First Report of Target Spot of Tobacco Caused by Rhizoctonia solani AG-2.1

In August 2010, lesions similar to those reported for target spot were observed on Nicotiana tabacum L. plants produced in float systems in Cerrillos, Salta, Argentina. Tobacco leaves with characteristic lesions were collected from different locations in Cerrillos, Salta. Symptoms ranged from small (2 to 3 mm), water-soaked spots to larger (2 to 3 cm), necrotic lesions that had a pattern of concentric rings, tears in the centers, and margins that often resulted in a shot-hole appearance. Isolation of the causal agent was made on potato dextrose agar (PDA) acidified to pH 5 with 10% lactic acid and incubated at 25 ± 2°C in darkness for 2 to 3 days. Hyphal tips were transferred to a new medium and the cultures were examined for morphological characters microscopically (3). Eight isolates were obtained. The rapid nuclear-staining procedure using acridine orange (3) was used to determine the number of nuclei in hyphal cells. Multinucleate hyphae were observed, with 4 to 9 nuclei per cell. Molecular characterization was conducted by examining the internal transcribed spacer (ITS) region from all of the isolates of the pathogen identified as Rhizoctonia solani based on morphological characteristics (1). Fragments amplified using primers ITS1 (5′TCCGTAGGTGAACCTGCGG3′) and ITS4 (5′TCCTCCGCTTATTGATATGC3′) (4) were sequenced and compared with R. solani anastomosis group (AG) sequences available in the NCBI GenBank database. Sequence comparison identified this new isolate as R. solani anastomosis group AG 2-1. Previous isolates of target spot were identified as AG 3 (2). The isolates that were studied were deposited in the “Laboratorio de Sanidad Vegetal” INTA-EEA-Salta Microbial Collection as Rs59c, Rs59b, Rs59, Rs66, Rs67, Rs68, Rs69, and Rs70. The ITS nucleotide sequence of isolate Rs59 has been assigned the GenBank Accession No. JF792354. Pathogenicity tests for each isolate were performed using tobacco plants grown for 8 weeks at 25 ± 2°C with a 12-h photoperiod. Ten plants were inoculated by depositing PDA plugs (0.2 cm) colonized with R. solani onto leaves; plants inoculated with the pure PDA plug without pathogen served as controls. The plants were placed in a 25 ± 2°C growth chamber and misted and covered with polyethylene bags that were removed after 2 days when plants were moved to a glasshouse. After 48 h, symptoms began as small (1 to 2 mm), circular, water-soaked spots, lesions enlarged rapidly, and often developed a pattern of concentric rings of 1 to 2 cm. After 8 days, all inoculated plants showed typical disease symptoms. Morphological characteristics of the pathogen reisolated from symptomatic plants were consistent with R. solani. Control plants remained healthy. These results correspond to the first reports of the disease in the country. Compared to other areas in the world, target spot symptoms were only observed in tobacco plants produced in float systems and were not observed in the field. The prevalence of the disease in Salta, Argentina was 7%. To our knowledge, this is the first report of R. solani AG2.1 causing target spot of tobacco. References: (1) M. Sharon et al. Mycoscience 49:93, 2008. (2) H. Shew and T. Melton. Plant Dis. 79:6, 1995. (3) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St. Paul, MN, 1991. (4) T. J. White et al. Page 282 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.

Download Full-text

First Report of Web Blight on Oregano (Origanum vulgare L.) Caused by Rhizoctonia solani AG-1-IB in Italy

Plant Disease ◽

10.1094/pdis-02-13-0138-pdn ◽

2013 ◽

Vol 97 (8) ◽

pp. 1119-1119 ◽

Cited By ~ 2

Author(s):

A. Garibaldi ◽

D. Bertetti ◽

P. Pensa ◽

A. Poli ◽

M. L. Gullino

Keyword(s):

