First Report of Impatiens necrotic spot virus Infecting Lettuce in California

Impatiens necrotic spot virus (INSV; family Bunyaviridae, genus Tospovirus) is an important pathogen of ornamental plants in North America and Europe, particularly in the greenhouse industry (2,3). However, INSV is now emerging as a pathogen of vegetable crops. During the 2006 and 2007 growing seasons, lettuce (Lactuca sativa) in Monterey County, CA showed necrotic spotting, leaf chlorosis, and plant stunting typical of symptoms induced by Tomato spotted wilt virus (TSWV). Significant and damaging outbreaks of these disease symptoms were found in numerous romaine, greenleaf, redleaf, butterhead, and iceberg lettuce fields in Monterey and San Benito counties. Samples from symptomatic plants from 21 of 27 fields in Monterey County were negative when tested with TSWV immunostrips (Agdia, Elkhart, IN); however, tests of the TSWV-negative samples with INSV immunostrips were positive. In most fields where INSV was detected, disease development was limited to the edges of fields and disease incidence was <5%; however, some fields had incidences >50% and crop loss was experienced. The virus causing the tospovirus symptoms in the TSWV-negative lettuce was sap transmitted to Nicotiana benthamiana and lettuce, where it induced chlorosis and necrosis. Symptoms in N. benthamiana were consistent with INSV infection, and those in lettuce were similar to symptoms observed in the field. Immunostrip tests confirmed that symptomatic N. benthamiana and lettuce plants were infected with INSV. To further confirm the identity of this virus, reverse transcription (RT)-PCR analysis was conducted with an INSV primer pair that directs the amplification of a ~1.3-kb fragment from the small RNA of INSV (4). The 1.3-kb fragment was amplified from RNA from symptomatic lettuce plants that were INSV positive with immunostrips, and not from asymptomatic lettuce. A total of 38 of 54 samples showing tospovirus-like symptoms were confirmed to be infected with INSV by RT-PCR. Sequences of two representative 1.3-kb DNA fragments were 98 to 99% identical with sequences of INSV isolates from Japan, Italy, and The Netherlands (GenBank Accession Nos. AB109100, DQ425096, and X66972). Taken together with the previous identification of the INSV vector, the western flower thrips (Frankliniella occidentalis), in central California lettuce (1), these results confirm that INSV induced tospovirus symptoms in lettuce fields in Monterey County in 2007. To our knowledge, this is the first report of the occurrence of INSV infecting lettuce in California. References: (1) W. E. Chaney. Annu. Rep. California Lettuce Res. Board. 2006. (2) M. Daughtrey et al. Plant Dis. 81:1220, 1997. (3) M. D. Law and J. W. Moyer. J. Gen. Virol. 71:933, 1990. (4) R. A. Naidu et al. Online publication. doi: 10.1094/PHP-2005-0727-01-HN. Plant Health Progress, 2005.

Download Full-text

First Report of Impatiens necrotic spot virus Infecting Greenhouse-Grown Potatoes in Washington State

Plant Disease ◽

10.1094/pdis-07-10-0542 ◽

2010 ◽

Vol 94 (12) ◽

pp. 1507-1507 ◽

Cited By ~ 7

Author(s):

J. M. Crosslin ◽

L. L. Hamlin

Keyword(s):

