G-Quadruplexes Formation at the Upstream Region of Replication Origin (OriL) of the Pseudorabies Virus: Implications for Antiviral Targets

Pseudorabies virus (PRV) is the causative agent of Aujeszky’s disease, which still causes large economic losses for the swine industry. Therefore, it is urgent to find a new strategy to prevent and control PRV infection. Previous studies have proven that guanine (G)-rich DNA or RNA sequences in some other viruses’ genomes have the potential to form G-quadruplex (G4), which serve as promising antivirus targets. In this study, we identified two novel G4-forming sequences, OriL-A and OriL-S, which are located at the upstream origin of replication (OriL) in the PRV genome and conserved across 32 PRV strains. Circular dichroism (CD) spectroscopy and a gel electrophoresis assay showed that the two G-rich sequences can fold into parallel G4 structures in vitro. Moreover, fluorescence resonance energy transfer (FRET) melting and a Taq polymerase stop assay indicated that the G4 ligand PhenDC3 has the capacity to bind and stabilize the G4. Notably, the treatment of PRV-infected cells with G4-stabilizer PhenDC3 significantly inhibited PRV DNA replication in host cells but did not affect PRV’s attachment and entry. These results not only expand our knowledge about the G4 characteristics in the PRV genome but also suggest that G4 may serve as an innovative therapeutic target against PRV.

Modification Of Taq DNA Polymerase with Improved Elongation Ability

Thermostable polymerases play a significant role in molecular biology and diagnostic practice. The most famous and demanded is Polymerase I from the thermophilic bacterium Thermus aquaticus (Taq-pol). This polymerase at one time made a kind of revolution in the polymerase chain reaction. In this work, we attempted to modify this polymerase by attaching an additional Sso7d protein from Sulfolobus solfataricus to Taq-pol, which provides additional binding to the double-stranded DNA of the template. Sso7d-Taq fusion gene was expressed in BL21(DE3) cells. Optimal conditions were selected for maximum production of modified Sso7d-Taq polymerase. The optimal conditions for the intracellular accumulation of Sso7d-Taq polymerase: activation of the T7 promoter when the optical density of the culture reaches OD600 = 0.8-1.0 by adding IPTG at a concentration of 0.2 mM, followed by incubation of the culture at 37°C for 20-24 hours. Recombinant Sso7d-Taq polymerase has been purified and tested by PCR for thermal stability and elongation time. It was found that the Sso7d-Taq enzyme withstands 5 hour incubation at 95°C and 75 minute incubation at 98°C. Comparative analysis with unmodified Taq DNA polymerase showed that the Sso7d-Taq enzyme reduces the elongation rate by several times - up to 15-13 seconds per 1 kbp. The results obtained indicate the prospects of using Sso7d-Taq DNA polymerase in scientific research and diagnostic practice.

Instant Taq: Rapid Autoinducible Expression and Chromatography-free Purification of Taq polymerase.

DNA modifying enzymes are ubiquitous reagents in synthetic biology. Producing these enzymes often requires large culture volumes, purified nucleases and chromatographic separations to make enzymes of necessary quality. We sought to leverage synthetic biology tools to develop engineered strains allowing for not only the production but rapid purification of these reagents. Toward this goal, we report an E. coli strain enabling the rapid production and purification of Taq polymerase. The method relies on 1) autoinducible expression achieving high protein titers, 2) autolysis and auto DNA/RNA hydrolysis via lysozyme and a mutant benzonase, and 3) heat denaturation under reducing conditions to precipitate contaminating proteins including the mutant benzonase. Taq polymerase is obtained at high purities (>95% pure by SDS-PAGE) and is readily usable in standard reactions. The method takes less than 1 hour of hands-on time, does not require special equipment, expensive reagents or affinity purification. We expect this simple methodology and approach will improve access not only to Taq polymerase but to numerous additional commonly utilized reagent proteins.

