The diversity of Passalora fulva Isolates Collected from Tomato Plants in US high tunnels

High tunnels extend the growing season of high value crops, including tomatoes, but the environmental conditions within high tunnels favor the spread of the tomato leaf mold pathogen, Passalora fulva (syn. Cladosporium fulvum). Tomato leaf mold results in defoliation, and if severe, losses in yield. Despite substantial research, little is known regarding the genetic structure and diversity of populations of P. fulva associated with high tunnel tomato production in the United States. From 2016 to 2019, a total of 50 P. fulva isolates were collected from tomato leaf samples in high tunnels in the Northeast and Minnesota. Other Cladosporium species were also isolated from the leaf surfaces. Koch’s postulates were conducted to confirm that P. fulva was the cause of the disease symptoms observed. Race determination experiments revealed that the isolates belonged to either race 0 (six isolates) or race 2 (44 isolates). Polymorphisms were identified within four previously characterized effector genes Avr2, Avr4, Avr4e, and Avr9. The largest number of polymorphisms were observed for Avr2. Both mating type genes, MAT1-1-1 and MAT1-2-1, were present in the isolate collection. For further insights into the pathogen diversity, the 50 isolates were genotyped at 7,514 single-nucleotide polymorphism loci using genotyping-by-sequencing: differentiation by region but not by year was observed. Within the collection of 50 isolates, there were 18 distinct genotypes. Information regarding P. fulva population diversity will enable better management recommendations for growers, as high tunnel production of tomatoes expands.

Gene Based ­­­­Markers in Marker-Assisted Selection to Screen Tomato Genotypes Resistant to Fusarium Wilt, Late Blight, Verticillium Wilt, Leaf Mold, Bacterial Spot and Bacterial Speck

The authors have requested that this preprint be withdrawn due to author disagreement.

Gene Based ­­­­Markers in Marker-Assisted Selection to Screen Tomato Genotypes Resistant to Fusarium Wilt, Late Blight, Verticillium Wilt, Leaf Mold, Bacterial Spot and Bacterial Speck

The tomato crop is exposed to serious losses due to infection with several diseases and pests, which threaten tomato production in Egypt and worldwide. Therefore, selecting the tomato germplasm resistant or tolerant to a specific pathogen by molecular markers closely linked to resistance loci is a desirable goal of this study. In this work, seven co-dominant markers targeting six resistance genes (I-1, Ve, Ph3, Cf-9/Cf-4, Rx4, and Pto) for six main diseases [ fusarium wilt (Fusarium oxysporum f. sp. lycopersici), verticillium wilt (Verticillium dahliae and V. alboatrum), late blight (Phytophthora infestans), leaf mold (Cladosporium fulvum), bacterial spot (Xanthomonas campestris pv. vesicatoria) and bacterial speck (Pseudomonas syringae pv. tomato)], respectively were determined. Theses molecular markers differentiated among 19 tomato genotypes resistant (homozygote/heterozygote) and susceptible (homozygote) to the pathogens. Therefore, this study supplied us with novel tomato lines with resistance to multiple diseases, and their pyramiding inside domesticated tomato cultivars are suggested to apply in the tomato breeding programs of resistance against fungal and bacterial diseases.

Identification of Сf-9 gene alleles of resistance to leaf mold in F1 tomato hybrids bred by Poisk Agrofirm