Frankliniella Occidentalis ◽

Solanum Tuberosum L ◽

Consensus Sequence ◽

Western Flower Thrips ◽

Alternaria Solani ◽

Impatiens Necrotic Spot Virus ◽

Necrotic Spot ◽

Feeding Damage ◽

Rt Pcr ◽

Spot Virus

In April and May 2010, leaves on approximately one-half of 200 potato (Solanum tuberosum L. cv. Atlantic) plants, 20 to 25 cm high, grown from prenuclear minitubers in greenhouses located at the USDA-ARS facility in Prosser, WA exhibited necrotic spots similar to those produced by the early blight pathogen, Alternaria solani. Fungicide sprays did not reduce incidence of the symptoms. Observations associated the symptoms with thrips feeding damage so plants were tested for Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) with ImmunoStrips from Agdia, Inc (Elkhart, IN). Three of three, two of two, and two of two symptomatic plants from three greenhouses were positive for INSV and negative for TSWV. Two symptomless plants tested negative. Four of four symptomatic and zero of two symptomless plants were positive by reverse transcription (RT)-PCR with INSV specific primers (forward: 5′ TAACACAACACAAAGCAAACC 3′ and reverse: 5′ CCAAATACTACTTTAACCGCA 3′) (4). The 906-bp amplicon from one sample was cloned and three clones were sequenced. The three clones were 99.7% identical, and BLAST analysis of the consensus sequence (GenBank Accession No. HM802206) showed 99% identity to INSV accessions D00914 and X66972, and 98% identity to other INSV isolates. The isolate, designated INSV pot 1, was mechanically inoculated to one plant of potato cv. GemStar and produced local, spreading necrotic lesions. The virus did not go systemic, as determined by RT-PCR of upper leaves 30 days after inoculation. The local necrotic lesions on GemStar were positive for INSV by ImmunoStrips and RT-PCR. The original source of the INSV inoculum is unknown. However, hairy nightshade (Solanum sarrachoides Sendtn.) and plantain (Plantago major L.) weeds in an ornamental planting near one of the affected greenhouses tested positive for INSV by ImmunoStrips. The nightshade showed obvious thrips feeding damage but no obvious virus symptoms while the plantain showed less thrips feeding damage but distinct necrotic rings. Subsequently, two of two symptomatic potato plants of cv. Desiree in another greenhouse near the initial site tested INSV positive with the ImmunoStrips. In addition to the necrotic lesions on leaves observed in cv. Atlantic, these plants also showed necrosis of petioles and stems. INSV is transmitted by a number of species of thrips, but the western flower thrips (Frankliniella occidentalis Perg.) is considered the most important under greenhouse conditions. The species of thrips in the affected greenhouses was not determined before all materials were discarded. Both INSV and the thrips vector have large host ranges including many crops and weeds, and have become increasingly important in recent years (1,2). INSV was reported on greenhouse-grown potatoes in New York in 2005 (3). These findings indicate INSV can be a major problem in greenhouse potatoes, whether for research purposes or production of virus-free minitubers destined for field plantings. References: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997. (2) R. A. Naidu et al. Online publication. doi:10.1094/PHP-2005-0727-01-HN, Plant Health Progress, 2005. (3) K. L. Perry et al. Plant Dis. 89:340, 2005. (4) K. Tanina et al. Jpn. J. Phytopathol. 67:42, 2001. ERRATUM: A correction was made to this Disease Note on September 7, 2012. The forward and reverse INSV specific primer sequences were corrected.

Download Full-text

First Report of Impatiens necrotic spot virus in Gentiana macrophylla in China

Plant Disease ◽

10.1094/pdis-09-10-0685 ◽

2011 ◽

Vol 95 (3) ◽

pp. 357-357 ◽

Cited By ~ 1

Author(s):

M. Ding ◽

Y. Yin ◽

Q. Fang ◽

S. Li ◽

Z. Zhang

Keyword(s):

Sandwich Elisa ◽

N Gene ◽

Impatiens Necrotic Spot Virus ◽

Natural Occurrence ◽

Necrotic Spot ◽

Rt Pcr ◽

Spot Virus ◽

First Report ◽

Severe Stunting ◽

Gentiana Macrophylla

Large leaf gentian, Gentiana macrophylla Pall., known as Qin Jiao in Chinese, is a medicinal herb. Its root is most commonly used in Chinese traditional medicine to relieve rheumatic conditions and to remove damp-heat. During a survey in July 2009, large leaf gentian plants exhibiting foliar chlorotic and necrotic spots as well as severe stunting were collected in Lijiang County, Yunnan Province of China. Incidence of symptomatic plants ranged from 10 to 30% in the field. Symptomatic leaves from five different G. macrophylla plants were collected and tested for Impatiens necrotic spot virus (INSV), Tomato spotted wilt virus, Watermelon silver mottle virus, Groundnut bud necrosis virus, Tomato chlorotic spot virus, and Groundnut ringspot virus by double-antibody sandwich-ELISA kits (Agdia Inc., Elkhart, IN). All tested samples were positive only for INSV. To further confirm the presence of INSV, reverse transcription (RT)-PCR was conducted. Total RNA was extracted from the symptomatic large leaf gentian plants leaves with a RNeasy Plant Kit (Qiagen Inc., Valencia, CA) and used as a template in RT-PCR using forward (5′-CTT TGC TTT TTA GAA CTG TGC A-3′) and reverse (5′-AGA GCA ATT GTG TCA CGA ATA T-3′) primers specific to the partial INSV nucleoprotein (N) gene (GenBank No. DQ425096). Amplicons of the expected size (approximately 760 bp) were obtained from all ELISA-positive samples. Three clones were sequenced and the partial nucleocapsid protein genes consensus sequences of these isolates were determined (GenBank No. HQ317133). Nucleotide sequences of large leaf gentian isolates shared 98 to 99% nucleotide identity with INSV sequences of isolates from China, Italy, Japan, United States, and the Netherlands (GenBank Nos. FN400772, GQ336989, DQ425096, AB109100, D00914, AB109100, and X66972). INSV is one of the most serious viral pathogens of ornamental plants in North America, Europe, and Asia (1–3). To our knowledge, this is the first report of natural occurrence of INSV in G. macrophylla in China. References: (1) S. T. Koike. Plant Dis. 92:1248, 2008. (2) E. K. Tóth et al. Plant Dis. 91:331, 2007. (3) Q. Zhang et al. Plant Dis. 94:915, 2010.

