First report of Rhizoctonia disease of lily caused by Rhizoctonia solani AG-11 in Japan

2017 ◽  
Vol 83 (6) ◽  
pp. 406-409 ◽  
Author(s):  
Tomoo Misawa ◽  
Miyuki Kayamori ◽  
Daisuke Kurose ◽  
Jun Sasaki ◽  
Takeshi Toda
Plant Disease ◽  
2019 ◽  
Vol 103 (3) ◽  
pp. 581
Author(s):  
B. Xia ◽  
C. T. Xu ◽  
J. K. Xu ◽  
Y. H. Wu ◽  
Q. Xie ◽  
...  

Plant Disease ◽  
2010 ◽  
Vol 94 (1) ◽  
pp. 125-125 ◽  
Author(s):  
G. Polizzi ◽  
D. Aiello ◽  
I. Castello ◽  
V. Guarnaccia ◽  
A. Vitale

Mediterranean fan palm (Chamaerops humilis L.), one of just two autochthonous European palms, is native to the western Mediterranean Region in southwestern Europe and northwestern Africa. It can be found growing wild in the Mediterranean area. In Europe, this species is very popular as an ornamental plant. In March 2009, a widespread damping-off was observed in a stock of approximately 30,000 potted 1-month-old plants of C. humilis cv. Vulcano in a nursery in eastern Sicily. Disease incidence was approximately 20%. Disease symptoms consisted of lesions at the seedling shoot (plumule). Stem lesions were initially orange, turned brown, and followed by death of the entire plumule or eophyll. A fungus with mycelial and morphological characteristics of Rhizoctonia solani Kühn was consistently isolated from lesions when plated on potato dextrose agar (PDA) amended with streptomycin sulfate at 100 μg/ml. Fungal colonies were initially white, turned brown with age, and produced irregularly shaped, brown sclerotia. Mycelium was branched at right angles with a septum near the branch and a slight constriction at the branch base. Hyphal cells removed from cultures grown at 25°C on 2% water agar were determined to be multinucleate when stained with 1% safranin O and 3% KOH solution (1) and examined at ×400. Anastomosis groups were determined by pairing isolates with tester strains AG-1 IA, AG-2-2-1, AG-2-2IIIB, AG-2-2IV, AG-3, AG-4, AG-5, AG-6, and AG-11 on 2% water agar in petri plates (3). Anastomosis was observed only with tester isolates of AG-4, giving both C2 and C3 reactions (2). One representative isolate obtained from symptomatic tissues was deposited at the Fungal Biodiversity Centre, Centraalbureau voor Schimmelcultures (CBS No. 125095). Pathogenicity tests were performed on container-grown, healthy, 1-month-old seedlings. Twenty plants of C. humilis cv. Vulcano were inoculated near the base of the stem with two 1-cm2 PDA plugs from 5-day-old mycelial cultures. The same number of plants served as uninoculated controls. Plants were incubated in a growth chamber and maintained at 25°C and 95% relative humidity on a 12-h fluorescent light/dark regimen. Symptoms identical to those observed in the nursery appeared 5 days after inoculation and all plants died within 20 days. No disease was observed on control plants. A fungus identical in culture morphology to R. solani AG-4 was consistently reisolated from symptomatic tissues, confirming its pathogenicity. To our knowledge, this is the first report in the world of R. solani causing damping-off on Mediterranean fan palm. References: (1) R. J. Bandoni. Mycologia 71:873, 1979. (2) D. E. Carling. Page 37 in: Grouping in Rhizoctonia solani by Hyphal Anastomosis Reactions. Kluwer Academic Publishers, the Netherlands, 1996. (3) C. C. Tu and J. W. Kimbrough. Mycologia 65:941, 1973.


Plant Disease ◽  
2006 ◽  
Vol 90 (8) ◽  
pp. 1109-1109 ◽  
Author(s):  
A. Garibaldi ◽  
G. Gilardi ◽  
M. L. Gullino

