Chitosan Nanoparticles Inactivate Alfalfa Mosaic Virus Replication and Boost Innate Immunity in Nicotiana glutinosa Plants

Plant viral infection is one of the most severe issues in food security globally, resulting in considerable crop production losses. Chitosan is a well-known biocontrol agent against a variety of plant infections. However, research on combatting viral infections is still in its early stages. The current study investigated the antiviral activities (protective, curative, and inactivation) of the prepared chitosan/dextran nanoparticles (CDNPs, 100 µg mL−1) on Nicotiana glutinosa plants. Scanning electron microscope (SEM) and dynamic light scattering analysis revealed that the synthesized CDNPs had a uniform, regular sphere shapes ranging from 20 to 160 nm in diameter, with an average diameter of 91.68 nm. The inactivation treatment was the most effective treatment, which resulted in a 100% reduction in the alfalfa mosaic virus (AMV, Acc# OK413670) accumulation level. On the other hand, the foliar application of CDNPs decreased disease severity and significantly reduced viral accumulation levels by 70.43% and 61.65% in protective and curative treatments, respectively, under greenhouse conditions. Additionally, the induction of systemic acquired resistance, increasing total carbohydrates and total phenolic contents, as well as triggering the transcriptional levels of peroxidase, pathogen-related protein-1, and phenylalanine ammonia-lyase were observed. In light of the results, we propose that the potential application of CDNPs could be an eco-friendly approach to enhance yield and a more effective therapeutic elicitor for disease management in plants upon induction of defense systems.

First report of Sida leaf curl virus and associated betasatellite in tobacco

Tobacco (Nicotiana tabacum L.) is an economic crop and an important model plant for scientific research in the world. Cigar tobacco, a variety of tobacco, has been planted for industrial production in China since its introduction into the country in 2018 (Wang et al., 2021). In March 2020, symptoms like leaf curling, vein thickening and enation were frequently observed in cigar tobacco in several plantation areas of 100 hectares in Danzhou, Hainan Province, China (Fig. 1A). It was speculated that a geminivirus was the possible causing agent of the disease since the symptoms resembled those caused by geminiviruses besides the presence of their insect vectors - whiteflies. Five tobacco leaf samples were collected for DNA extraction, and pooled DNA was subjected to viral metagenomics analysis with Illumina Sequencing Technology (Illumina) at Tiangen Biotech, Beijing. A total of 67,774,552 filtered reads (99.84%) were matched to tobacco genome, and the remaining 110,908 reads (0.16%) were analyzed by BLASTn against GenBank virus Refseq Database with E-value smaller than 1e-6. Among the virus-matching sequencing data obtained, 65 and 2,058 reads were annotated as genomes of sida leaf curl virus (SiLCV, reference sequence: NC_007638) and its associated betasatellite (SiLCB, reference sequence: NC_007639), accounting for 3% and 95%, respectively. Thirty six reads matched to sweet potato vein clearing virus (reference sequence: NC_015228), and 7 reads matched to Emiliania huxleyi virus (reference sequence: JF429838). We speculated the causing pathogen of this disease might be SiLCV and its associated betasatellite. We next designed primers SiLCV-DNA-A-F/SiLCV-DNA-A-R (SiLCV-DNA-A-F: GAATTCTTTTCCTCGTCCAGG; SiLCV-DNA-A-R: CGCTTTAAAGACTTGGGCTTT) and SiLCV-β-F/SiLCV-β-R (SiLCV-β-F: ACCGGTGGCGAGCTGGTGTCT; SiLCV-β-R: AATATTAGAACGGTGGCGAGC) to amplify the complete genome of SiLCV and its associated betasatellite, respectively (Table S1). As expected, all five tobacco DNA samples were PCR-positive for the two sets of primers. Thereafter, the amplicons from one sample (Fig. 1B) were fully sequenced by Sanger sequencing at Tiangen Biotech, Beijing. The anticipated SiLCV genome with a length 2,760 nucleotides (accession no. MW465952) and its associated betasatellite with a length of 1,369 nucleotides (accession no. MW465953) exhibited the highest sequence identity of 93.5% and 95.6% with that of SiLCV isolate 61 (DQ641706; Ha et al., 2008) and isolate Hn57 (AM050732.1; Guo and Zhou 2006), respectively. This SiLCV isolate identified in Hainan province is named as SiLCV-HN, and its associated betasatellite is named as SiLCB-HN. Infectious clones of SiLCV-HN and SiLCB-HN were constructed by ligating two complete genomes of each SiLCV-HN and SiLCB-HN to a binary expression vector pCAMBIA1300 as previously described (Wang et al. 2019). Next, SiLCV-HN alone or co-infiltrated SiLCV-HN and SiLCB-HN were infiltrated into Nicotiana benthamiana. At 5 days post inoculation (5 dpi), typical begomovirus symptoms such as severe down-curl on newly emerging leaves displayed in SiLCV-HN and SiLCB-HN co-infiltrated N. benthamiana plants. Agroinoculation of N. benthamiana plants with SiLCV-HN alone showed severe leaf up-curl symptom at 12 dpi (Fig. 1C). Quantitative PCR results showed that the virus titer was higher in SiLCV-HN/SiLCB-HN co-infected plants in comparison to plants infected with SiLCV-HN individually (Fig. 1D). Typical virus symptoms and SiLCV DNA could also be detected in a wild tobacco species Nicotiana glutinosa when agroinfiltration-based infection was done, even though at a low infection efficacy (Fig. 1E and 1F). We could not make successful agroinfiltration-based infection of SiLCV in cigar tobacco due to unknown reasons. Nevertheless our data suggest that SiLCV-HN could infect species from Nicotiana genus and therefore poses severe threats to tobacco industry. References: Guo, X. J., & Zhou, X. P., 2006. Virus Genes. 10.1007/s11262-006-0066-8. Ha C., et al., 2008, The Journal of general virology. 10.1099/vir.0.83236-0. Wang, D., et al., 2019. Molecular plant-microbe interactions. 10.1094/MPMI-06-19-0163-FI. Wang, Y. Y., et al., 2021. Frontiers in plant science. 10.3389/fpls.2021.618133.