Download Full-text

First Report of Impatiens necrotic spot virus in Mexico in Tomatillo and Pepper Plants

Plant Disease ◽

10.1094/pdis-01-13-0092-pdn ◽

2013 ◽

Vol 97 (8) ◽

pp. 1124-1124 ◽

Cited By ~ 5

Author(s):

B. E. González-Pacheco ◽

L. Silva-Rosales

Keyword(s):

Mosaic Virus ◽

Ringspot Virus ◽

Impatiens Necrotic Spot Virus ◽

Post Inoculation ◽

Necrotic Spot ◽

Rt Pcr ◽

Spot Virus ◽

First Report ◽

True Leaf ◽

Necrotic Spots

Mexico contributes 20% of the total worldwide pepper exports (1). Impatiens necrotic spot virus (INSV) (genus Tospovirus; family Bunyaviridae) has emerged and has possibly caused diseases in various crops and ornamentals in Mexico. INSV was treated as a quarantine virus in Mexico (2) but not anymore. During the growing seasons of 2009 to 2011, surveys were conducted in the counties of Guanajuato and Querétaro in the states of the same names. Sampling included tomatillo (Physalis ixocarpa) and pepper (Capsicum spp.) plantations where plants with possible viral symptoms were observed. The symptoms observed were dark necrotic spots on some leaves and on the stems. These were similar to those observed elsewhere (3). Leaf spots further developed into localized necrotic areas. Using ELISA (Agdia, Elkhart, IN) with polyclonal antibodies, all collected samples showing symptoms tested positive for INSV and negative for Alfalfa mosaic virus (AMV), Cucumber mosaic virus (CMV), Potato X virus (PVX), Potato Y virus (PVY), Tobacco mosaic virus (TMV), Tomato spotted wilt virus (TSWV), Tobacco ringspot virus (TRSV), and Tomato ringspot virus (ToRSV). In order to identify the causal agent of these symptoms, INSV-specific sequences available for the S genomic fragments were obtained from NCBI GenBank. They were aligned and used to design primers to amplify a 250-bp fragment from total extracted RNA from healthy and symptomatic plants using reverse transcription (RT)-PCR. Primers used were INSVF (5′CCCAACTGCCTCTTTAGTGC3′) and INSVR (5′GGACAATGGATCTGCTCTGA3′). Three extracted plasmids, each containing an amplified and cloned fragment for the pepper and tomatillo isolates, were sequenced (GenBank Accession Nos. KC503051 and KC503052, respectively). Both nucleotide sequences showed 95% identity with the Chinese, Italian, and Japanese INSV sequences (FN400773, DQ425096, and AB207803, respectively) and 94% identity to other INSV isolates (4). The putative Mexican INSV pepper isolate, derived from a necrotic spot, was mechanically inoculated to other experimental host plants after grinding 1 g of symptomatic leaf tissue in 3 ml of a buffer with quaternary ammonium salts at 0.5%, pH 7.8. Ten plants, at the second true-leaf stage, of each Capsicum annuum cv. cannon and Citrullus lanatus were inoculated after carborundum abrasion of the second true leaf. At 15 days post inoculation, systemic chlorotic necrotic spots, stunting, and apical malformation were observed in capsicum plants while wilting was shown in watermelon plants. RT-PCR analyses and nucleotide sequence of the amplified product confirmed the presence and identity of both virus isolates. To our knowledge, this is the first report of INSV in Mexico found naturally in tomatillo and pepper and experimentally in watermelon plants. Derived from this report, INSV distribution in Mexico should be studied due to its potential impact on these two economically important crops. References: (1) Food and Agriculture Organization of the United Nations. FAOSTAT, retrieved online at http://faostat.fao.org , 2013. (2) DGSV-CNRF. Impatiens necrotic spot virus (INSV). SAGARPA-SENASICA. México, 2011. (3) M. Ding et al. Plant Dis. 95:357, 2011. (4) I. Mavrič et al. Plant Dis. 85:12, 2001.

Download Full-text

First Report of Impatiens necrotic spot virus on Begonia in Bosnia and Herzegovina

Plant Disease ◽

10.1094/pdis-01-13-0088-pdn ◽

2013 ◽

Vol 97 (7) ◽

pp. 1004-1004 ◽

Cited By ~ 3

Author(s):

V. Trkulja ◽

J. Mihić Salapura ◽

B. Ćurković ◽

I. Stanković ◽

A. Bulajić ◽

...

