. Mol. Biol. Evol. 28:2731, 2011. (3) H. Uga and S. Tsuda. Phytopathology 95:166, 2005.

Download Full-text

First Report of Impatiens necrotic spot virus (INSV) Infecting Basil (Ocimum basilicum) in the United States

Plant Disease ◽

10.1094/pdis-11-12-1101-pdn ◽

2013 ◽

Vol 97 (6) ◽

pp. 850-850 ◽

Cited By ~ 5

Author(s):

S. Poojari ◽

R. A. Naidu

Keyword(s):

United States ◽

Nucleotide Sequence ◽

Nucleotide Sequence Identity ◽

The United States ◽

Ocimum Basilicum ◽

Impatiens Necrotic Spot Virus ◽

Necrotic Spot ◽

Rt Pcr ◽

Spot Virus ◽

Sequence Identity

Basil (Ocimum basilicum L.), a native of India belonging to the Lamiaceae family, is an aromatic herb with distinctive aroma, and several commercial varieties are used extensively for culinary and ornamental purposes. During the summer of 2011 and 2012, potted plants of basil in a commercial greenhouse in the Richland-Kennewick area of Washington State were observed showing foliar symptoms consisting of chlorotic spots, ring spots, leaf distortion, and stem necrosis. In initial tests, extracts of symptomatic leaves were positive for Impatiens necrotic spot virus (INSV; genus Tospovirus, family Bunyaviridae), when tested with INSV immnunostrips (Agdia, Inc., Elkhart, IN). These samples were negative with immunostrips specific to Tomato spotted wilt virus (genus Tospovirus) and group-specific potyviruses. The virus from symptomatic leaves of basil was transmitted by leaf rub inoculation to Nicotiana benthamiana and Emilia sonchifolia, where it produced necrosis on inoculated leaves followed by systemic necrosis in the former and chlorotic spots and mosaic mottling in newly developed leaves in the latter. Symptomatic leaves from both host plants tested positive with INSV, but not with TSWV, immunostrips. For additional confirmation of INSV, total RNA was extracted from symptomatic leaves of basil using RNeasy Plant Minikit (Qiagen, Inc., Valencia, CA) and used for reverse transcription (RT)-PCR amplification of the nucleocapsid (N) gene using forward (5′-AGCTTAAATCAATAGTAGCA-3′) and reverse (5′-AGCTTCCTCAAGAATAGGCA-3′) primers. RT was carried out at 52°C for 60 min followed by denaturation at 94°C for 3 min. Subsequently, 35 cycles of PCR was carried out with each cycle consisting of 94°C for 1 min, 58°C for 45 s, and 72°C for 1 min, followed by a final extension step at 72°C for 10 min. The amplicons of about 610 nt obtained from RT-PCR were cloned into pTOPO2.1 vector (Invitrogen Corporation, Carlsbad, CA) and three independent clones were sequenced in both directions. Sequence analyses of these clones (GenBank Accession No. KC218475) showed 100% nucleotide sequence identity among themselves and 99% nucleotide sequence identity with INSV isolates from the United States (DQ523598, JX138531, and D00914) and a basil isolate (JQ724132) from Austria. These results further confirm the presence of INSV in symptomatic leaves of basil. Previously, basil has been reported to be naturally infected with TSWV in the United States (3) and INSV in Austria (2). Therefore, this study represents the first confirmed report of the virus in basil in the United States. No species of thrips vector was observed on the affected basil plants. The discovery of INSV in basil has important implications for the nursery industry due to the broad host range of the virus (1); stock plants may serve as a source of inoculum in production areas and infected plants could be distributed to homeowners. It is important for commercial nurseries to monitor for INSV to identify infected mother plants to prevent virus spread. Since more than 31 viruses belonging to 13 different genera have been reported in basil ( http://pvo.bio-mirror.cn/famly073.htm#Ocimumbasilicum ), further studies are in progress to determine if the observed symptoms on basil are only due to single infection of INSV. References: (1) M. Daughtrey et al. Plant Dis. 81:1220, 1997. (2). S. Grausgruber-Gröger. New Dis. Rep. 26:12, 2012. (3) G. E. Holcomb et al. Plant Dis. 83:966.

