Rapid Detection and Identification of Six Tomato yellow leaf curl virus Isolates from Different Regions Using Polymerase Chain Reaction and Restriction Enzyme Analysis

2013 ◽  
Vol 162 (4) ◽  
pp. 209-217 ◽  
Author(s):  
Jungan Park ◽  
Eui-Joon Kil ◽  
Jaedeok Kim ◽  
Yong-Gil Shin ◽  
Noh-Youl Heo ◽  
...  
Keyword(s):  
Rapid Detection ◽  
Tomato Yellow Leaf ◽  
Enzyme Analysis ◽  
Restriction Enzyme Analysis ◽  
Yellow Leaf ◽  
Chain Reaction ◽  
Detection And Identification ◽  
Polymerase Chain ◽  
Leaf Curl Virus ◽  
Virus Isolates

Detection and identification of Clavibacter michiganensis subsp. sepedonicus and Clavibacter michiganensis subsp. michiganensis by nonradioactive hybridization, polymerase chain reaction, and restriction enzyme analysis

1994 ◽  
Vol 40 (12) ◽  
pp. 1007-1018 ◽  
Author(s):  
J. L. W. Rademaker ◽  
J. D. Janse
Keyword(s):  
Polymerase Chain Reaction ◽  
Polymerase Chain Reaction Product ◽  
Enzyme Analysis ◽  
Restriction Enzyme Analysis ◽  
Bacterial Strains ◽  
Clavibacter Michiganensis ◽  
Chain Reaction ◽  
Clavibacter Michiganensis Subsp ◽  
Detection And Identification ◽  
Polymerase Chain

To develop a rapid and reliable detection and identification method for Clavibacter michiganensis subsp. sepedonicus and C. michiganensis subsp. michiganensis, two biotinylated probes and derived primer sets were evaluated for specificity using a large number of bacterial strains. Detection in dot blot analysis using the Diagen probe against C. michiganensis subsp. sepedonicus was possible with all 32 C. michiganensis subsp. sepedonicus strains tested. Cross-hybridization occurred with all nine C. michiganensis subsp. insidiosus strains tested. No hybridization occurred with any of 54 other related and unrelated bacterial strains including C. michiganensis subsp. michiganensis, C. michiganensis subsp. nebraskensis, C. michiganensis subsp. tessellarius, C. iranicus, C. rathayi, and C. tritici and potato saprophytes. Hybridization of the MIC 1 probe against C. michiganensis subsp. michiganensis was obtained with 22 out of 24 C. michiganensis subsp. michiganensis strains. A weak hybridization signal occurred only with two strains of C. michiganensis subsp. insidiosns. No hybridization occurred with any of the 71 other related and unrelated bacterial strains tested including tomato saprophytes. Restriction fragment length polymorphisms detected with the Diagen probe allowed differentiation between C. michiganensis subsp. sepedonicus and the related C. michiganensis subsp. insidiosus. Restriction fragment length polymorphism analysis using the MIC 1 probe and BamH1 showed at least two groups of patterns within C. michiganensis subsp. michiganensis. By using a primer set derived from the Diagen probe, a DNA sequence could be amplified with all C. michiganensis subsp. sepedonicus strains tested. Only the nontarget organism C. michiganensis subsp. insidiosus yielded a similar polymerase chain reaction product. Restriction enzyme analysis of the polymerase chain reaction product enabled rapid distinction between the subspecies. With a CMM primer set derived from the MIC 1 probe a DNA sequence was amplified from the same 22 out of 24 C. michiganensis subsp. michiganensis strains that showed hybridization with the MIC 1 probe. The polymerase chain reaction product could be verified by restriction enzyme analysis. The Diagen and MIC 1 probes and derived primer sets were shown to be useful for the detection and identification of C. michiganensis subsp. sepedonicus and C. michiganensis subsp. michiganensis. The MIC 1 probe, however, failed to detect two strains of the latter subspecies.Key words: biotin, PCR, REA, potato bacterial ring rot, bacterial canker of tomato, RFLP, Clavibacter michiganensis subsp. insidiosus.

scholarly journals First Report of Tomato yellow leaf curl virus Infecting Pepper Plants in Cuba

Plant Disease ◽  
2002 ◽  
Vol 86 (1) ◽  
pp. 73-73 ◽  
Author(s):  
M. Quiñones ◽  
D. Fonseca ◽  
Y. Martinez ◽  
G. P. Accotto
Keyword(s):  
Field Survey ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Chain Reaction ◽  
Tomato Production ◽  
First Report ◽  
Polymerase Chain ◽  
Leaf Curl Virus ◽  
Pepper Plants ◽  
Leaf Curl