Keyword(s):

Bosnia And Herzegovina ◽

Ornamental Plants ◽

N Gene ◽

Impatiens Necrotic Spot Virus ◽

Post Inoculation ◽

Necrotic Spot ◽

Rt Pcr ◽

Spot Virus ◽

First Report ◽

Negative Controls

Impatiens necrotic spot virus (INSV) and Tomato spotted wilt virus (TSWV) are the most serious viral pathogens in the production of ornamental plants in Europe and North America (1). During a survey for the presence of tospoviruses in July 2012, potted begonia hybrids (Begonia × tuberhybrida Voss) exhibiting foliar chlorotic rings and zonal spots accompanied by leaf necrosis and distortion, were observed in a greenhouse in the vicinity of Banja Luka (Bosnia and Herzegovina). Leaf samples collected from 12 symptomatic plants were analyzed for the presence of INSV and TSWV by commercial double-antibody sandwich (DAS)-ELISA kits (Bioreba AG, Reinach, Switzerland). Commercial positive and negative controls and extracts from healthy begonia leaves were included in each ELISA. INSV was detected serologically in all 12 begonia samples and all tested samples were negative for TSWV. Five healthy plants of each Petunia × hybrida and Nicotiana benthamiana were mechanically inoculated with sap from an ELISA-positive sample (157-12) using chilled 0.01 M phosphate buffer (pH 7) containing 0.1% sodium sulphite. Local necrotic lesions on P. × hybrida and systemic chlorotic mottling on N. benthamiana were observed on all inoculated plants 4 and 10 days post-inoculation, respectively. For further confirmation of INSV infection, total RNAs were extracted from all ELISA-positive begonia plants as well as mechanically inoculated N. benthamiana plants with the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and used as template in reverse transcription (RT)-PCR. RT-PCR was performed with the OneStep RT-PCR Kit (Qiagen) using primer pair INSV-589 and TOS-R15 (3), specific to the partial INSV nucleocapsid (N) gene. Total RNA obtained from Serbian INSV isolate from a begonia (GenBank Accession No. HQ724289) and RNA extracts from healthy begonia plants were used as positive and negative controls, respectively. All naturally and mechanically infected plants as well as the positive control yielded an amplicon of the expected size (589 bp), while no amplification products were obtained from the healthy controls. The RT-PCR product derived from the isolate 157-12 was sequenced directly after purification with QIAquick PCR Purification Kit (Qiagen) and submitted to GenBank (KC494869). Pairwise comparison of the 157-12 isolate N sequence with other homologous sequences available in GenBank, conducted using MEGA5 software (2), revealed that begonia isolate from Bosnia and Herzegovina showed the highest nucleotide identity of 99.7% (100% amino acid identity) with the Chinese INSV isolate (FN400772) originating from Oncidium sp. To our knowledge, this is the first report of INSV on begonia in Bosnia and Herzegovina. Begonias are very popular and widely grown ornamentals in Bosnia and Herzegovina and the presence of a new and devastating pathogen could represent a serious threat for its production. Since begonia is commonly grown together with numerous ornamental plants susceptible to INSV, further investigations are needed in order to prevent spread of this potentially harmful pathogen to new hosts in Bosnia and Herzegovina. References: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997. (2) K. Tamura et al. Mol. Biol. Evol. 28:2731, 2011. (3) H. Uga and S. Tsuda. Phytopathology 95:166, 2005.

Download Full-text

First Report of Yellow Nutsedge (Cyperus esculentus) and Purple Nutsedge (C. rotundus) in Georgia Naturally Infected with Impatiens necrotic spot virus

Plant Disease ◽

10.1094/pdis.2004.88.7.771b ◽

2004 ◽

Vol 88 (7) ◽

pp. 771-771 ◽

Cited By ~ 8

Author(s):

N. Martínez-Ochoa ◽

S. W. Mullis ◽

A. S. Csinos ◽

T. M. Webster

Keyword(s):