Development of a recombinant Taq DNA polymerase enzyme expressed using a synthetic gene and its comparison with a commercial enzyme

Taq DNA polymerase is a thermostable enzyme widely used for DNA amplification in the PCR technique. It was initially characterized and isolated from thermophilic bacteria, Thermus aquaticus. It was difficult to developed in this enzyme using a native host system. Therefore, the development of the recombinant Taq DNA polymerase expressed using a synthetic gene is important to improve production efficiency. In this study, we developed the in house Taq DNA polymerase recombinant based on a codon-optimized using E. coli expression system. We cloned 2685 bp of the Taq DNA polymerase gene in the pET151/D-TOPO vector. The gene was synthesized and the expression was analyzed with SDS-PAGE technique which indicated with a 100.9 kDa specific target protein. The concentration and activity of this purified enzyme were 5.17 mg/mL and 4.647 U/µL, respectively. The application of this enzyme to the PCR technique showed that this enzyme could amplify the target genes from 200 bp to 3500 bp amplicons with a minimum DNA concentration template 10 ng/µL. This assumes that the in house recombinant Taq DNA polymerase based on synthetic genes is successfully expressed, purified, and was functional and comparable to the commercial Taq polymerase.

Identification of Сf-9 gene alleles of resistance to leaf mold in F1 tomato hybrids bred by Poisk Agrofirm

В статье представлены результаты молекулярно-генетического анализа F1 гибридов томата разных товарных групп на наличие аллелей гена устойчивости Cf-9 к кладоспориозу. Молекулярно-генетический анализ проводили в лаборатории маркерной и геномной селекции растений ФГБНУ ВНИИСБ в 2019 году. В качестве объекта исследования использованы 16 F1 гибридов томата, в том числе 10 крупноплодных, 1 кистевой, 1 коктейль и 4 черри. Повторность исследований двухкратная (одна повторность – одно растение). Для идентификации аллелей гена Cf-9 устойчивости к кладоспориозу применяли SCAR-маркер со следующими праймерами: CS5 (TTTCCAACTTACAATCCCTTC), DS1 (GAGAGCTCAACCTTTACGAA), CS1 (GCCGTTCAAGTTGGGTGTT). Реакционная смесь для ПЦР объемом 25 мкл содержала 50–100 нг ДНК, 2,5 мМ dNTP, 3 мМ MgSO4, 10 пМ каждого праймера, 2 ед. Taq-полимеразы (ООО «НПФ Синтол») и 2х стандартный ПЦР буфер. Реакцию проводили в амплификаторе Termal Cycler Bio-Rad T 100 по программе 95 °C – 5 мин, 35 циклов 95 °C – 20 с, 60 °C – 30 с, 72 °C – 30 с, финальная элонгация в течение 5 мин при 72 °C. Визуализацию результатов ПЦР проводили путем электрофореза в 1,7%-ном агарозном геле с 1х ТАЕ буфером, результаты анализировали с помощью системы Gel Doc 2000 (Bio-Rad Laboratories, Inc., США). При идентификации гена устойчивости Cf-9 к кладоспориозу у изучаемых гибридов томата F1 были выявлены фрагменты размером 378 п. н. (аллель Cf-9) и 507 п. н. (аллель 9DC), что указывает на их устойчивость к этому заболеванию. Согласно результатам исследований, из 16 F1 гибридов томата 13 устойчивы к кладоспориозу, причем у 12 из них выявлено наличие только аллелей Cf-9, 1 гибрид имеет в генотипе оба аллеля устойчивости – Cf-9 и 9DС. Доминантные гомозиготы по гену Cf-9 будут использованы в селекционных программах Агрофирмы «Поиск» для создания линий-доноров устойчивости к кладоспориозу. The article presents the results of molecular genetic analysis of F1 tomato hybrids of different commodity groups for presence of Cf-9 gene alleles of resistance to leaf mold. The molecular genetic analysis was carried out in the laboratory of marker and genomic plant breeding of FSBSI VNIISB in 2019. 16 F1 tomato hybrids were used as the object of the study, including 10 large-fruited, 1 brush, 1 cocktail and 4 cherry. The repetition of studies is two-fold (one frequency – one plant). To identify alleles of the Cf-9gene for cladosporiosis resistance, a SCAR marker with the following primers was used: CS5 (TTTCCAACTTACAATCCCTTC), DS1 (GAGAGCTCAACCTTTACGAA), CS1 (GCCGTTCAAGTTGGGTGTT). The reaction mixture for PCR with a volume of 25 µl contained 50–100 ng of DNA, 2.5 mM dNTP, 3 mM MgSO4, 10 pM of each primer, 2 units. Taq-polymerase (LLC NPF Synthol) and 2x standard PCR buffer. The reaction was carried out in the Termal Cycler Bio-Rad T 100 amplifier according to the program 95 °C – 5 min, 35 cycles 95 °C – 20 s, 60 °C – 30 s, 72 °C – 30 s, the final elongation for 5 minutes at 72 °C. The PCR results were visualized by electrophoresis in a 1.7% agarose gel with 1x TAE buffer, the results were analyzed using the Gel Doc 2000 system (Bio-Rad Laboratories, Inc., USA). The identification of the Cf-9resistance gene to cladosporiosis in the studied tomato F1 hybrids revealed fragments of 378 bp (Cf-9 allele) and 507 bp (9DC allele), which indicates their resistance to this disease. According to the research results, 13 out of 16 tomato F1 hybrids are resistant to cladosporiosis, and 12 of them have only Cf-9 alleles, 1 hybrid has both Cf-9 and 9DC resistance alleles in the genotype. Dominant homozygotes for the Cf-9 gene will be used in breeding programs of Poisk Agrofirm to create donor lines for resistance to cladosporiosis.

