First Report of Monarda didyma Infection with Impatiens necrotic spot virus in Washington State

2007 ◽  
Vol 8 (1) ◽  
pp. 38
Author(s):  
Rayapati A. Naidu ◽  
Olufemi J. Alabi ◽  
Gandhi Karthikeyan ◽  
Mark Nelson ◽  
Anne Morrell
Keyword(s):  
Washington State ◽  
Ornamental Plant ◽  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Spot Virus ◽  
First Report ◽  
Monarda Didyma ◽  
Herbaceous Perennial

Monarda didyma is an herbaceous perennial widely used as a garden ornamental plant throughout USA. Infection of M. didyma by Impatiens necrotic spot virus (INSV) in commercial greenhouse settings has been reported only in Pennsylvania in 1992. Therefore, this is the first report of INSV infecting a M. didyma in the field. Accepted for publication 25 September 2007. Published 19 November 2007.

scholarly journals First Report of Impatiens necrotic spot virus Infecting Lettuce in California

Plant Disease ◽  
2008 ◽  
Vol 92 (8) ◽  
pp. 1248-1248 ◽  
Author(s):  
S. T. Koike ◽  
Y.-W. Kuo ◽  
M. R. Rojas ◽  
R. L. Gilbertson
Keyword(s):  
Frankliniella Occidentalis ◽  
Disease Incidence ◽  
Pcr Analysis ◽  
Impatiens Necrotic Spot Virus ◽  
Vegetable Crops ◽  
Necrotic Spot ◽  
Rt Pcr ◽  
Spot Virus ◽  
First Report ◽  
Monterey County

Impatiens necrotic spot virus (INSV; family Bunyaviridae, genus Tospovirus) is an important pathogen of ornamental plants in North America and Europe, particularly in the greenhouse industry (2,3). However, INSV is now emerging as a pathogen of vegetable crops. During the 2006 and 2007 growing seasons, lettuce (Lactuca sativa) in Monterey County, CA showed necrotic spotting, leaf chlorosis, and plant stunting typical of symptoms induced by Tomato spotted wilt virus (TSWV). Significant and damaging outbreaks of these disease symptoms were found in numerous romaine, greenleaf, redleaf, butterhead, and iceberg lettuce fields in Monterey and San Benito counties. Samples from symptomatic plants from 21 of 27 fields in Monterey County were negative when tested with TSWV immunostrips (Agdia, Elkhart, IN); however, tests of the TSWV-negative samples with INSV immunostrips were positive. In most fields where INSV was detected, disease development was limited to the edges of fields and disease incidence was <5%; however, some fields had incidences >50% and crop loss was experienced. The virus causing the tospovirus symptoms in the TSWV-negative lettuce was sap transmitted to Nicotiana benthamiana and lettuce, where it induced chlorosis and necrosis. Symptoms in N. benthamiana were consistent with INSV infection, and those in lettuce were similar to symptoms observed in the field. Immunostrip tests confirmed that symptomatic N. benthamiana and lettuce plants were infected with INSV. To further confirm the identity of this virus, reverse transcription (RT)-PCR analysis was conducted with an INSV primer pair that directs the amplification of a ~1.3-kb fragment from the small RNA of INSV (4). The 1.3-kb fragment was amplified from RNA from symptomatic lettuce plants that were INSV positive with immunostrips, and not from asymptomatic lettuce. A total of 38 of 54 samples showing tospovirus-like symptoms were confirmed to be infected with INSV by RT-PCR. Sequences of two representative 1.3-kb DNA fragments were 98 to 99% identical with sequences of INSV isolates from Japan, Italy, and The Netherlands (GenBank Accession Nos. AB109100, DQ425096, and X66972). Taken together with the previous identification of the INSV vector, the western flower thrips (Frankliniella occidentalis), in central California lettuce (1), these results confirm that INSV induced tospovirus symptoms in lettuce fields in Monterey County in 2007. To our knowledge, this is the first report of the occurrence of INSV infecting lettuce in California. References: (1) W. E. Chaney. Annu. Rep. California Lettuce Res. Board. 2006. (2) M. Daughtrey et al. Plant Dis. 81:1220, 1997. (3) M. D. Law and J. W. Moyer. J. Gen. Virol. 71:933, 1990. (4) R. A. Naidu et al. Online publication. doi: 10.1094/PHP-2005-0727-01-HN. Plant Health Progress, 2005.

scholarly journals First Report of Impatiens Necrotic Spot Virus Infecting Lettuce in Greece