Southeastern United States ◽

Impatiens Necrotic Spot Virus ◽

Cyperus Esculentus ◽

Necrotic Spot ◽

Rt Pcr ◽

Spot Virus ◽

Black Shank ◽

Purple Nutsedge ◽

Yellow Nutsedge ◽

Das Elisa

Impatiens necrotic spot virus (INSV), family Bunyaviridae, genus Tospovirus, is an emerging virus found mostly in ornamentals under greenhouse production. INSV has been detected in peanut (Arachis hypogaea L.) in Georgia and Texas (3) and recently in tobacco (Nicotiana tabacum L.) in the southeastern United States (2) but little is known about INSV distribution and impact on these crops. Noncrop plant hosts are likely to contribute to disease spread by serving as reservoirs for the virus and reproductive hosts for thrips (Frankliniella occidentalis Pergande), which transmit the virus. Yellow nutsedge, a native of North America, and purple nutsedge introduced from Eurasia, are considered serious weed problems in the southeastern United States. To date, there are no reports of natural INSV infections in these weeds. A survey was conducted at two research farms in Tift County, Georgia to determine if yellow and purple nutsedge plants were naturally infected with Tomato spotted wilt virus (TSWV) and INSV. The first field at the Black Shank Farm had been planted with flue-cured tobacco K-326 earlier in the year and fallow at the time of sampling. The second field at the Ponder Farm was planted at the time of sampling with yellow squash (Cucurbita pepo L.) and cabbage (Brassica oleracea L.). In early October 2002, 90 nutsedge plants were taken at random from each site. Leaf and root tissues of each of the nutsedge plants were tested for TSWV and INSV using double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) alkaline phosphatase antisera kits (Agdia Inc., Elkhart, IN). No visible symptoms of INSV or TSWV were observed. Samples from the field at the Black Shank Farm resulted in 2 of 26 positive for INSV in purple nutsedge plants and 6 of 64 in yellow nutsedge plants. At the Ponder Farm, 3 of 12 were positive for INSV in purple nutsedge plants and 14 of 78 in yellow nutsedge plants. None of the samples in either site tested positive for TSWV. The DAS-ELISA positive samples were verified for INSV using reverse transcription-polymerase chain reaction (RT-PCR) as previously described by Dewey et al. (1). Total RNA extracts were obtained from the DAS-ELISA positive nutsedge samples using RNeasy extraction kits (Qiagen Inc., Valencia, CA). The RT-PCR was carried out with primer 1F: 5′-TCAAG(C/T) CTTC(G/T)GAA(A/G)GTGAT 3′ (1) and primer 2R: 5′-ATGAACAAAGCAAAGATTACC 3′ specific to the 3′ end of the INSV N gene open reading frame (GenBank Accession No. NC003624). DAS-ELISA negative tissues of Cyperus esculentus L. and Emilia sonchifolia (L.) DC and an E. sonchifolia DAS-ELISA positive for INSV were included in the reactions as controls. All of the DAS-ELISA positive nutsedge samples yielded an amplification product with the expected size of 298 bp when PCR products were resolved by agarose (0.7%) gel electrophoresis. The relatively high occurrence of INSV found in the sampled fields may explain the recent increase in incidence of INSV in susceptible field crops. Although yellow nutsedge is more common than purple nutsedge in North America, the potential for dispersal of INSV in both species could be significant because of the nature of nutsedge tuber survival and spreading capabilities. References: (1) R. A. Dewey et al. J. Virol. Methods 56:19, 1996. (2) N. Martínez-Ochoa et al. On-line publication. doi:10.1094/PHP-2003-0417-01-HN. Plant Health Progress, 2003. (3) S. S. Pappu et al. Plant Dis. 83:966,1999.

Download Full-text

First Report of Tomato spotted wilt virus on Chrysanthemum in Serbia

Plant Disease ◽

10.1094/pdis-08-12-0778-pdn ◽

2013 ◽

Vol 97 (1) ◽

pp. 150-150 ◽

Cited By ~ 7

Author(s):

I. Stanković ◽

A. Bulajić ◽

A. Vučurović ◽

D. Ristić ◽

K. Milojević ◽

...

Keyword(s):