Download Full-text

Characterization and Epidemiology of Outbreaks of Impatiens necrotic spot virus on Lettuce in Coastal California

Plant Disease ◽

10.1094/pdis-07-13-0681-re ◽

2014 ◽

Vol 98 (8) ◽

pp. 1050-1059 ◽

Cited By ~ 10

Author(s):

Yen-Wen Kuo ◽

Robert L. Gilbertson ◽

Tom Turini ◽

Eric B. Brennan ◽

Richard F. Smith ◽

...

Keyword(s):

United States ◽

Frankliniella Occidentalis ◽

Spinacia Oleracea ◽

Disease Outbreaks ◽

Central Valley ◽

The United States ◽

Impatiens Necrotic Spot Virus ◽

Necrotic Spot ◽

Weed Species ◽

Spot Virus

California is the leading producer of lettuce (Lactuca sativa) for the United States and grows 77% of the country's supply. Prior to 2006, coastal California lettuce was only periodically and incidentally infected by a single tospoviruses species: Tomato spotted wilt virus (TSWV). However, beginning in 2006 and continuing through 2012, severe outbreaks of disease caused by Impatiens necrotic spot virus (INSV) have affected the coastal lettuce crop, though TSWV was also present. In contrast, TSWV was the only tospovirus associated with disease outbreaks in Central Valley lettuce during this period. Disease surveys conducted over two seasons (2008 and 2009) in 10 commercial fields (acreage of 6 to 20 ha) indicated that INSV was the only tospovirus associated with economically damaging disease outbreaks in lettuce in the coastal region, with incidences of 0.5 to 27% (mean = 5.7%). Molecular characterization of INSV isolates associated with these disease outbreaks revealed little genetic diversity and indicated that lettuce-infecting INSV isolates were nearly identical to those previously characterized from ornamental or other hosts from different locations in the United States and the world. Monitoring of thrips revealed moderate to large populations in all surveyed lettuce fields, and the majority of thrips identified from these fields were western flower thrips, Frankliniella occidentalis. There was significant positive correlation (r2 = 0.91, P = 0.003) between thrips populations and INSV incidence in the most commonly encountered type of commercial lettuce (romaine, direct seeded, conventional) included in this study. A reverse-transcription polymerase chain reaction assay developed for detection of INSV in thrips showed promise as a monitoring tool in the field. Surveys for INSV reservoir hosts in the coastal production area revealed that the weeds little mallow (Malva parvifolia) and shepherd's purse (Capsella bursa-pastoris) were commonly infected. M. parvifolia plants infected in the field did not show obvious symptoms, whereas plants of this species inoculated in the laboratory with INSV by sap transmission developed necrotic spots and chlorosis. Eleven other weed species growing in the lettuce production areas were found to be hosts of INSV. Coastal crops found to be infected with INSV included basil (Ocimum basilicum), bell pepper (Capsicum annuum), calla lily (Zantedeschia aethiopica), faba bean (Vicia faba), radicchio (Cichorium intybus), and spinach (Spinacia oleracea). Thus, it is likely that INSV was introduced into coastal California lettuce fields via viruliferous thrips that initially acquired the virus from other local susceptible plant species. Results of this study provide a better understanding of INSV epidemiology in coastal California and may help growers devise appropriate disease management strategies.

Download Full-text

First Report of Potato spindle tuber viroid Naturally Infecting Field Tomatoes in the Dominican Republic

Plant Disease ◽

10.1094/pdis-09-13-0992-pdn ◽

2014 ◽

Vol 98 (5) ◽

pp. 701-701

Author(s):

K.-S. Ling ◽

R. Li ◽

D. Groth-Helms ◽

F. M. Assis-Filho

Keyword(s):

