scholarly journals Occurrence of DMI-fungicide-resistant isolates of Mycovellosiella nattrassii Deighton, causal fungus of leaf mold of eggplant.

2000 ◽  
Vol 66 (2) ◽  
pp. 78-84 ◽  
Author(s):  
J. YAMAGUCHI ◽  
M. INADA ◽  
M. MATSUZAKI
Keyword(s):  
Leaf Mold ◽  
Causal Fungus

Cylindrocladium root rot in Ontario bare-root nurseries: estimate of spruce seedling losses

1988 ◽  
Vol 18 (11) ◽  
pp. 1493-1496 ◽  
Author(s):  
J. Juzwik ◽  
C. Honhart ◽  
N. Chong
Keyword(s):  
Visual Field ◽  
Root Rot ◽  
Disease Incidence ◽  
White Spruce ◽  
Visual Assessment ◽  
Inoculum Density ◽  
Field Assessment ◽  
Causal Fungus ◽  
Bare Root ◽  
Apparently Healthy

Estimates of cylindrocladium root rot losses in three black and three white spruce compartments at five Ontario bare-root nurseries were determined through visual field assessment and seedling isolation. The causal fungus, Cylindrocladiumfloridanum Sob. & C.P. Seym., was isolated from 10–77% of the symptomatic and 0–28% of the apparently healthy seedlings in each compartment. In five compartments, estimates of mean incidence based on seedling isolations and visual assessment, were higher than those based on visual assessment alone. The percentage of living spruce (apparently healthy or symptomatic) estimated to be infected in each compartment was 0.1–32.7%. No fungus isolations were attempted from dead seedlings. Mortality in the plots in the six compartments was 0.02–17.7%. The correlation between the level of Cylindrocladium incidence and the inoculum density was significant (p < 0.01) in two compartments. The use of inoculum density to predict disease incidence warrants further investigation.

Accumulation of phytoalexins in the compatible interaction between Cladosporium fulvum and tomato in relation to colonization

1991 ◽  
Vol 69 (4) ◽  
pp. 822-830 ◽  
Author(s):  
Ulisses G. Batista ◽  
Verna J. Higgins
Keyword(s):  
Suspension Culture ◽  
Germ Tube ◽  
Plant Cells ◽  
Cladosporium Fulvum ◽  
In Vitro Experiments ◽  
Compatible Interaction ◽  
Leaf Mold ◽  
Production And Distribution ◽  
Fulvia Fulva

The production and distribution of the phytoalexin falcarindiol in tomato foliage infected with leaf mold was examined to determine how the fungus Cladosporium fulvum is able to colonize and sporulate in an apparently antifungal environment. In a compatible interaction (cv. Potentate – C. fulvum race 2.3), by 12 and 15 days after inoculation, solvent-extractable falcarindiol and two other phytoalexins from tomato, compound 2 (probably falcarinol) and compound 3 (unidentified), reached concentrations considerably in excess of ED50 values for inhibition of the fungus. In contrast, intercellular (apoplastic) fluids obtained from similarly infected leaflets contained only traces of falcarindiol. ED50 values for germination and germ-tube growth of C. fulvum increased as the incubation time was extended, suggesting that adaptation or recovery was possible at the concentrations tested. In in vitro experiments, C. fulvum appeared to readily metabolize falcarindiol, as did a Lycopersicon cell suspension culture. Binding of falcarindiol to living and dead fungal and plant cells was also observed. Falcarindiol, injected into tomato leaflets, decreased rapidly and was only recovered in trace amounts by 24 h. The results suggest that falcarindiol and probably the two other phytoalexins do not reach sufficient concentrations in the apoplast of an infected susceptible leaf to have an effect on growth and sporulation of C. fulvum. Key words: leaf mold, Fulvia fulva, falcarindiol, falcarinol.

Detection of Thiophanate-methyl-resistant Strains in Diplocarpon mail, Causal Fungus of Apple Blotch

2000 ◽  
Vol 66 (1) ◽  
pp. 82-85 ◽  
Author(s):  
Shuhei TANAKA ◽  
Nobue KAMEGAWA ◽  
Shin-ichi ITO ◽  
Mitsuro KAMEYA-IWAKI
Keyword(s):  
Thiophanate Methyl ◽  
Causal Fungus ◽  
Resistant Strains

Identification of Сf-9 gene alleles of resistance to leaf mold in F1 tomato hybrids bred by Poisk Agrofirm

2021 ◽  
pp. 35-37
Author(s):  
А.С. Ерошевская ◽  
А.А. Егорова ◽  
Н.А. Милюкова ◽  
А.С. Пырсиков
Keyword(s):  
Genetic Analysis ◽  
Scar Marker ◽  
Molecular Genetic ◽  
Molecular Genetic Analysis ◽  
F1 Hybrids ◽  
Agarose Gel ◽  
Breeding Programs ◽  
Taq Polymerase ◽  
Leaf Mold ◽  
C 30