Tomato Spotted Wilt Virus ◽

Disease Incidence ◽

N Gene ◽

Impatiens Necrotic Spot Virus ◽

Maximum Parsimony Tree ◽

Rt Pcr ◽

First Report ◽

Tomato Spotted Wilt ◽

Negative Controls ◽

Wilt Virus

In July 2011, greenhouse-grown chrysanthemum hybrid plants (Chrysanthemum × morifolium) with symptoms resembling those associated with tospoviruses were observed in the Kupusina locality (West Bačka District, Serbia). Disease incidence was estimated at 40%. Symptomatic plants with chlorotic ring spots and line patterns were sampled and tested by double antibody sandwich (DAS)-ELISA using polyclonal antisera (Bioreba AG, Reinach, Switzerland) against the two of the most devastating tospoviruses in the greenhouse floriculture industry: Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) (2). Commercial positive and negative controls and extracts from healthy chrysanthemum tissue were included in each ELISA. TSWV was detected serologically in 16 of 20 chrysanthemum samples and all tested samples were negative for INSV. The virus was mechanically transmitted from ELISA-positive chrysanthemum samples to five plants each of both Petunia × hybrida and Nicotiana tabacum ‘Samsun’ using chilled 0.01 M phosphate buffer (pH 7) containing 0.1% sodium sulfite. Inoculated plants produced local necrotic spots and systemic chlorotic/necrotic concentric rings, consistent with symptoms caused by TSWV (1). The presence of TSWV in ELISA-positive chrysanthemum plants and N. tabacum‘Samsun’ was further confirmed by conventional reverse transcription (RT)-PCR. Total RNAs were extracted with an RNeasy Plant Mini Kit (Qiagen, Hilden, Germany). RT-PCR was performed with the One-Step RT-PCR Kit (Qiagen) using primers TSWVCP-f/TSWVCP-r specific to the nucleocapsid protein (N) gene (4). A Serbian isolate of TSWV from tobacco (GenBank Accession No. GQ373173) and RNA extracted from a healthy chrysanthemum plant were used as positive and negative controls, respectively. An amplicon of the correct predicted size (738-bp) was obtained from each of the plants assayed, and that derived from chrysanthemum isolate 529-11 was purified (QIAqick PCR Purification Kit, Qiagen) and sequenced (JQ692106). Sequence analysis of the partial N gene, conducted with MEGA5 software, revealed the highest nucleotide identity of 99.6% (99% amino acid identity) with 12 TSWV isolates deposited in GenBank originating from different hosts from Italy (HQ830186-87, DQ431237-38, DQ398945), Montenegro (GU355939-40, GU339506, GU339508), France (FR693055-56), and the Czech Republic (AJ296599). The consensus maximum parsimony tree obtained on a 705-bp partial N gene sequence of TSWV isolates available in GenBank revealed that Serbian TSWV isolate 529-11 from chrysanthemum was clustered in the European subpopulation 2, while the Serbian isolates from tomato (GU369723) and tobacco (GQ373172-73 and GQ355467) were clustered in the European subpopulation 1 denoted previously (3). The distribution of TSWV in commercial chrysanthemum crops is wide (2). To our knowledge, this is the first report of TSWV infecting chrysanthemum in Serbia. Since chrysanthemum popularity and returns have been rising rapidly, the presence of TSWV may significantly reduce quality of crops in Serbia. References: (1) Anonymous. OEPP/EPPO Bull. 34:271, 2004. (2) Daughtrey et al. Plant Dis. 81:1220, 1997. (3) I. Stanković et al. Acta Virol. 55:337, 2011. (4) A. Vučurović et al. Eur. J. Plant Pathol. 133:935, 2012.

Download Full-text

First Report of Impatiens Necrotic Spot Virus Infecting Lettuce in Greece

Plant Disease ◽

10.1094/pdis-11-19-2316-pdn ◽

2020 ◽

Vol 104 (10) ◽

pp. 2742-2742

Author(s):

D. Beris ◽

I. Malandraki ◽

O. Kektsidou ◽

N. Vassilakos ◽

C. Varveri

Keyword(s):

Impatiens Necrotic Spot Virus ◽

Necrotic Spot ◽

Spot Virus ◽

First Report

Download Full-text

First Report of Cucumber mosaic virus Infecting Peperomia tuisana in Serbia

Plant Disease ◽

10.1094/pdis-01-13-0089-pdn ◽

2013 ◽

Vol 97 (7) ◽

pp. 1004-1004 ◽

Cited By ~ 2

Author(s):

K. Milojević ◽

I. Stanković ◽

A. Vučurović ◽

D. Ristić ◽

D. Milošević ◽

...

Keyword(s):