Cytological, Histological and Molecular Characterization of Two Isolates of Cucumber Mosaic Virus (CMV) in Egypt

Two isolates of Cucumber mosaic virus (CMV), CMV-wild tobacco (from Alexandria governorate) and CMV-cucumber (from Kafr El-Sheikh governorate) were investigated in this study. Cytological studies on epidermal strips of Nicotiana glutinosa leaves separately infected with each isolate revealed the presence of viral crystalline inclusion bodies within the infected cells. Electron microscopy of ultrathin sections of CMV infected N. glutinosa leaves showed significant alterations in the shape and internal structure of chloroplasts. The cell wall had serrated edges in infected cells but was more severe in cells infected with CMV-wild tobacco isolate compared to those infected with CMV-cucumber isolate. CMV-cucumber isolate was partially purified from systemically infected leaves of N. glutinosa. The ratio A260/ 280 was 1.0 and the concentration of the virus in the preparation was estimated using an extinction coefficient of E260nm0.1%, 1cm = 5. Yield of purified virus was about 2.8 mg/100 g fresh weight of infected N. glutinosa leaves. Electron microscopy of the purified preparation of CMV showed the presence of numerous spherical particles with a mean particle diameter of 28 nm. Amplified real-time reverse transcription-polymerase chain reaction (qRT-PCR) product of coat protein gene of each isolate was purified and sequenced. Sequences of both isolates had been submitted to GenBank Database and ware assigned accession number (LT669766) for CMV-cucumber isolate and (LT706517) for CMV-wild tobacco isolate. The sequences were edited using Chromas Pro. Version 1.34 software and compared with previously subgrouping of 27 isolates of the virus retrieved from the GenBank database. Both CMV-wild tobacco and CMV-cucumber isolates were closely related to the isolate with the accession number AJ585086 with a similarity of 97.07% and 98.54%, respectively, suggesting that the two isolates belong to subgroup II. According to the available literature, this is the first report in Egypt where CMV isolates belonging to subgroup II have been obtained

