scholarly journals First Report of Colletotrichum gloeosporioides f. sp. manihotis, Cause of Cassava Anthracnose Disease, Being Seed-borne and Seed-Transmitted in Cassava

Plant Disease ◽  
1997 ◽  
Vol 81 (6) ◽  
pp. 695-695 ◽  
Author(s):  
C. N. Fokunang ◽  
T. Ikotun ◽  
A. G. O. Dixon ◽  
C. N. Akem
Keyword(s):  
Colletotrichum Gloeosporioides ◽  
Seedling Emergence ◽  
Canopy Temperature ◽  
Seed Transmission ◽  
Significant Loss ◽  
Crop Failure ◽  
Manihot Esculenta Crantz ◽  
First Report ◽  
Anthracnose Disease ◽  
Transmission Studies

Cassava anthracnose disease is a major economic disease of cassava in the tropics (2). Infection can lead to a significant loss in planting materials and total field crop failure. The disease has been reported to be transmitted mainly by a bug (Pseudotheraptus devastans Dist) (1). Open pollinated seeds from 13 cassava (Manihot esculenta Crantz) genotypes, stored for 10 months after harvest in 1994, were used to investigate the presence of the cassava anthracnose disease fungus. Seeds, 200 from each genotype, were surface sterilized, cultured on potato dextrose agar (PDA), and incubated for 8 days, at 25 ± 2°C. Microscopic examination indicated that Colletotrichum gloeosporioides was one of the seed-borne fungi, with up to 40% incidence recorded in some genotypes. Seeds from five susceptible genotypes selected for seed transmission studies were planted in fine, steam-sterilized soils in jiffy pots and watered daily for seedling emergence. At a height of 10 to 15 cm, the seedlings were transferred to plastic pots (10.5 cm in diameter) filled with sterilized mixture of soil and sand (2:2, vol/vol). Pots were placed close to each other to obtain a thick plant canopy. Temperature of 25 to 32°C and humidity of 80 to 98% were maintained. After 45 days, some plants had cassava anthracnose symptoms, including defoliation, wilt, and necrotic lesions. Stems, leaves, and roots of infected plants were washed, surface sterilized, and plated on PDA for 5 to 7 days. Microscopic observation of the fungus showed conidia of C. gloeosporioides. The rest of the plants were monitored for 3 months under vector-free conditions for typical anthracnose symptoms. Mean maximum wilt and defoliation of 35 to 38% was recorded in some genotypes. Conidial suspensions of C. gloeosporioides were used in stem-puncture inoculations of young, healthy cassava plants. The typical anthracnose symptoms of stem necrosis were observed 2 weeks after inoculation, confirming isolates as C. gloeosporioides f. sp. manihotis. This is the first report of C. gloeosporioides f. sp. manihotis being seed-borne and seed-transmitted in cassava. References: (1) B. Boher et al. Agronomie 3:989, 1983. (2) J. C. Lozano. PANS 20:30, 1974.

First Report of Anthracnose Disease on Jatropha curcas Caused by Colletotrichum gloeosporioides in Korea

2012 ◽  
Vol 160 (5) ◽  
pp. 255-257 ◽  
Author(s):  
Jin-Hyeuk Kwon ◽  
Okhee Choi ◽  
Jinwoo Kim ◽  
Youn-Sig Kwak
Keyword(s):  
Jatropha Curcas ◽  
Colletotrichum Gloeosporioides ◽  
First Report ◽  
Anthracnose Disease

scholarly journals First Report of Anthracnose Disease on Young Stems of Bawanghua (Hylocereus undatus) Caused by Colletotrichum gloeosporioides in China

Plant Disease ◽  
2014 ◽  
Vol 98 (7) ◽  
pp. 991-991 ◽  
Author(s):  
W. J. Ma ◽  
X. Yang ◽  
X. R. Wang ◽  
Y. S. Zeng ◽  
M. D. Liao ◽  
...  
Keyword(s):  
Colletotrichum Gloeosporioides ◽  
Sequence Data ◽  
Southern China ◽  
Morphological Characteristics ◽  
Its Region ◽  
Pathogenic Fungi ◽  
First Report ◽  
Guangzhou City ◽  
Anthracnose Disease ◽  
Hylocereus Undatus