Cucumber Mosaic Virus ◽

Mosaic Virus ◽

Disease Incidence ◽

Impatiens Necrotic Spot Virus ◽

Rt Pcr ◽

Test Species ◽

First Report ◽

Cp Gene ◽

Negative Controls ◽

Das Elisa

Peperomia tuisana C.DC. ex Pittier (family Piperaceae) is an attractive succulent grown as an ornamental. Despite its tropical origins, it can be successfully grown indoors in any climate. In March 2012, three samples of P. tuisana showing virus-like symptoms were collected from a commercial greenhouse in Zemun (District of Belgrade, Serbia) in which estimated disease incidence was 80%. Infected plants showed symptoms including necrotic ringspots and line patterns that enlarged and caused necrosis of leaves. A serious leaf drop led to growth reduction and even death of the plant. Leaves from three symptomatic P. tuisana plants were sampled and analyzed by double-antibody sandwich (DAS)-ELISA using commercial diagnostic kits (Bioreba AG, Reinach, Switzerland) against the most common viral pathogens of ornamentals: Cucumber mosaic virus (CMV), Tomato spotted wilt virus (TSWV), and Impatiens necrotic spot virus (INSV) (1,2). Commercial positive and negative controls were included in each ELISA. Serological analyses showed that all plants were positive for CMV and negative for TSWV and INSV. The ELISA-positive sample (isolate 1-12) was mechanically inoculated onto five plants each of three test species as well as of healthy young P. tuisana using 0.01 M phosphate buffer (pH 7). Chlorotic local lesions on Chenopodium quinoa and severe mosaic and leaf malformations were observed on all inoculated Nicotiana tabacum ‘Samsun’ and N. glutinosa. Also, the virus was successfully mechanically transmitted to P. tuisana that reacted with symptoms identical to those observed on the original host plants. All mechanically inoculated plants were positive for CMV in DAS-ELISA. For further confirmation of CMV infection, reverse transcription (RT)-PCR was performed on extracts made from symptomatic P. tuisana, N. tabacum ‘Samsun,’ and N. glutinosa leaf materials. Total RNAs were extracted with the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and RT-PCR was carried out using One-Step RT-PCR Kit (Qiagen). A CMV-specific primer pair, CMVCPfwd and CMVCPrev (3), which amplifies an 871-bp fragment of the entire coat protein (CP) gene and part of 3′- and 5′-UTRs, were used for both amplification and sequencing. Total RNAs obtained from the Serbian CMV isolate (HM065510) and healthy P. tuisana were used as positive and negative controls, respectively. A product of the correct predicted size was obtained in all naturally and mechanically infected plants, as well as positive control. No amplicon was recorded in the healthy control. The amplified product derived from isolate 1-12 was purified (QIAquick PCR Purification Kit, Qiagen), directly sequenced in both directions, deposited in GenBank (KC505441), and analyzed by MEGA5 software (4). Sequence comparison of the complete CP gene (657 nt) revealed that the Serbian isolate 1-12 shared the highest nucleotide identity of 99.1% (99.5% amino acid identity) with the Japanese isolate (AB006813). To our knowledge, this is the first report on the occurrence of CMV in P. tuisana in Serbia. This is also an important discovery since P. tuisana is commonly grown together with other ornamental hosts of CMV, and thus could represent a serious threat for future expansion of CMV in the greenhouse floriculture industry in Serbia. References: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997. (2) S. Flasinski et al. Plant Dis. 79:843, 1995. (3) K. Milojevic et al. Plant Dis. 96:1706, 2012. (4) K. Tamura et al. Mol. Biol. Evol. 28:2731, 2011.

Download Full-text

First Report of Impatiens necrotic spot virus on Spiderlily in China

Plant Disease ◽

10.1094/pdis-94-4-0484c ◽

2010 ◽

Vol 94 (4) ◽

pp. 484-484 ◽

Cited By ~ 4

Author(s):

Y. T. Liu ◽

Y. X. Zheng ◽

Y. Z. Li ◽

Z. Y. Li

Keyword(s):

Infected Plant ◽

Protein S ◽

The United States ◽

Impatiens Necrotic Spot Virus ◽

Necrotic Spot ◽

Spot Virus ◽

Nicotiana Glutinosa ◽

First Report ◽

N Protein ◽

Italian Isolate

Impatiens necrotic spot virus (INSV) (genus Tospovirus; family Bunyaviridae) is a devastating disease in the production of ornamental flowers (1). From 2007 to 2009, a survey of 10 major parks and recreation areas in Kunming, the capital of Yunnan Province, China, indicated that approximately 60 to 70% of Spiderlily (Hymenocallis littoralis Salisb.) plants from eight parks had symptoms of concentric ring spots and necrotic spots. Symptomatic plants were tested for INSV and Tomato spotted wilt virus (TSWV) with an immunostrip (Agdia Inc. Elkhart, IN). Results indicated that only the samples designated HDL were positive for INSV and all other samples were negative for both INSV and TSWV. Mechanically inoculated Emilia sonchifolia, Nicotiana glutinosa, Impatiens balsamina, and N. rustica showed chlorotic lesions, concentric rings, and severe necrosis, symptoms typical for INSV in these hosts. Electron microscope inspection found tospovirus-like spheroidal, enveloped particles that were 90 nm in diameter. Primer 5 software (Premier, Canada) was used to design 14 primers from GenBank Accession No. NC_003625 to amplify the L RNA, nine from NC_003616 to amplify the M RNA, and six from NC_003624 to amplify the S RNA. With total RNA extracted from infected plant tissue as templates in reverse transcription (RT)-PCR, these primers generated 29 target fragments of 250 to 900 bp. These fragments were cloned with the vector pMD19 simple-T vector (Takara Bio Inc., Dalian, China) and sequenced. The sequences of the clones were aligned with the software DNAman (version 2.5; Lynnon Biosoft, Quebec, Canada), showing that RNAs L, M, and S are 8,776 bp (GenBank Accession No. GU112505), 4,948 bp (GenBank Accession No. GU112503), and 2,875 bp (GenBank Accession No. GU112504), respectively. BLAST analysis of these Spiderlily INSV sequences against the NCBI sequence database indicated that the RdRp protein (L RNA) was 99.6% identical with the RdRp protein from an Italian isolate (No. DQ425094), the Nsm protein (M RNA) has 99.0% identity with the Nsm protein from an isolate from Italy (No. DQ425095) and one from the United States (No. NC_003616), the G1G2 polyprotein (M RNA) has 99.9% identity with the analogous protein from an Italian isolate (No. DQ425095), the N protein (S RNA) has 99.6% identity with the N protein from an Italian isolate (No. DQ425096), and the NSs protein (S RNA) has 98.7% identity with the NSs protein from an isolate from Japan (No. AB109100). To our knowledge, this is the first report of INSV on Spiderlily in China. Reference: (1) A. E. Whitfield et al. Annu. Rev. Phytopathol. 43:459, 2005.