Endemic Atlantic Forest species of Caryophyllales as inhibitors of viral infection in zucchini

ABSTRACT In Brazil, zucchini (Cucurbita pepo) is a socioeconomically important vegetable affected by damage caused primarily by zucchini yellow mosaic virus (ZYMV). Although the occurrence of cucumber mosaic virus (CMV) is less frequent, in C. pepo ‘Caserta’ plants it can cause symptoms such as mottle, mosaic, leaf and fruit distortion, as well as reduced plant development. To minimize the damage, the most widely used management technique is the preventive, albeit inefficient, application of insecticides, aimed at controlling aphids, the vectors of this virus. Thus, the search for more effective and less environmentally harmful control methods has been the target of investigations. The purpose of the present study was to assess the action of the extracts of four native Caryophyllales species, as inhibitors of infection by CMV and ZYMV in C. pepo, in addition to evaluating the possible induced resistance in this species. Fresh leaf extracts (LEs) of Guapira opposita, Pisonia ambigua (Nyctaginaceae), Gallesia integrifolia and Seguieria langsdorffii (Phytolaccaceae), previously assessed in the tobacco mosaic virus / Nicotiana glutinosa pathosystem, were submitted to progressive dilutions sprayed on cotyledonary C. pepo leaves 30 min before inoculation with CMV and ZYMV. Leaf extracts of G. integrifolia did not induce inhibition in any of the pathosystems assessed. Guapira opposita LEs inhibited the infection of plants inoculated with ZYMV below 50% but inhibited CMV infection by 70% at a concentration of 1:40. Given that leaf extracts of P. ambigua and S. langsdorffii induced high percentage inhibition, evident in the number of asymptomatic plants and confirmed by serological tests, these species were selected to assess induced resistance in pre-treatment experiments. The LEs were efficient in inhibiting ZYMV and CMV infection in C. pepo when applied up to 48 h before inoculation. The LEs of S. langsdorffii and G. opposita, also tested for this system, were efficient when applied up to 72 h before CMV inoculation. The LEs can be prepared from dry leaves and maintained at -20°C for at least three years, conserving their inhibitory activity. These results expand the possibilities for producers and consumers alike in the sustainable management of the main zucchini viruses, without damaging the environment.

Ptr1 evolved convergently with RPS2 and Mr5 to mediate recognition of AvrRpt2 in diverse solanaceous species

SummaryThe Ptr1 (Pseudomonas tomato race 1) locus in Solanum lycopersicoides confers resistance to strains of Pseudomonas syringae pv. tomato expressing AvrRpt2 and Ralstonia pseudosolanacearum expressing RipBN. Here we describe the identification and phylogenetic analysis of the Ptr1 gene. A single recombinant among 585 F2 plants segregating for the Ptr1 locus was discovered that narrowed the Ptr1 candidates to eight nucleotide-binding leucine-rich repeat protein (NLR)-encoding genes. From analysis of the gene models in the S. lycopersicoides genome sequence and RNA-Seq data, two of the eight genes emerged as the strongest candidates for Ptr1. One of these two candidates was found to encode Ptr1 based on its ability to mediate recognition of AvrRpt2 and RipBN when it was transiently expressed with these effectors in leaves of Nicotiana glutinosa. The ortholog of Ptr1 in tomato and in Solanum pennellii is a pseudogene. However, a functional Ptr1 ortholog exists in N. benthamiana and potato and both mediate recognition of AvrRpt2 and RipBN. In apple and Arabidopsis, recognition of AvrRpt2 is mediated by the Mr5 and RPS2 proteins, respectively. Phylogenetic analysis places Ptr1 in a distinct clade compared to Mr5 and RPS2 and it therefore appears to have arisen by convergent evolution for recognition of AvrRpt2.