United States ◽

Dominican Republic ◽

Mosaic Virus ◽

Potato Spindle Tuber Viroid ◽

The United States ◽

Disease Outbreak ◽

Ringspot Virus ◽

Rt Pcr ◽

Spot Virus ◽

Three Samples

In recent years, viroid disease outbreaks have resulted in serious economic losses to a number of tomato growers in North America (1,2,3). At least three pospiviroids have been identified as the causal agents of tomato disease, including Potato spindle tuber viroid (PSTVd), Tomato chlorotic dwarf viroid (TCDVd), and Mexican papita viroid (MPVd). In the spring of 2013, a severe disease outbreak with virus-like symptoms (chlorosis and plant stunting) was observed in a tomato field located in the Dominican Republic, whose tomato production is generally exported to the United States in the winter months. The transplants were produced in house. The disease has reached an epidemic level with many diseased plants pulled and disposed of accordingly. Three samples collected in May of 2013 were screened by ELISA against 16 common tomato viruses (Alfalfa mosaic virus, Cucumber mosaic virus, Impatiens necrotic spot virus, Pepino mosaic virus, Potato virus X, Potato virus Y, Tobacco etch virus, Tobacco mosaic virus, Tobacco ringspot virus, Tomato aspermy virus, Tomato bushy stunt virus, Tomato mosaic virus, Tomato ringspot virus, Tomato spotted wilt virus, Groundnut ringspot virus, and Tomato chlorotic spot virus), a virus group (Potyvirus group), three bacteria (Clavibacter michiganensis subsp. michiganensis, Pectobacterium atrosepticum, and Xanthomonas spp.), and Phytophthora spp. No positive result was observed, despite the presence of symptoms typical of a viral-like disease. Further analysis by RT-PCR using Agdia's proprietary pospiviroid group-specific primer resulted in positive reactions in all three samples. To determine which species of pospiviroid was present in these tomato samples, full-genomic products of the expected size (~360 bp) were amplified by RT-PCR using specific primers for PSTVd (4) and cloned using TOPO-TA cloning kit (Invitrogen, CA). A total of 8 to 10 clones from each isolate were selected for sequencing. Sequences from each clone were nearly identical and the predominant sequence DR13-01 was deposited in GenBank (Accession No. KF683200). BLASTn searches into the NCBI database demonstrated that isolate DR13-01 shared 97% sequence identity to PSTVd isolates identified in wild Solanum (U51895), cape gooseberry (EU862231), or pepper (AY532803), and 96% identity to the tomato-infecting PSTVd isolate from the United States (JX280944). The relatively lower genome sequence identity (96%) to the tomato-infecting PSTVd isolate in the United States (JX280944) suggests that PSTVd from the Dominican Republic was likely introduced from a different source, although the exact source that resulted in the current disease outbreak remains unknown. It may be the result of an inadvertent introduction of contaminated tomato seed lots or simply from local wild plants. Further investigation is necessary to determine the likely source and route of introduction of PSTVd identified in the current epidemic. Thus, proper control measures could be recommended for disease management. The detection of this viroid disease outbreak in the Dominican Republic represents further geographic expansion of the viroid disease in tomatoes beyond North America. References: (1). K.-S. Ling and M. Bledsoe. Plant Dis. 93:839, 2009. (2) K.-S. Ling and W. Zhang. Plant Dis. 93:1216, 2009. (3) K.-S. Ling et al. Plant Dis. 93:1075, 2009. (4) A. M. Shamloul et al. Can. J. Plant Pathol. 19:89, 1997.

Download Full-text

Detection of a Severe Isolate of Impatiens Necrotic Spot Virus Infecting Lisianthus in Florida

Plant Disease ◽

10.1094/pdis.1997.81.11.1334b ◽

1997 ◽

Vol 81 (11) ◽

pp. 1334-1334 ◽

Cited By ~ 3

Author(s):

R. J. McGovern ◽

J. E. Polston ◽

B. K. Harbaugh

Keyword(s):