Lamb's lettuce or corn salad (Valerianella olitoria) is increasingly grown in Italy and used primarily in the preparation of mixed processed salad. In the fall of 2005, plants of lamb's lettuce, cv Trophy, exhibiting a basal rot were observed in some commercial greenhouses near Bergamo in northern Italy. The crown of diseased plants showed extensive necrosis, progressing to the basal leaves, with plants eventually dying. The first symptoms, consisting of water-soaked zonate lesions on basal leaves, were observed on 30-day-old plants during the month of October when temperatures ranged between 15 and 22°C. Disease was uniformly distributed in the greenhouses, progressed rapidly in circles, and 50% of the plants were affected. Diseased tissue was disinfested for 1 min in 1% NaOCl and plated on potato dextrose agar amended with 100 μg/liter of streptomycin sulfate. A fungus with the morphological characteristics of Rhizoctonia solani was consistently and readily isolated and maintained in pure culture after single-hyphal tipping (3). The five isolates of R. solani, obtained from affected plants successfully anastomosed with tester isolate AG 4, no. RT 31, received from R. Nicoletti of the Istituto Sperimentale per il Tabacco, Scafati, Italy (2). The hyphal diameter at the point of anastomosis was reduced, and cell death of adjacent cells occurred (1). Pairings were also made with AG 1, 2, 3, 5, 7, and 11 with no anastomoses observed between the five isolates and testers. For pathogenicity tests, the inoculum of R. solani (no. Rh. Vale 1) was grown on autoclaved wheat kernels at 25°C for 10 days. Plants of cv. Trophy were grown in 10-liter containers (20 × 50 cm, 15 plants per container) on a steam disinfested substrate (equal volume of peat and sand). Inoculations were made on 20-day-old plants by placing 2 g of infected wheat kernels at each corner of the container with 3 cm as the distance to the nearest plant. Plants inoculated with clean wheat kernels served as controls. Three replicates (containers) were used. Plants were maintained at 25°C in a growth chamber programmed for 12 h of irradiation at a relative humidity of 80%. The first symptoms, consisting of water-soaked lesions on the basal leaves, developed 5 days after inoculation with crown rot and plant kill in 2 weeks. Control plants remained healthy. R. solani was consistently reisolated from infected plants. The pathogenicity test was carried out twice with similar results. This is, to our knowledge, the first report of R. solani on lamb's lettuce in Italy as well as worldwide. The isolates were deposited at the AGROINNOVA fungal collection. The disease continues to spread in other greenhouses in northern Italy. References: (1) D. Carling. Rhizoctonia Species: Pages 37–47 in: Taxonomy, Molecular Biology, Ecology, Pathology and Disease Control. B. Sneh et al., eds. Kluwer Academic Publishers, the Netherlands, 1996. (2) J. Parmeter et al. Phytopathology, 59:1270, 1969. (3) B. Sneh et al. Identification of Rhizoctonia Species. The American Phytopathological Society, St. Paul, MN, 1996.


Plant Disease ◽  
2021 ◽  
Author(s):  
Hao Zhou ◽  
Shuang-Feng Yang ◽  
Shao-Mei Wang ◽  
Ke Yao ◽  
Xiao-Yu Ye ◽  
...  

Bletilla striata (Thunb.) Rchb. f. (Orchidaceae), a perennial plant, is a traditional Chinese herb (known as baiji) used to treat hemorrhage, scalding injuries, gastric ulcers, pulmonary diseases, and inflammation (Zu et al. 2019). In May 2019, foliar blight symptoms were observed on approximately 25% of B. striata (cv. Guiji No.1) plants in three plantations (∼4.5 hectares in total) in Ziyuan County, Guangxi Province, China. Initial symptoms were light brown, irregular, water-soaked spots on the plant leaves. Several spots often merged, forming large, irregular, lesions that extended onto the stem after a week and led to leaf abscission, and even plant death. To determine the causal agent, 5-mm squares cut from the margin of 6 infected leaves were surface disinfected in 1% sodium hypochlorite solution for 2 min, rinsed three times with sterile distilled water, plated on potato dextrose agar (PDA), and incubated at 28°C (12-h light-dark cycle) for 3 days. The emerging hyphal tip of a single mycelium was transferred to PDA to obtain pure cultures of the isolates. Twenty isolates were obtained, and 10 isolates (50%) were initially white before turning light brown (∼4 days). Septate hyphae were 4.29 to 10.75 μm (average 6.42 μm) in diameter and branched at right angles with a constriction at the origin of the branch point. Staining with 1% safranin O and 3% KOH solution (Bandoni 1979) revealed multinucleated cells (3 to 9 nuclei per cell, n = 142). This morphology was typical of Rhizoctonia solani Kühn (Meyer et al. 1990). For species confirmation by molecular identification, three isolates (BJ101.6, BJ101.11, and BJ102.2) were cultured on PDA for 4 days, then DNA was extracted from the mycelium using the CTAB method (Guo et al. 2000), and the ribosomal ITS1-5.8S-ITS2 region was amplified by PCR using the universal fungal primers ITS1 and ITS4 (White et al. 1990). Internal transcribed spacer (ITS) sequences of strains BJ101.6, BJ101.11, and BJ102 (deposited in GenBank under accession nos MT406271, MT892815, and MT892814, respectively) had over 99% similarity with those of R. solani AG-2-2 IIIB in GenBank (accession nos JX913810 and AB054858) (Carling et al. 2002; Hong et al. 2012). Phylogenetic analysis using ITS sequences showed that the isolates clustered monophyletically with strains of R. solani AG-2-2 IIIB. The AG of the isolates was confirmed by their ability to grow well on PDA at 35°C, which separates AG-2-2 IIIB from AG-2-2 IV (Inokuti et al. 2019). Based on morphological characteristics and nucleotide sequence analysis, the isolates were identified as R. solani AG-2-2 IIIB. Pathogenicity was tested using 1.5-year-old B. striata (cv. Guiji No.1) plants grown in a perlite and peat moss mixture (1:3) in 7-cm pots. Healthy leaves on plants were inoculated with an aqueous suspension (approximately 1 × 105 hyphal fragments/mL, 100 μL) prepared from cultures of strains BJ101.6, BJ101.11, and BJ102.2, each isolate was inoculated onto three plants; three other plants with sterile water served as controls. All plants were enclosed in transparent plastic bags and incubated in a greenhouse at 28°C for 14 days (12-h photoperiod). Three days post-inoculation, leaves exposed to the mycelial fragments had symptoms similar to those originally observed in the field. No symptoms were detected on control plants. Experiments were replicated three times with similar results. To fulfill Koch’s postulates, R. solani AG-2-2 IIIB was re-isolated on PDA from symptomatic leaves and confirmed by sequencing, whereas no fungus was isolated from the control plants. To our knowledge, this is the first report of R. solani AG-2-2 IIIB causing foliar blight on B. striata in China, and these findings will be useful for further control strategies and research.