Switching the activity of Taq polymerase using clamp-like triplex aptamer structure

In nature, allostery is the principal approach for regulating cellular processes and pathways. Inspired by nature, structure-switching aptamer-based nanodevices are widely used in artificial biotechnologies. However, the canonical aptamer structures in the nanodevices usually adopt a duplex form, which limits the flexibility and controllability. Here, a new regulating strategy based on a clamp-like triplex aptamer structure (CLTAS) was proposed for switching DNA polymerase activity via conformational changes. It was demonstrated that the polymerase activity could be regulated by either adjusting structure parameters or dynamic reactions including strand displacement or enzymatic digestion. Compared with the duplex aptamer structure, the CLTAS possesses programmability, excellent affinity and high discrimination efficiency. The CLTAS was successfully applied to distinguish single-base mismatches. The strategy expands the application scope of triplex structures and shows potential in biosensing and programmable nanomachines.

Impact of metal ions on PCR inhibition and RT-PCR efficiency

Inhibition of PCR by metal ions can pose a serious challenge in the process of forensic DNA analysis. Samples contaminated with various types of metal ions encountered at crime scenes include swabs from metal surfaces such as bullets, cartridge casings, weapons (including guns and knives), metal wires and surfaces as well as bone samples which contain calcium. The mechanism behind the impact of metal ions on DNA recovery, extraction and subsequent amplification is not fully understood. In this study, we assessed the inhibitory effects of commonly encountered metals on DNA amplification. Of the nine tested metals, zinc, tin, iron(II) and copper were shown to have the strongest inhibitory properties having IC50 values significantly below 1 mM. In the second part of the study, three commercially available DNA polymerases were tested for their susceptibility to metal inhibition. We found that KOD polymerase was the most resistant to metal inhibition when compared with Q5 and Taq polymerase. We also demonstrate how the calcium chelator ethylene glycol-bis(2-aminoethylether)-N,N,N′,N′-tetraacetic acid (EGTA) can be used as an easy and non-destructive method of reversing calcium-induced inhibition of PCR reactions.

One enzyme reverse transcription qPCR using Taq DNA polymerase

ABSTRACTTaq DNA polymerase, one of the first thermostable DNA polymerases to be discovered, has been typecast as a DNA-dependent DNA polymerase commonly employed for PCR. However, Taq polymerase belongs to the same DNA polymerase superfamily as the Molony murine leukemia virus reverse transcriptase and has in the past been shown to possess reverse transcriptase activity. We report optimized buffer and salt compositions that promote the reverse transcriptase activity of Taq DNA polymerase, and thereby allow it to be used as the sole enzyme in TaqMan RT-qPCR reactions. We demonstrate the utility of Taq-alone RT-qPCR reactions by executing CDC SARS-CoV-2 N1, N2, and N3 TaqMan RT-qPCR assays that could detect as few as 2 copies/µL of input viral genomic RNA.