Leaf Tissue ◽

Impatiens Necrotic Spot Virus ◽

Enzyme Linked Immunosorbent Assay ◽

Mechanical Transmission ◽

Necrotic Spot ◽

Spot Virus ◽

Eustoma Grandiflorum ◽

Systemic Necrosis ◽

Low Incidence ◽

Leaf Distortion

In May 1997, inclusions typical of a tospovirus were visualized by light microscopy in leaf tissue of lisianthus (Eustoma grandiflorum) exhibiting stunting, necrotic ringspots, leaf distortion, and systemic necrosis. Wilting and plant death were the final symptoms observed. Affected plants occurred at low incidence (<0.1%) in greenhouse-grown lisianthus in Manatee County, FL. Symptomatic tissue tested positive for impatiens necrotic spot virus (INSV) and negative for tomato spotted wilt virus (TSWV) with enzyme-linked immunosorbent assay (ELISA; Agdia, Elkhart, IN). Mechanical transmission of the virus to lisianthus and tomato was attempted by triturating 1 g of symptomatic leaf tissue in 7 ml of a buffer consisting of 0.01 M Tris and 0.01 M sodium sulfite, pH 7.3. Six plants of lisianthus cv. Maurine Blue and three of tomato (Lycopersicon esculentum) cv. Lanai at the second true-leaf stage were inoculated following abrasion of leaves with Carborundum. An equal number of controls were inoculated with buffer alone. Plants were maintained in a controlled environment chamber with a 12-h photoperiod, day/night temperatures of 21/16°C, and light intensity of 120 μE · s-l · m-2. Transmission rates were 100 and 0% to lisianthus and tomato, respectively. Chlorotic local lesions followed by chlorotic ringspots were observed in inoculated lisianthus leaves 4 days after inoculation. Stunting, leaf distortion, and necrotic ringspots appeared in noninoculated leaves of lisianthus plants within 3 to 4 weeks after inoculation. Buffer-inoculated lisianthus and all tomato plants remained symptomless and tested negative for INSV by ELISA. All symptomatic lisianthus tested positive for INSV by ELISA. The symptoms we observed in lisianthus due to infection by INSV were more severe than those previously reported in this host (1,2). The occurrence of such strains of INSV at high incidences could pose a significant threat for commercial lisianthus production. References: (1) M. K. Hausbeck et al. Plant Dis. 76:795, 1992. (2) H. T. Hsu and R. H. Lawson. Plant Dis. 75:292,1991.

Download Full-text

First Report of Natural Infection of Penstemon acuminatus with Cucumber mosaic virus in the Treasure Valley Region of Idaho and Oregon

Plant Disease ◽

10.1094/pdis-93-7-0762a ◽

2009 ◽

Vol 93 (7) ◽

pp. 762-762 ◽

Cited By ~ 1

Author(s):

R. K. Sampangi ◽

C. Almeyda ◽

K. L. Druffel ◽

S. Krishna Mohan ◽

C. C. Shock ◽

...

Keyword(s):

Cucumber Mosaic Virus ◽

Mosaic Virus ◽

Great Basin ◽

Natural Infection ◽

The United States ◽

Native Plant ◽

Rt Pcr ◽

Cmv Infection ◽

Spot Virus ◽

First Report

Penstemons are perennials that are grown for their attractive flowers in the United States. Penstemon species (P. acuminatus, P. deustus, and P. speciosus) are among the native forbs considered as a high priority for restoration of great basin rangelands. During the summer of 2008, symptoms of red spots and rings were observed on leaves of P. acuminatus (family Scrophulariaceae) in an experimental trial in Malheur County, Oregon where the seeds from several native forbs were multiplied for restoration of range plants in intermountain areas. These plants were cultivated as part of the Great Basin Native Plant Selection and Increase Project. Several native wildflower species are grown for seed production in these experimental plots. Plants showed red foliar ringspots and streaks late in the season. Fungal or bacterial infection was ruled out. Two tospoviruses, Impatiens necrotic spot virus and Tomato spotted wilt virus, and one nepovirus, Tomato ring spot virus, are known to infect penstemon (2,3). Recently, a strain of Turnip vein-clearing virus, referred to as Penstemon ringspot virus, was reported in penstemon from Minnesota (1). Symptomatic leaves from the penstemon plants were negative for these viruses when tested by ELISA or reverse transcription (RT)-PCR. However, samples were found to be positive for Cucumber mosaic virus (CMV) when tested by a commercially available kit (Agdia Inc., Elkhart, IN). To verify CMV infection, total nucleic acid extracts from the symptomatic areas of the leaves were prepared and used in RT-PCR. Primers specific to the RNA-3 of CMV were designed on the basis of CMV sequences available in GenBank. The primer pair consisted of CMV V166: 5′ CCA ACC TTT GTA GGG AGT GA 3′ and CMV C563: 5′ TAC ACG AGG ACG GCG TAC TT 3′. An amplicon of the expected size (400 bp) was obtained and cloned and sequenced. BLAST search of the GenBank for related sequences showed that the sequence obtained from penstemon was highly identical to several CMV sequences, with the highest identity (98%) with that of a sequence from Taiwan (GenBank No. D49496). CMV from infected penstemon was successfully transmitted by mechanical inoculation to cucumber seedlings. Infection of cucumber plants was confirmed by ELISA and RT-PCR. To our knowledge, this is the first report of CMV infection of P. acuminatus. With the ongoing efforts to revegetate the intermountain west with native forbs, there is a need for a comprehensive survey of pests and diseases affecting these plants. References: (1) B. E. Lockhart et al. Plant Dis. 92:725, 2008. (2) D. Louro. Acta Hortic. 431:99, 1996. (3) M. Navalinskiene et al. Trans. Estonian Agric. Univ. 209:140, 2000.