В статье представлены результаты молекулярно-генетического анализа F1 гибридов томата разных товарных групп на наличие аллелей гена устойчивости Cf-9 к кладоспориозу. Молекулярно-генетический анализ проводили в лаборатории маркерной и геномной селекции растений ФГБНУ ВНИИСБ в 2019 году. В качестве объекта исследования использованы 16 F1 гибридов томата, в том числе 10 крупноплодных, 1 кистевой, 1 коктейль и 4 черри. Повторность исследований двухкратная (одна повторность – одно растение). Для идентификации аллелей гена Cf-9 устойчивости к кладоспориозу применяли SCAR-маркер со следующими праймерами: CS5 (TTTCCAACTTACAATCCCTTC), DS1 (GAGAGCTCAACCTTTACGAA), CS1 (GCCGTTCAAGTTGGGTGTT). Реакционная смесь для ПЦР объемом 25 мкл содержала 50–100 нг ДНК, 2,5 мМ dNTP, 3 мМ MgSO4, 10 пМ каждого праймера, 2 ед. Taq-полимеразы (ООО «НПФ Синтол») и 2х стандартный ПЦР буфер. Реакцию проводили в амплификаторе Termal Cycler Bio-Rad T 100 по программе 95 °C – 5 мин, 35 циклов 95 °C – 20 с, 60 °C – 30 с, 72 °C – 30 с, финальная элонгация в течение 5 мин при 72 °C. Визуализацию результатов ПЦР проводили путем электрофореза в 1,7%-ном агарозном геле с 1х ТАЕ буфером, результаты анализировали с помощью системы Gel Doc 2000 (Bio-Rad Laboratories, Inc., США). При идентификации гена устойчивости Cf-9 к кладоспориозу у изучаемых гибридов томата F1 были выявлены фрагменты размером 378 п. н. (аллель Cf-9) и 507 п. н. (аллель 9DC), что указывает на их устойчивость к этому заболеванию. Согласно результатам исследований, из 16 F1 гибридов томата 13 устойчивы к кладоспориозу, причем у 12 из них выявлено наличие только аллелей Cf-9, 1 гибрид имеет в генотипе оба аллеля устойчивости – Cf-9 и 9DС. Доминантные гомозиготы по гену Cf-9 будут использованы в селекционных программах Агрофирмы «Поиск» для создания линий-доноров устойчивости к кладоспориозу. The article presents the results of molecular genetic analysis of F1 tomato hybrids of different commodity groups for presence of Cf-9 gene alleles of resistance to leaf mold. The molecular genetic analysis was carried out in the laboratory of marker and genomic plant breeding of FSBSI VNIISB in 2019. 16 F1 tomato hybrids were used as the object of the study, including 10 large-fruited, 1 brush, 1 cocktail and 4 cherry. The repetition of studies is two-fold (one frequency – one plant). To identify alleles of the Cf-9gene for cladosporiosis resistance, a SCAR marker with the following primers was used: CS5 (TTTCCAACTTACAATCCCTTC), DS1 (GAGAGCTCAACCTTTACGAA), CS1 (GCCGTTCAAGTTGGGTGTT). The reaction mixture for PCR with a volume of 25 µl contained 50–100 ng of DNA, 2.5 mM dNTP, 3 mM MgSO4, 10 pM of each primer, 2 units. Taq-polymerase (LLC NPF Synthol) and 2x standard PCR buffer. The reaction was carried out in the Termal Cycler Bio-Rad T 100 amplifier according to the program 95 °C – 5 min, 35 cycles 95 °C – 20 s, 60 °C – 30 s, 72 °C – 30 s, the final elongation for 5 minutes at 72 °C. The PCR results were visualized by electrophoresis in a 1.7% agarose gel with 1x TAE buffer, the results were analyzed using the Gel Doc 2000 system (Bio-Rad Laboratories, Inc., USA). The identification of the Cf-9resistance gene to cladosporiosis in the studied tomato F1 hybrids revealed fragments of 378 bp (Cf-9 allele) and 507 bp (9DC allele), which indicates their resistance to this disease. According to the research results, 13 out of 16 tomato F1 hybrids are resistant to cladosporiosis, and 12 of them have only Cf-9 alleles, 1 hybrid has both Cf-9 and 9DC resistance alleles in the genotype. Dominant homozygotes for the Cf-9 gene will be used in breeding programs of Poisk Agrofirm to create donor lines for resistance to cladosporiosis.

Sign in / Sign up

Export Citation Format

Share Document