Hylocereus undatus widely grows in southern China. Some varieties are planted for their fruits, known as dragon fruits or Pitaya, while some varieties for their flowers known as Bawanghua. Fresh or dried flowers of Bawanghua are used as routine Chinese medicinal food. Since 2008, a serious anthracnose disease has led to great losses on Bawanghua flower production farms in the Baiyun district of Guangzhou city in China. Anthracnose symptoms on young stems of Bawanghua are reddish-brown, sunken lesions with pink masses of spores in the center. The lesions expand rapidly in the field or in storage, and may coalesce in the warm and wet environment in spring and summer in Guangzhou. Fewer flowers develop on infected stems than on healthy ones. The fungus overwinters in infected debris in the soil. The disease caused a loss of up to 50% on Bawanghua. Putative pathogenic fungi with whitish-orange colonies were isolated from a small piece of tissue (3 × 3 mm) cut from a lesion margin and cultured on potato dextrose agar in a growth chamber at 25°C, 80% RH. Dark colonies with acervuli bearing pinkish conidial masses formed 14 days later. Single celled conidia were 11 to 18 × 4 to 6 μm. Based on these morphological characteristics, the fungi were identified as Colletotrichum gloeosporioides (Penz.) Penz. & Sacc (2). To confirm this, DNA was extracted from isolate BWH1 and multilocus analyses were completed with DNA sequence data generated from partial ITS region of nrDNA, actin (ACT) and glutamine synthetase (GS) nucleotide sequences by PCR, with C. gloeosporioides specific primers as ITS4 (5′-TCCTCCGCTTATTGATATGC-3′) / CgInt (5′-GGCCTCCCGCCTCCGGGCGG-3′), GS-F (5′-ATGGCCGAGTACATCTGG-3′) / GS-R (5′-GAACCGTCGAAGTTCCAC-3′) and actin-R (5′-ATGTGCAAGGCCGGTTTCGC-3′) / actin-F (5′-TACGAGTCCTTCTGGCCCAT-3′). The sequence alignment results indicated that the obtained partial ITS sequence of 468 bp (GenBank Accession No. KF051997), actin sequence of 282 bp (KF712382), and GS sequence of 1,021 bp (KF719176) are 99%, 96%, and 95% identical to JQ676185.1 for partial ITS, FJ907430 for ACT, and FJ972589 for GS of C. gloeosporioides previously deposited, respectively. For testing its pathogenicity, 20 μl of conidia suspension (1 × 106 conidia/ml) using sterile distilled water (SDW) was inoculated into artificial wounds on six healthy young stems of Bawanghua using sterile fine-syringe needle. Meanwhile, 20 μl of SDW was inoculated on six healthy stems as a control. The inoculated stems were kept at 25°C, about 90% relative humidity. Three independent experiments were carried out. Reddish-brown lesions formed after 10 days, on 100% stems (18 in total) inoculated by C. gloeosporioides, while no lesion formed on any control. The pathogen was successfully re-isolated from the inoculated stem lesions on Bawanghua. Thus, Koch's postulates were fulfilled. Colletotrichum anthracnose has been reported on Pitaya in Japan (3), Malaysia (1) and in Brazil (4). To our knowledge, this is the first report of anthracnose disease caused by C. gloeosporioides on young stems of Bawanghua (H. undatus) in China. References: (1) M. Masyahit et al. Am. J. Appl. Sci. 6:902, 2009. (2) B. C. Sutton. Page 402 in: Colletotrichum Biology, Pathology and Control. J. A. Bailey and M. J. Jeger, eds. CAB International, Wallingford, UK, 1992. (3) S. Taba et al. Jpn. J. Phytopathol. 72:25, 2006. (4) L. M. Takahashi et al. Australas. Plant Dis. Notes 3:96, 2008.

scholarly journals First Report of Banana Anthracnose Caused by Colletotrichum gloeosporioides in Ecuador