Download Full-text

First Report of Yellow Nutsedge (Cyperus esculentus) and Purple Nutsedge (C. rotundus) in Georgia Naturally Infected with Impatiens necrotic spot virus

Plant Disease ◽

10.1094/pdis.2004.88.7.771b ◽

2004 ◽

Vol 88 (7) ◽

pp. 771-771 ◽

Cited By ~ 8

Author(s):

N. Martínez-Ochoa ◽

S. W. Mullis ◽

A. S. Csinos ◽

T. M. Webster

Keyword(s):

Southeastern United States ◽

Impatiens Necrotic Spot Virus ◽

Cyperus Esculentus ◽

Necrotic Spot ◽

Rt Pcr ◽

Spot Virus ◽

Black Shank ◽

Purple Nutsedge ◽

Yellow Nutsedge ◽

Das Elisa

Impatiens necrotic spot virus (INSV), family Bunyaviridae, genus Tospovirus, is an emerging virus found mostly in ornamentals under greenhouse production. INSV has been detected in peanut (Arachis hypogaea L.) in Georgia and Texas (3) and recently in tobacco (Nicotiana tabacum L.) in the southeastern United States (2) but little is known about INSV distribution and impact on these crops. Noncrop plant hosts are likely to contribute to disease spread by serving as reservoirs for the virus and reproductive hosts for thrips (Frankliniella occidentalis Pergande), which transmit the virus. Yellow nutsedge, a native of North America, and purple nutsedge introduced from Eurasia, are considered serious weed problems in the southeastern United States. To date, there are no reports of natural INSV infections in these weeds. A survey was conducted at two research farms in Tift County, Georgia to determine if yellow and purple nutsedge plants were naturally infected with Tomato spotted wilt virus (TSWV) and INSV. The first field at the Black Shank Farm had been planted with flue-cured tobacco K-326 earlier in the year and fallow at the time of sampling. The second field at the Ponder Farm was planted at the time of sampling with yellow squash (Cucurbita pepo L.) and cabbage (Brassica oleracea L.). In early October 2002, 90 nutsedge plants were taken at random from each site. Leaf and root tissues of each of the nutsedge plants were tested for TSWV and INSV using double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) alkaline phosphatase antisera kits (Agdia Inc., Elkhart, IN). No visible symptoms of INSV or TSWV were observed. Samples from the field at the Black Shank Farm resulted in 2 of 26 positive for INSV in purple nutsedge plants and 6 of 64 in yellow nutsedge plants. At the Ponder Farm, 3 of 12 were positive for INSV in purple nutsedge plants and 14 of 78 in yellow nutsedge plants. None of the samples in either site tested positive for TSWV. The DAS-ELISA positive samples were verified for INSV using reverse transcription-polymerase chain reaction (RT-PCR) as previously described by Dewey et al. (1). Total RNA extracts were obtained from the DAS-ELISA positive nutsedge samples using RNeasy extraction kits (Qiagen Inc., Valencia, CA). The RT-PCR was carried out with primer 1F: 5′-TCAAG(C/T) CTTC(G/T)GAA(A/G)GTGAT 3′ (1) and primer 2R: 5′-ATGAACAAAGCAAAGATTACC 3′ specific to the 3′ end of the INSV N gene open reading frame (GenBank Accession No. NC003624). DAS-ELISA negative tissues of Cyperus esculentus L. and Emilia sonchifolia (L.) DC and an E. sonchifolia DAS-ELISA positive for INSV were included in the reactions as controls. All of the DAS-ELISA positive nutsedge samples yielded an amplification product with the expected size of 298 bp when PCR products were resolved by agarose (0.7%) gel electrophoresis. The relatively high occurrence of INSV found in the sampled fields may explain the recent increase in incidence of INSV in susceptible field crops. Although yellow nutsedge is more common than purple nutsedge in North America, the potential for dispersal of INSV in both species could be significant because of the nature of nutsedge tuber survival and spreading capabilities. References: (1) R. A. Dewey et al. J. Virol. Methods 56:19, 1996. (2) N. Martínez-Ochoa et al. On-line publication. doi:10.1094/PHP-2003-0417-01-HN. Plant Health Progress, 2003. (3) S. S. Pappu et al. Plant Dis. 83:966,1999.

Download Full-text