The begomovirus Tomato yellow leaf curl virus (TYLCV) is one of the major threats to tomato production in tropical and subtropical regions worldwide. TYLCV was found in Cuba in 1994 and later became the most serious constraint to tomato production (2). During a field survey in 2001, pepper plants (Capsicum annuum) were observed in a greenhouse in Camagüey Province, showing mild interveinal yellowing and curling of leaves. Total nucleic acids were extracted from these plants and from pepper samples collected in previous years that showed similar symptoms. Polymerase chain reaction (PCR) was performed on extracts using a primer pair (TY-1/TY-2) (1) specific for the capsid protein (CP) gene of begomoviruses and a second primer pair (IR2353+: CTGAATGTTTGGATGGAAATGTGC; IR255-:GCTCGTAAGTTTCCT CAACGGAC) designed to amplify the part of the genome encompassing the intergenic region (IR) of the Cuban isolate of TYLCV-IS (2). With these primer pairs, amplicons of the expected size were obtained from five samples (one collected in 1995 in Havana Province, two in 1999 in Sancti Spiritus, and two in 2001 in Camagüey.) The CP fragment was digested with RsaI, while the IR amplicon was digested with AvaII and EcoRI. In all cases the patterns obtained corresponded to digestion patterns for identical PCR fragments obtained from TYLCV-infected tomatoes. The IR amplicon sequence from one sample showed ≈99% identity with the corresponding region of the TYLCV-IS isolated from tomato in Cuba. To our knowledge, this is the first report of TYLCV-IS infection in peppers in Cuba. References: (1) G. P. Accotto et al. Eur. J. Plant. Pathol. 106:179, 2000. (2) Y. Martínez et al. J. Phytopathol.144:277, 1996.

scholarly journals Genome Analysis of North American Small Ruminant Lentiviruses by Polymerase Chain Reaction and Restriction Enzyme Analysis

1995 ◽  
Vol 7 (4) ◽  
pp. 437-443 ◽  
Author(s):  
Sergio Rosati ◽  
Jimmy Kwang ◽  
James E. Keen
Keyword(s):  
Polymerase Chain Reaction ◽  
North American ◽  
Small Ruminant ◽  
Control Variable ◽  
Enzyme Analysis ◽  
Restriction Enzyme Analysis ◽  
Amplification Efficiency ◽  
Chain Reaction ◽  
Polymerase Chain ◽  
Small Ruminant Lentiviruses

The polymerase chain reaction (PCR) was used to amplify portions of the gag and env structural genes of 8 ovine and 1 caprine lentivirus isolates of North American origin. Three sets of primers were used to amplify p16, p25, and Nî-gp40 gene fragments, and 1 set, annealing highly conserved portions of long terminal repeat (LTR) among small ruminant lentiviruses, was used as a positive control. Variable PCR amplification efficiency was observed. Different stringency conditions of hybridization with specific DNA probes were used to maximize detection of the PCR product. The p25 primers detected all strains, the gp40 primers detected 1 ovine and the caprine strain, and the p16 primers detected only 1 ovine isolate. All strains were detected by LTR primers. Restriction endonuclease analysis of 5 amplified p25 and 2 Nî-gp40 gene fragments revealed extensive heterogeneity among these North American small ruminant lentiviruses.

scholarly journals Use of Tomato yellow leaf curl virus (TYLCV) Rep Gene Sequences to Engineer TYLCV Resistance in Tomato

2004 ◽  
Vol 94 (5) ◽  
pp. 490-496 ◽  
Author(s):  
Y. Yang ◽  
T. A. Sherwood ◽  
C. P. Patte ◽  
E. Hiebert ◽  
J. E. Polston
Keyword(s):  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Gene Sequences ◽  
Tomato Production ◽  
Challenge Inoculation ◽  
Biolistic Inoculation ◽  
Polymerase Chain ◽  
The Tropics ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a member of the genus Begomovirus (family Geminiviridae), causes severe losses in tomato production in the tropics and subtropics. In order to generate engineered resistance, eight different constructs of the TYLCV replication-associated protein (Rep) and C4 gene sequences were tested in transformed tomato inbred lines. Transgenic plants were screened for resistance to TYLCV using viruliferous whiteflies. No symptoms were observed and no TYLCV genomic DNA was detected by both hybridization and polymerase chain reaction in progenies of plants transformed with three constructs. This resistance was observed in plants that contained one of the following transgenes: 2/5Rep (81 nucleotides [nt] of the intergenic region [IR] plus 426 nt of the 5′ end of the TYLCV Rep gene), Δ2/5Rep (85 nt of the IR plus 595 nt of the 5′ end of the TYLCV Rep gene in the antisense orientation), and RepΔ2/5Rep (81 nt of the IR, the entire Rep gene, and 41 nt 3′ to the end of the Rep gene fused to Δ2/5Rep). Our study differs from other transgenic Geminivirus resistance reports involving the Rep gene in that viruliferous whiteflies were used for challenge inoculation instead of agroinoculation or biolistic inoculation, and TYLCV resistance was evaluated under field conditions.

Sign in / Sign up

Export Citation Format

Share Document