Plant Disease ◽  
2019 ◽  
Vol 103 (4) ◽  
pp. 763-763 ◽  
Author(s):  
N. Riera ◽  
D. Ramirez-Villacis ◽  
N. Barriga-Medina ◽  
J. Alvarez-Santana ◽  
K. Herrera ◽  
...  
Keyword(s):  
Colletotrichum Gloeosporioides ◽  
First Report

scholarly journals First Report of Anthracnose Caused by Colletotrichum gloeosporioides on Kiwifruit (Actinidia chinensis) in China

Plant Disease ◽  
2017 ◽  
Vol 101 (12) ◽  
pp. 2151-2151 ◽  
Author(s):  
L. Li ◽  
H. Pan ◽  
M. Y. Chen ◽  
S. J. Zhang ◽  
C. H. Zhong
Keyword(s):  
Colletotrichum Gloeosporioides ◽  
Actinidia Chinensis ◽  
First Report

scholarly journals First Report of Southern tomato virus on Tomatoes in Southwest France

Plant Disease ◽  
2013 ◽  
Vol 97 (8) ◽  
pp. 1124-1124 ◽  
Author(s):  
T. Candresse ◽  
A. Marais ◽  
C. Faure
Keyword(s):  
North America ◽  
Seed Transmission ◽  
The United States ◽  
High Rate ◽  
Reference Sequence ◽  
Tomato Mosaic Virus ◽  
Potential Contribution ◽  
First Report ◽  
Tomato Sample ◽  
Potential Pathogenicity

Southern tomato virus (STV) is a recently described virus of tomato reported to be associated with a new disorder in this crop, the tomato yellow stunt disease (2). However, its detection in asymptomatic seedlings of some tomato varieties raises doubts about its pathogenicity (2). STV has a small 3.5-kb dsRNA genome with properties that place it in an intermediate position between the Totiviridae and Partitiviridae families. STV also has an unusual biology because, while being seed-transmitted at a high rate, it is neither mechanically nor graft-transmitted (2). It has so far only been reported from North America (Mississipi and California in the United States, as well as Mexico) (2). Agents with similar genomic organizations but apparently not associated with specific disease symptoms have recently been reported from faba bean, rhododendrons, and blueberry and proposed to represent a novel family of dsRNA viruses tentatively named Amalgamaviridae (1). In the course of plant virus metagenomics experiments, double stranded RNAs extracted from tomato samples from Southwest France collected in 2011 (variety unknown) were analyzed by 454 pyrosequencing. BLAST analysis of the contigs assembled from individual sequencing reads revealed a ca. 2.2 kb long contig with very high (99.7%) identity with the STV reference sequence deposited in GenBank (NC_011591). In order to confirm the presence of STV, an STV-specific primer pair (STV-fw 5′ CTGGAGATGAAGTGCTCGAAGA 3′ and STV-rev 5′ TGGCTCGTCTCGCATCCTTCG 3′) was designed and used to amplify by RT-PCR an 894-bp fragment from the relevant tomato sample. A PCR product of the expected size was obtained and the identity of the amplified agent verified by sequencing of the amplicon. The sequence obtained was identical to contig obtained through pyrosequencing of purified dsRNAs and has been deposited in GenBank (KC333078). This is, to our knowledge, the first report of STV infecting tomato crops outside of North America. The tomato sample from France from which STV was recovered showed distinct viral infection symptoms (e.g., mosaics, leaf deformation), that are clearly different from the symptoms reported for the tomato yellow stunt disease (2). However, the plants were found to be also infected with Tomato mosaic virus and Potato virus Y, so that it is not possible to draw firm conclusions about a potential contribution of STV to the symptoms observed. The high rate of STV seed transmission and its reported presence in commercial seed lots of several varieties (2) suggest that its distribution could be much broader than is currently known and further efforts are clearly needed to provide a final and conclusive answer as to the potential pathogenicity of this agent to tomato crops. References: (1) R. R. Martin et al. Virus Res. 155:175, 2011. (2) S. Sabanadzovic et al. Virus Res. 140:130, 2009.

Sign in / Sign up

Export Citation Format

Share Document