Plant Disease ◽  
2020 ◽  
Vol 104 (10) ◽  
pp. 2742-2742
Author(s):  
D. Beris ◽  
I. Malandraki ◽  
O. Kektsidou ◽  
N. Vassilakos ◽  
C. Varveri
Keyword(s):  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Spot Virus ◽  
First Report

scholarly journals First Report of Impatiens necrotic spot virus in Gentiana macrophylla in China

Plant Disease ◽  
2011 ◽  
Vol 95 (3) ◽  
pp. 357-357 ◽  
Author(s):  
M. Ding ◽  
Y. Yin ◽  
Q. Fang ◽  
S. Li ◽  
Z. Zhang
Keyword(s):  
Sandwich Elisa ◽  
N Gene ◽  
Impatiens Necrotic Spot Virus ◽  
Natural Occurrence ◽  
Necrotic Spot ◽  
Rt Pcr ◽  
Spot Virus ◽  
First Report ◽  
Severe Stunting ◽  
Gentiana Macrophylla

Large leaf gentian, Gentiana macrophylla Pall., known as Qin Jiao in Chinese, is a medicinal herb. Its root is most commonly used in Chinese traditional medicine to relieve rheumatic conditions and to remove damp-heat. During a survey in July 2009, large leaf gentian plants exhibiting foliar chlorotic and necrotic spots as well as severe stunting were collected in Lijiang County, Yunnan Province of China. Incidence of symptomatic plants ranged from 10 to 30% in the field. Symptomatic leaves from five different G. macrophylla plants were collected and tested for Impatiens necrotic spot virus (INSV), Tomato spotted wilt virus, Watermelon silver mottle virus, Groundnut bud necrosis virus, Tomato chlorotic spot virus, and Groundnut ringspot virus by double-antibody sandwich-ELISA kits (Agdia Inc., Elkhart, IN). All tested samples were positive only for INSV. To further confirm the presence of INSV, reverse transcription (RT)-PCR was conducted. Total RNA was extracted from the symptomatic large leaf gentian plants leaves with a RNeasy Plant Kit (Qiagen Inc., Valencia, CA) and used as a template in RT-PCR using forward (5′-CTT TGC TTT TTA GAA CTG TGC A-3′) and reverse (5′-AGA GCA ATT GTG TCA CGA ATA T-3′) primers specific to the partial INSV nucleoprotein (N) gene (GenBank No. DQ425096). Amplicons of the expected size (approximately 760 bp) were obtained from all ELISA-positive samples. Three clones were sequenced and the partial nucleocapsid protein genes consensus sequences of these isolates were determined (GenBank No. HQ317133). Nucleotide sequences of large leaf gentian isolates shared 98 to 99% nucleotide identity with INSV sequences of isolates from China, Italy, Japan, United States, and the Netherlands (GenBank Nos. FN400772, GQ336989, DQ425096, AB109100, D00914, AB109100, and X66972). INSV is one of the most serious viral pathogens of ornamental plants in North America, Europe, and Asia (1–3). To our knowledge, this is the first report of natural occurrence of INSV in G. macrophylla in China. References: (1) S. T. Koike. Plant Dis. 92:1248, 2008. (2) E. K. Tóth et al. Plant Dis. 91:331, 2007. (3) Q. Zhang et al. Plant Dis. 94:915, 2010.

scholarly journals First Report of Impatiens necrotic spot virus on Spiderlily in China

Plant Disease ◽  
2010 ◽  
Vol 94 (4) ◽  
pp. 484-484 ◽  
Author(s):  
Y. T. Liu ◽  
Y. X. Zheng ◽  
Y. Z. Li ◽  
Z. Y. Li
Keyword(s):  
Infected Plant ◽  
Protein S ◽  
The United States ◽  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Spot Virus ◽  
Nicotiana Glutinosa ◽  
First Report ◽  
N Protein ◽  
Italian Isolate