В статье представлены результаты молекулярно-генетического анализа F1 гибридов томата разных товарных групп на наличие аллелей гена устойчивости Cf-9 к кладоспориозу. Молекулярно-генетический анализ проводили в лаборатории маркерной и геномной селекции растений ФГБНУ ВНИИСБ в 2019 году. В качестве объекта исследования использованы 16 F1 гибридов томата, в том числе 10 крупноплодных, 1 кистевой, 1 коктейль и 4 черри. Повторность исследований двухкратная (одна повторность – одно растение). Для идентификации аллелей гена Cf-9 устойчивости к кладоспориозу применяли SCAR-маркер со следующими праймерами: CS5 (TTTCCAACTTACAATCCCTTC), DS1 (GAGAGCTCAACCTTTACGAA), CS1 (GCCGTTCAAGTTGGGTGTT). Реакционная смесь для ПЦР объемом 25 мкл содержала 50–100 нг ДНК, 2,5 мМ dNTP, 3 мМ MgSO4, 10 пМ каждого праймера, 2 ед. Taq-полимеразы (ООО «НПФ Синтол») и 2х стандартный ПЦР буфер. Реакцию проводили в амплификаторе Termal Cycler Bio-Rad T 100 по программе 95 °C – 5 мин, 35 циклов 95 °C – 20 с, 60 °C – 30 с, 72 °C – 30 с, финальная элонгация в течение 5 мин при 72 °C. Визуализацию результатов ПЦР проводили путем электрофореза в 1,7%-ном агарозном геле с 1х ТАЕ буфером, результаты анализировали с помощью системы Gel Doc 2000 (Bio-Rad Laboratories, Inc., США). При идентификации гена устойчивости Cf-9 к кладоспориозу у изучаемых гибридов томата F1 были выявлены фрагменты размером 378 п. н. (аллель Cf-9) и 507 п. н. (аллель 9DC), что указывает на их устойчивость к этому заболеванию. Согласно результатам исследований, из 16 F1 гибридов томата 13 устойчивы к кладоспориозу, причем у 12 из них выявлено наличие только аллелей Cf-9, 1 гибрид имеет в генотипе оба аллеля устойчивости – Cf-9 и 9DС. Доминантные гомозиготы по гену Cf-9 будут использованы в селекционных программах Агрофирмы «Поиск» для создания линий-доноров устойчивости к кладоспориозу. The article presents the results of molecular genetic analysis of F1 tomato hybrids of different commodity groups for presence of Cf-9 gene alleles of resistance to leaf mold. The molecular genetic analysis was carried out in the laboratory of marker and genomic plant breeding of FSBSI VNIISB in 2019. 16 F1 tomato hybrids were used as the object of the study, including 10 large-fruited, 1 brush, 1 cocktail and 4 cherry. The repetition of studies is two-fold (one frequency – one plant). To identify alleles of the Cf-9gene for cladosporiosis resistance, a SCAR marker with the following primers was used: CS5 (TTTCCAACTTACAATCCCTTC), DS1 (GAGAGCTCAACCTTTACGAA), CS1 (GCCGTTCAAGTTGGGTGTT). The reaction mixture for PCR with a volume of 25 µl contained 50–100 ng of DNA, 2.5 mM dNTP, 3 mM MgSO4, 10 pM of each primer, 2 units. Taq-polymerase (LLC NPF Synthol) and 2x standard PCR buffer. The reaction was carried out in the Termal Cycler Bio-Rad T 100 amplifier according to the program 95 °C – 5 min, 35 cycles 95 °C – 20 s, 60 °C – 30 s, 72 °C – 30 s, the final elongation for 5 minutes at 72 °C. The PCR results were visualized by electrophoresis in a 1.7% agarose gel with 1x TAE buffer, the results were analyzed using the Gel Doc 2000 system (Bio-Rad Laboratories, Inc., USA). The identification of the Cf-9resistance gene to cladosporiosis in the studied tomato F1 hybrids revealed fragments of 378 bp (Cf-9 allele) and 507 bp (9DC allele), which indicates their resistance to this disease. According to the research results, 13 out of 16 tomato F1 hybrids are resistant to cladosporiosis, and 12 of them have only Cf-9 alleles, 1 hybrid has both Cf-9 and 9DC resistance alleles in the genotype. Dominant homozygotes for the Cf-9 gene will be used in breeding programs of Poisk Agrofirm to create donor lines for resistance to cladosporiosis.

First Draft Genome Resource for the Tomato Black Leaf Mold Pathogen Pseudocercospora fuligena

Pseudocercospora fuligena is a fungus that causes black leaf mold, an important disease of tomato in tropical and subtropical regions of the world. Despite its economic importance, genomic resources for this pathogen are scarce and no reference genome was available thus far. Here, we report a 50.6-Mb genome assembly for P. fuligena, consisting of 348 contigs with an N50 value of 0.407 Mb. In total, 13,764 protein-coding genes were predicted with an estimated BUSCO completeness of 98%. Among the predicted genes there were 179 candidate effectors, 445 carbohydrate-active enzymes, and 30 secondary metabolite gene clusters. The resources presented in this study will allow genome-wide comparative analyses and population genomic studies of this pathogen, ultimately improving management strategies for black leaf mold of tomato.