Plant Disease ◽  
2008 ◽  
Vol 92 (5) ◽  
pp. 836-836 ◽  
Author(s):  
D. Aiello ◽  
G. Parlavecchio ◽  
A. Vitale ◽  
E. Lahoz ◽  
R. Nicoletti ◽  
...  

Lagunaria patersonii (Adr.) G. Don (cow itch tree) is native to Australia and tolerates salted winds. During July 2007, damping-off of cow itch tree was observed on 4-month-old seedlings growing in a commercial nursery in eastern Sicily, Italy. More than 20% of the seedlings showed disease symptoms. First symptoms consisting of water-soaked lesions at the seedling base that expand rapidly girdle the stem and collapse the seedling in a few days. Diseased tissues were disinfested for 1 min in 1% NaOCl, rinsed in sterile water, plated on potato dextrose agar (PDA) amended with streptomycin sulphate at 100 mg/l, and then incubated at 25°C. A fungus with mycelial and morphological characteristics of Rhizoctonia solani Kühn was consistently yielded. Fungal colonies were initially white, turned brown with age, and produced irregularly shaped, brown sclerotia. Microscopic examination revealed that hyphae had a right-angle branching pattern, were constricted at the base of the branch near the union with main hyphae, and septate near the constriction. Basidia were not observed in the greenhouses or on the plates. Hyphal cells were determined to be multinucleate when stained with 0.5% aniline blue solution and examined at ×400 magnification with a microscope. Anastomosis groups were determined by pairing isolates on 2% water agar in petri plates (3). Pairings were made with tester strains of AG-1 IA, AG-2-2-1, AG-2-2IIIB, AG-2-2IV, AG-3, AG-4, AG-5, AG-6, AG-11. Anastomosis was observed only with tester isolates of AG-4 producing both C2 and C3 reactions. The hyphal diameter at the point of anastomosis was reduced, the anastomosis point was obvious, and cell death of adjacent cells was observed. These results were consistent with other reports on anastomosis reactions (1). The identification of group AG-4 within R. solani has been confirmed by electrophoretic patterns of pectic enzymes (polygalacturonases) in vertical pectin-acrylamide gel stained with ruthenium red (2). Pathogenicity tests were conducted on potted, healthy, 3-month-old seedlings of cow itch tree. Twenty plants were inoculated by placing plugs of PDA from 5-day-old mycelial cultures near the base of the stem. The same number of plants was treated with 1 cm2 PDA plugs as control. Plants were kept at 25°C and 95% relative humidity on a 12-h fluorescent light/dark regimen. Wilt symptoms due to basal stem rot, identical to ones observed in the nursery, appeared 10 days after inoculation and all inoculated plants showed symptoms within 1 month. Control plants remained healthy. The pathogen was reisolated from symptomatic tissues, completing Koch's postulates. To our knowledge, this is the first report in the world of R. solani causing disease on L. patersonii. References: (1) D. E. Carling. Page 37 in: Grouping in Rhizoctonia solani by Hyphal Anastomosis Reactions. Kluwer Academic Publishers, the Netherlands, 1996. (2) R. H. Cruickshank and G. C. Wade. Anal. Biochem. 107:177, 1980. (3) C. C. Tu and J. W. Kimbrough. Mycologia 65:941, 1973.