Impatiens necrotic spot virus (INSV) (genus Tospovirus; family Bunyaviridae) is a devastating disease in the production of ornamental flowers (1). From 2007 to 2009, a survey of 10 major parks and recreation areas in Kunming, the capital of Yunnan Province, China, indicated that approximately 60 to 70% of Spiderlily (Hymenocallis littoralis Salisb.) plants from eight parks had symptoms of concentric ring spots and necrotic spots. Symptomatic plants were tested for INSV and Tomato spotted wilt virus (TSWV) with an immunostrip (Agdia Inc. Elkhart, IN). Results indicated that only the samples designated HDL were positive for INSV and all other samples were negative for both INSV and TSWV. Mechanically inoculated Emilia sonchifolia, Nicotiana glutinosa, Impatiens balsamina, and N. rustica showed chlorotic lesions, concentric rings, and severe necrosis, symptoms typical for INSV in these hosts. Electron microscope inspection found tospovirus-like spheroidal, enveloped particles that were 90 nm in diameter. Primer 5 software (Premier, Canada) was used to design 14 primers from GenBank Accession No. NC_003625 to amplify the L RNA, nine from NC_003616 to amplify the M RNA, and six from NC_003624 to amplify the S RNA. With total RNA extracted from infected plant tissue as templates in reverse transcription (RT)-PCR, these primers generated 29 target fragments of 250 to 900 bp. These fragments were cloned with the vector pMD19 simple-T vector (Takara Bio Inc., Dalian, China) and sequenced. The sequences of the clones were aligned with the software DNAman (version 2.5; Lynnon Biosoft, Quebec, Canada), showing that RNAs L, M, and S are 8,776 bp (GenBank Accession No. GU112505), 4,948 bp (GenBank Accession No. GU112503), and 2,875 bp (GenBank Accession No. GU112504), respectively. BLAST analysis of these Spiderlily INSV sequences against the NCBI sequence database indicated that the RdRp protein (L RNA) was 99.6% identical with the RdRp protein from an Italian isolate (No. DQ425094), the Nsm protein (M RNA) has 99.0% identity with the Nsm protein from an isolate from Italy (No. DQ425095) and one from the United States (No. NC_003616), the G1G2 polyprotein (M RNA) has 99.9% identity with the analogous protein from an Italian isolate (No. DQ425095), the N protein (S RNA) has 99.6% identity with the N protein from an Italian isolate (No. DQ425096), and the NSs protein (S RNA) has 98.7% identity with the NSs protein from an isolate from Japan (No. AB109100). To our knowledge, this is the first report of INSV on Spiderlily in China. Reference: (1) A. E. Whitfield et al. Annu. Rev. Phytopathol. 43:459, 2005.

scholarly journals First Report of Impatiens necrotic spot virus Infecting Phalaenopsis and Dendrobium Orchids in Yunnan Province, China

Plant Disease ◽  
2010 ◽  
Vol 94 (7) ◽  
pp. 915-915 ◽  
Author(s):  
Q. Zhang ◽  
Y.-M. Ding ◽  
M. Li
Keyword(s):  
Tissue Culture ◽  
Yunnan Province ◽  
N Gene ◽  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Spot Virus ◽  
First Report ◽  
Chlorotic Spot ◽  
Consensus Sequences ◽  
Groundnut Bud Necrosis Virus

In November 2007, leaves of 79 Phalaenopsis and two Dendrobium orchid plants in a nursery in Yunnan Province showed large chlorotic/necrotic ringspot symptoms. Eight symptomatic leaves from Phalaenopsis and two from Dendrobium were sampled and tested for Impatiens necrotic spot virus (INSV), Tomato spotted wilt virus (TSWV), Watermelon silver mottle virus (WSMoV), Groundnut bud necrosis virus (GBNV), Tomato chlorotic spot virus (TCSV), and Groundnut ringspot virus (GRSV) with double-antibody sandwich (DAS)-ELISA kits (Agdia Inc., Elkhart, IN). All samples were positive for INSV and negative for TSWV, WSMoV, GBNV, TCSV, and GRSV. Total RNA extracts were prepared from all ELISA-positive samples with the RNeasy extraction kit (Huashun Inc., Shanghai, China). Reverse transcription (RT)-PCR was carried out with specific primers to the INSV N gene (ZI2F, 5′-GTTTAGCCTTACCAAT-3′ and ZI2R, 5′-TACCAACAACCGTGAA-3′), designed from a sequence of GenBank Accession No. AB109100. All ELISA-positive samples yielded an amplification product of the expected 539 bp as observed by gel electrophoresis in 1% agarose. Three clones from each isolate were sequenced and two N gene consensus sequences of the isolates from Phalaenopsis and Dendrobium were determined (GenBank Nos. GU289904 and GU289905, respectively). Nucleotide sequences of these two Chinese orchid isolates were 98 to 99% identical with sequences of isolates from the Netherlands, United States, Italy, and Japan (GenBank Nos. X66972, D00914, DQ425096 and AB109100, respectively). To our knowledge, this is the first report of INSV infecting Phalaenopsis and Dendrobium in Yunnan Province, although INSV has been reported in Oncidium in Yunnan Province previously (2), and the first time that INSV has been detected in Dendrobium. An investigation of the orchid nurseries looking for the thrips vector (1) of INSV was performed and a few thrips were found, suggesting that thrips may not be responsible for the observed prevalence of INSV in these nurseries. The orchids were imported from Taiwan and reproduced by tissue culture and it is possible that INSV found to be infecting orchids in these Yunnan nurseries may be from the infected source plant and was not eradicated completely through tissue culture. To reduce spread of INSV, virus-free tissue culture should be a priority for orchid production. References: (1). S. T. Koike and D. E. Mayhew. Orchids. Mag. Am. Orchid Soc. 70:746, 2001. (2). Q. Zhang et al. Plant Quarantine. 22:348, 2008.