Download Full-text

First Report of Impatiens necrotic spot virus Infecting Phalaenopsis and Dendrobium Orchids in Yunnan Province, China

Plant Disease ◽

10.1094/pdis-94-7-0915a ◽

2010 ◽

Vol 94 (7) ◽

pp. 915-915 ◽

Cited By ~ 8

Author(s):

Q. Zhang ◽

Y.-M. Ding ◽

M. Li

Keyword(s):

Tissue Culture ◽

Yunnan Province ◽

N Gene ◽

Impatiens Necrotic Spot Virus ◽

Necrotic Spot ◽

Spot Virus ◽

First Report ◽

Chlorotic Spot ◽

Consensus Sequences ◽

Groundnut Bud Necrosis Virus

In November 2007, leaves of 79 Phalaenopsis and two Dendrobium orchid plants in a nursery in Yunnan Province showed large chlorotic/necrotic ringspot symptoms. Eight symptomatic leaves from Phalaenopsis and two from Dendrobium were sampled and tested for Impatiens necrotic spot virus (INSV), Tomato spotted wilt virus (TSWV), Watermelon silver mottle virus (WSMoV), Groundnut bud necrosis virus (GBNV), Tomato chlorotic spot virus (TCSV), and Groundnut ringspot virus (GRSV) with double-antibody sandwich (DAS)-ELISA kits (Agdia Inc., Elkhart, IN). All samples were positive for INSV and negative for TSWV, WSMoV, GBNV, TCSV, and GRSV. Total RNA extracts were prepared from all ELISA-positive samples with the RNeasy extraction kit (Huashun Inc., Shanghai, China). Reverse transcription (RT)-PCR was carried out with specific primers to the INSV N gene (ZI2F, 5′-GTTTAGCCTTACCAAT-3′ and ZI2R, 5′-TACCAACAACCGTGAA-3′), designed from a sequence of GenBank Accession No. AB109100. All ELISA-positive samples yielded an amplification product of the expected 539 bp as observed by gel electrophoresis in 1% agarose. Three clones from each isolate were sequenced and two N gene consensus sequences of the isolates from Phalaenopsis and Dendrobium were determined (GenBank Nos. GU289904 and GU289905, respectively). Nucleotide sequences of these two Chinese orchid isolates were 98 to 99% identical with sequences of isolates from the Netherlands, United States, Italy, and Japan (GenBank Nos. X66972, D00914, DQ425096 and AB109100, respectively). To our knowledge, this is the first report of INSV infecting Phalaenopsis and Dendrobium in Yunnan Province, although INSV has been reported in Oncidium in Yunnan Province previously (2), and the first time that INSV has been detected in Dendrobium. An investigation of the orchid nurseries looking for the thrips vector (1) of INSV was performed and a few thrips were found, suggesting that thrips may not be responsible for the observed prevalence of INSV in these nurseries. The orchids were imported from Taiwan and reproduced by tissue culture and it is possible that INSV found to be infecting orchids in these Yunnan nurseries may be from the infected source plant and was not eradicated completely through tissue culture. To reduce spread of INSV, virus-free tissue culture should be a priority for orchid production. References: (1). S. T. Koike and D. E. Mayhew. Orchids. Mag. Am. Orchid Soc. 70:746, 2001. (2). Q. Zhang et al. Plant Quarantine. 22:348, 2008.

Download Full-text