Plant Disease ◽  
2021 ◽  
Vol 105 (1) ◽  
pp. 213
Author(s):  
S. D. Takooree ◽  
H. Neetoo ◽  
V. M. Ranghoo-Sanmukhiya ◽  
S. Hardowar ◽  
J. E. van der Waals ◽  
...  

Plant Disease ◽  
2019 ◽  
Vol 103 (8) ◽  
pp. 2130-2130
Author(s):  
M. R. Murdock ◽  
J. W. Woodhall ◽  
R. Maggard ◽  
S. Keith ◽  
M. Harrington ◽  
...  

Plant Disease ◽  
2020 ◽  
Vol 104 (12) ◽  
pp. 3251
Author(s):  
Mehi Lal ◽  
Sorabh Chaudhary ◽  
Manoj Kumar ◽  
Sanjeev Sharma ◽  
S. K. Chakrabarti

Plant Disease ◽  
2012 ◽  
Vol 96 (3) ◽  
pp. 456-456 ◽  
Author(s):  
G. Mercado Cárdenas ◽  
M. Galván ◽  
V. Barrera ◽  
M. Carmona

In August 2010, lesions similar to those reported for target spot were observed on Nicotiana tabacum L. plants produced in float systems in Cerrillos, Salta, Argentina. Tobacco leaves with characteristic lesions were collected from different locations in Cerrillos, Salta. Symptoms ranged from small (2 to 3 mm), water-soaked spots to larger (2 to 3 cm), necrotic lesions that had a pattern of concentric rings, tears in the centers, and margins that often resulted in a shot-hole appearance. Isolation of the causal agent was made on potato dextrose agar (PDA) acidified to pH 5 with 10% lactic acid and incubated at 25 ± 2°C in darkness for 2 to 3 days. Hyphal tips were transferred to a new medium and the cultures were examined for morphological characters microscopically (3). Eight isolates were obtained. The rapid nuclear-staining procedure using acridine orange (3) was used to determine the number of nuclei in hyphal cells. Multinucleate hyphae were observed, with 4 to 9 nuclei per cell. Molecular characterization was conducted by examining the internal transcribed spacer (ITS) region from all of the isolates of the pathogen identified as Rhizoctonia solani based on morphological characteristics (1). Fragments amplified using primers ITS1 (5′TCCGTAGGTGAACCTGCGG3′) and ITS4 (5′TCCTCCGCTTATTGATATGC3′) (4) were sequenced and compared with R. solani anastomosis group (AG) sequences available in the NCBI GenBank database. Sequence comparison identified this new isolate as R. solani anastomosis group AG 2-1. Previous isolates of target spot were identified as AG 3 (2). The isolates that were studied were deposited in the “Laboratorio de Sanidad Vegetal” INTA-EEA-Salta Microbial Collection as Rs59c, Rs59b, Rs59, Rs66, Rs67, Rs68, Rs69, and Rs70. The ITS nucleotide sequence of isolate Rs59 has been assigned the GenBank Accession No. JF792354. Pathogenicity tests for each isolate were performed using tobacco plants grown for 8 weeks at 25 ± 2°C with a 12-h photoperiod. Ten plants were inoculated by depositing PDA plugs (0.2 cm) colonized with R. solani onto leaves; plants inoculated with the pure PDA plug without pathogen served as controls. The plants were placed in a 25 ± 2°C growth chamber and misted and covered with polyethylene bags that were removed after 2 days when plants were moved to a glasshouse. After 48 h, symptoms began as small (1 to 2 mm), circular, water-soaked spots, lesions enlarged rapidly, and often developed a pattern of concentric rings of 1 to 2 cm. After 8 days, all inoculated plants showed typical disease symptoms. Morphological characteristics of the pathogen reisolated from symptomatic plants were consistent with R. solani. Control plants remained healthy. These results correspond to the first reports of the disease in the country. Compared to other areas in the world, target spot symptoms were only observed in tobacco plants produced in float systems and were not observed in the field. The prevalence of the disease in Salta, Argentina was 7%. To our knowledge, this is the first report of R. solani AG2.1 causing target spot of tobacco. References: (1) M. Sharon et al. Mycoscience 49:93, 2008. (2) H. Shew and T. Melton. Plant Dis. 79:6, 1995. (3) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St. Paul, MN, 1991. (4) T. J. White et al. Page 282 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.


Sign in / Sign up

Export Citation Format

Share Document