scholarly journals First Report of Impatiens necrotic spot virus on Hiemalis Begonia (Begonia × hiemalis) in Canada

Plant Disease ◽  
2013 ◽  
Vol 97 (2) ◽  
pp. 291-291 ◽  
Author(s):  
X. Tian ◽  
Y. Zheng ◽  
K. Chintaluri ◽  
B. Meng
Keyword(s):  
The United States ◽  
Economic Losses ◽  
N Gene ◽  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Spot Virus ◽  
First Report ◽  
Initial Symptoms ◽  
Necrotic Spots ◽  
The Impact

Impatiens necrotic spot virus (INSV) is a member of the genus Tospovirus, and one of the prevalent viruses infecting ornamental plants, including begonia. Since the late 1980s, it has caused dramatic and unusual diseases on many flower crops, leading to considerable economic losses to the greenhouse floriculture industry (1). The western flower thrips, Frankliniella occidentalis (Pergande), is the only species currently known to vector INSV (1). In spring 2012, stunted plant growth and necrotic spots were observed on leaves of all Hiemalis begonias (Begonia × hiemalis Fotsch.) in a greenhouse in southwest Ontario, Canada. Initial symptoms were mosaic patterns, followed by necrotic spots on leaves, concentric rings, then necrotic areas on flowers, stem and vein necrosis, and finally stunting and burning of foliage similar to damage caused by sunburn or chemical injury. Thrips were observed colonizing nearby begonia plants. Leaf tissue from five symptomatic plants tested positive for INSV in a double-antibody sandwich (DAS)-ELISA with INSV-specific ImmunoStrips (Agdia Inc., Elkhart, IN). To confirm this, five of the leaf samples that were found to be positive for INSV in ELISA tests were mechanically inoculated to 10 plants of Hiemalis Begonia. Out of the 10 inoculated plants, eight produced necrotic local lesions and necrotic spots that are typical of INSV infection, followed by systemic infection of upper leaves 30 days after inoculation. The presence of INSV in the eight symptomatic plants was confirmed using the commercial INSV Pocket Diagnostic Kit (Forsite Diagnostics Ltd., York, UK) according to the manufacturer's instructions. Results showed that all eight symptomatic plants were positive for INSV. The other two plants were asymptomatic and tested negative for INSV. To further confirm the identity of this virus, total RNAs were isolated from symptomatic leave of begonia plants using TRIzol reagent (Invitrogen, Life Technologies Grand Island, NY) and amplified using reverse transcription (RT)-PCR analysis. A pair of primers was designed based on the consensus sequence of the N gene for a number of isolates retrieved from GenBank. These primers were INSV-F2286 (5′CCAAGCTCAACATGTTTAGC 3′, nt positions 2286 to 2305 of AB109100) and INSV-R2604 (5′ACTGCATCTTGCCTATCCTT 3′, nt positions 2664 to 2683 of AB109100). The expected amplification product of 398 bp was obtained, and was cloned into the vector pGEM-T Easy (Promega Corp., Madison, WI). Two clones were sequenced using the vector primer M13Forward. The sequences of these two clones were identical and the sequence was deposited in GenBank (Accession No. JX846907). BLAST analysis indicated that the sequence was 98 to 99% identical to INSV isolates from Japan (AB109100), the United States (D00914), and the Netherlands (X66972). To our knowledge, this is the first report of INSV infection in Begonia × hiemalis in Canada. This finding provides further evidence for the spread of the virus within North America. Further studies are required to determine the impact of INSV on the begonia industry in Canada and to determine viable management strategies, if necessary. Reference: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997.