Inhibitory Effect of Osthole from Cnidium monnieri on Tobacco Mosaic Virus (TMV) Infection in Nicotiana glutinosa

The coumarin compound of osthole was extracted from Cnidium monnieri and identified by LC-MS and 1H- and 13C-NMR. Osthole was tested for anti-virus activity against tobacco mosaic virus (TMV) using the half-leaf method. The results showed that stronger antiviral activity on TMV infection appeared in Nicotiana glutinosa than that of eugenol and ningnanmycin, with inhibitory, protective, and curative effects of 72.57%, 70.26%, and 61.97%, respectively. Through observation of the TMV particles, we found that osthole could directly affect the viral particles. Correspondingly, the level of coat protein detected by Western blot was significantly reduced when the concentrations of osthole increased in tested plants compared to that of the control. These results suggest that osthole has anti-TMV activity and may be used as a biological reagent to control the plant virus in the half-leaf method.

Terpenoids in the Essential Oil and Concentrated Aromatic Products Obtained from Nicotiana glutinosa L. Leaves

N. glutinosa L. is a relatively less studied Nicotiana species (Solanaceae), although there are data about its importance as a model plant in viral control studies, as a gene donor in tobacco hybridization and as a source of agents with insecticidal or fungicidal effects. The biological activities of the species were associated mostly with the presence of leaf surface metabolites, in particular diterpenes and sucrose esters. The aim of this study was to identify the chemical composition of the essential oil (EO) and two aromatic extraction products (concrete and resinoid) obtained from N. glutinosa L. leaves. GC-MS analysis identified 26 components in the EO (representing 97.3% of total oil content), which contained mostly diterpene compounds with major components manool (14.2%), sclarene (8.4%) and manoyl oxide (8.1%). The number of compounds identified in the concrete was 37 (95.5% of the total content) and the major component was the diterpene alcohol sclareol (14.2%). In the resinoid, 30 volatile components (representing 95.1% of resinoid content) were identified, with major components nicotine (32.9%), α-tocopherol (8.2%), tridecanoin (6.9%), sclareol (6.9%), and solanone (6.9%). The group of bicyclic diterpenes had the largest share in the diterpene fraction of the products (57.3%, 91.7%, and 86.3%, respectively for the EO, concrete, and resinoid). Considering the abundance of sclareol in the aromatic products, the antimicrobial activity of the pure substance was determined. Sclareol was highly effective against a set of medicinally important yeasts; Candida albicans АТСС 10231, C. glabrata ATCC 90030, C. parapsilosis clinical isolate, and C. tropicalis NBIMCC 23, while being less effective against the studied Gram-positive and Gram-negative bacteria. Data from the study on N. glutinosa aromatic products composition may be of interest to the aroma industries for their possible use in perfumery and cosmetics.

Galling in Actinidia spp. seedlings

Several Actinidia spp. genotypes exhibit crown gall-like symptoms in both roots and canes. Galls form on roots and pruning wounds of canes. Investigations were undertaken to determine if an Agrobacterium species was responsible for gall formation in the Actinidia spp. material. Macerated galls were plated onto King’s B and various selective Agrobacterium agars, e.g. 1A and Roy & Sasser media. Bacterial isolates were tested by PCR for the presence of tumour-inducing (Ti) plasmids. Isolates that tested positive for the Ti plasmid were subsequently tested for pathogenicity by inoculation onto cut carrot discs, Nicotiana glutinosa and Solanum lycopersicum, and assessed for gall formation. Bacterial isolates that tested positive by PCR for the Ti plasmid were an orange tan colour on selective medium 1A, and clear with a red centre on the Roy & Sasser medium. Galls formed on cut carrots, S. lycopersicum and N. glutinosa after inoculation of Ti-positive bacterial isolates. Initial results indicate that an Agrobacterium species is associated with the formation of galls in Actinidia seedlings. However, biochemical characterisation and confirmation of Koch’s postulates using Actinidia species are needed for verification of this result.