scholarly journals First Report of Impatiens necrotic spot virus in Mexico in Tomatillo and Pepper Plants

Plant Disease ◽  
2013 ◽  
Vol 97 (8) ◽  
pp. 1124-1124 ◽  
Author(s):  
B. E. González-Pacheco ◽  
L. Silva-Rosales
Keyword(s):  
Mosaic Virus ◽  
Ringspot Virus ◽  
Impatiens Necrotic Spot Virus ◽  
Post Inoculation ◽  
Necrotic Spot ◽  
Rt Pcr ◽  
Spot Virus ◽  
First Report ◽  
True Leaf ◽  
Necrotic Spots

Mexico contributes 20% of the total worldwide pepper exports (1). Impatiens necrotic spot virus (INSV) (genus Tospovirus; family Bunyaviridae) has emerged and has possibly caused diseases in various crops and ornamentals in Mexico. INSV was treated as a quarantine virus in Mexico (2) but not anymore. During the growing seasons of 2009 to 2011, surveys were conducted in the counties of Guanajuato and Querétaro in the states of the same names. Sampling included tomatillo (Physalis ixocarpa) and pepper (Capsicum spp.) plantations where plants with possible viral symptoms were observed. The symptoms observed were dark necrotic spots on some leaves and on the stems. These were similar to those observed elsewhere (3). Leaf spots further developed into localized necrotic areas. Using ELISA (Agdia, Elkhart, IN) with polyclonal antibodies, all collected samples showing symptoms tested positive for INSV and negative for Alfalfa mosaic virus (AMV), Cucumber mosaic virus (CMV), Potato X virus (PVX), Potato Y virus (PVY), Tobacco mosaic virus (TMV), Tomato spotted wilt virus (TSWV), Tobacco ringspot virus (TRSV), and Tomato ringspot virus (ToRSV). In order to identify the causal agent of these symptoms, INSV-specific sequences available for the S genomic fragments were obtained from NCBI GenBank. They were aligned and used to design primers to amplify a 250-bp fragment from total extracted RNA from healthy and symptomatic plants using reverse transcription (RT)-PCR. Primers used were INSVF (5′CCCAACTGCCTCTTTAGTGC3′) and INSVR (5′GGACAATGGATCTGCTCTGA3′). Three extracted plasmids, each containing an amplified and cloned fragment for the pepper and tomatillo isolates, were sequenced (GenBank Accession Nos. KC503051 and KC503052, respectively). Both nucleotide sequences showed 95% identity with the Chinese, Italian, and Japanese INSV sequences (FN400773, DQ425096, and AB207803, respectively) and 94% identity to other INSV isolates (4). The putative Mexican INSV pepper isolate, derived from a necrotic spot, was mechanically inoculated to other experimental host plants after grinding 1 g of symptomatic leaf tissue in 3 ml of a buffer with quaternary ammonium salts at 0.5%, pH 7.8. Ten plants, at the second true-leaf stage, of each Capsicum annuum cv. cannon and Citrullus lanatus were inoculated after carborundum abrasion of the second true leaf. At 15 days post inoculation, systemic chlorotic necrotic spots, stunting, and apical malformation were observed in capsicum plants while wilting was shown in watermelon plants. RT-PCR analyses and nucleotide sequence of the amplified product confirmed the presence and identity of both virus isolates. To our knowledge, this is the first report of INSV in Mexico found naturally in tomatillo and pepper and experimentally in watermelon plants. Derived from this report, INSV distribution in Mexico should be studied due to its potential impact on these two economically important crops. References: (1) Food and Agriculture Organization of the United Nations. FAOSTAT, retrieved online at http://faostat.fao.org , 2013. (2) DGSV-CNRF. Impatiens necrotic spot virus (INSV). SAGARPA-SENASICA. México, 2011. (3) M. Ding et al. Plant Dis. 95:357, 2011. (4) I. Mavrič et al. Plant Dis. 85:12, 2001.

scholarly journals First Report of Impatiens necrotic spot virus in Hoya carnosa in Korea

2017 ◽  
Vol 23 (4) ◽  
pp. 383-387
Author(s):  
Mikyeong Kim ◽  
Hyo-Jung Kang ◽  
Hae-Ryun Kwak ◽  
Jeong-Eun Kim ◽  
Jaedeok Kim ◽  
...  
Keyword(s):  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Spot Virus ◽  
First Report
Sign in / Sign up

Export Citation Format

Share Document