Rhizoctonia Solani ◽

Its Region ◽

Morphological Characters ◽

Anastomosis Group ◽

Morphological Identification ◽

Pathogenicity Test ◽

Origanum Vulgare ◽

First Report ◽

Plastic Bags ◽

Hyphal Diameter

Origanum vulgare L., common name oregano, family Labiatae, is grown for its aromatic and medicinal properties and as ornamental. In the fall of 2012, a blight was observed in a farm located near Albenga (northern Italy) on 6% of 30,000 50-day-old plants, grown in trays in a peat/perlite mix. Semicircular, water soaked lesions appeared on leaves and stems, starting from the basal ones. As the disease progressed, blighted leaves turned brown, withered, clung to the shoots, and matted on the surrounding foliage. Eventually, infected plants died. Leaf and stem fragments taken from the margin of the diseased tissues belonging to 10 plants were disinfected for 10 s in 1% NaOCl, rinsed with sterile water, and plated on potato dextrose agar (PDA). A fungus with the morphological characters of Rhizoctonia solani was consistently recovered. Three isolates of R. solani obtained from affected plants were successfully anastomosed with R. solani isolate AG 1 (ATCC 58946). Three pairings were made for each tester strain. The hyphal diameter at the point of anastomosis was reduced, the anastomosis point was obvious, and death of adjacent cells was observed. Results were consistent with other reports on anastomosis reactions (2). Isolates from oregano were paired with R. solani isolates AG 2, 3, 4, 6, 7, or 11 and examined microscopically. Anastomosis was not observed in any of the pairings. Tests were conducted twice. Mycelium of 10-day-old isolates from oregano appeared reddish brown, coarse, and radiate. Numerous dark brown sclerotia, 0.3 to 1.0 mm diameter (average 0.7) developed within 10 days after transfer of mycelia to PDA in 90 mm diameter petri dishes at 21 to 24°C. The descriptions of mycelium and sclerotia were typical for subgroup IB Type 1 (4). The internal transcribed spacer (ITS) region of rDNA was amplified using the primers ITS1/ITS4 and sequenced. BLASTn analysis (1) of the 538 bp showed a 99% homology with the sequence of R. solani FJ746937, confirming the morphological identification of the species. The nucleotide sequence has been assigned the GenBank Accession KC493638. For pathogenicity tests, one of the isolates assigned to the anastomosis group AG-1-IB was tested by placing 9 mm diameter mycelial disks removed from PDA 10-day-old cultures of the fungus on leaves of 90-day-old oregano plants (n = 35). Thirty-five plants inoculated with non-inoculated PDA disks served as controls. Plants were covered with plastic bags and maintained in a growth chamber at 25 ± 1°C with 12 h light/dark. The first symptoms, similar to those observed in the farm, developed 3 days after inoculation. Nine days after the artificial inoculation, 50% of plants were dead. About 10 colonies of R. solani were reisolated from infected leaves of inoculated plants. Control plants remained healthy. The pathogenicity test was carried out twice with similar results. Symptoms caused by R. solani have been recently observed on O. vulgare in Greece (3). This is, to our knowledge, the first report of blight of O. vulgare caused by R. solani in Italy. References: (1) S. F. Altschul et al. Nucleic Acids Res., 25:3389, 1997. (2) D. E. Carling. Grouping in Rhizoctonia solani by hyphal anastomosis reactions. In: Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease control. Kluwer Academic Publishers, The Netherlands, pp. 37-47, 1996. (3) C. D. Holevas et al. Benaki Phytopathol. Inst., Kiphissia, Athens, 19:1-96, 2000. (4) R. T. Sherwood. Phytopathology 59:1924, 1969.

Download Full-text

First Report of Web Blight on Rosemary (Rosmarinus officinalis) Caused by Rhizoctonia solani AG-1-IA in Italy

Plant Disease ◽

10.1094/pdis-11-12-1012-pdn ◽

2013 ◽

Vol 97 (6) ◽

pp. 844-844 ◽

Cited By ~ 4

Author(s):

A. Garibaldi ◽

D. Bertetti ◽

P. Pensa ◽

A. Poli ◽

M. L. Gullino

Keyword(s):

Rhizoctonia Solani ◽

Ground Cover ◽

Its Region ◽

Morphological Characters ◽

Anastomosis Group ◽

Rosmarinus Officinalis ◽

Economic Losses ◽

Pathogenicity Test ◽

First Report ◽

Wheat Kernels

Rosmarinus officinalis L., family Labiatae, is an evergreen shrub used in gardens as an aromatic or ground cover plant. In the summer of 2012, a blight was observed in a farm located near Albenga (northern Italy) on 20% of 150,000 70-day-old plants, grown in trays. Water soaked lesions appeared on leaves and stems. As the disease progressed, blighted leaves turned brown, withered, clung to the shoots, and matted on the surrounding foliage. A light mycelium spread on the substrate. Disease progressed from infected plants to healthy ones and, eventually, infected plants died. Leaf and stem fragments taken from the margin of the diseased tissues belonging to 10 plants were disinfected for 10 s in 1% NaOCl, rinsed with sterile water, and plated on potato dextrose agar (PDA). A fungus with the morphological characters of Rhizoctonia solani was consistently and readily recovered. Three isolates of R. solani obtained from affected plants were successfully paired with R. solani tester strains AG 1, 2, 3, 4, 6, 7, or 11 and examined microscopically. Three pairings were made for each recovered isolate. The isolates of R. solani from rosemary anastomosed only with tester strain AG 1 (ATCC 58946). Results were consistent with other reports on anastomosis reactions (2). Tests were repeated once. Mycelium of 10-day-old isolates from rosemary appeared light brown, compact, and radiate. Numerous dark brown sclerotia, 0.7 to 2.0 mm diameter (average 1.3), developed within 10 days at 20 to 26°C. The descriptions of mycelium and sclerotia were typical for subgroup IA Type 2 (4). The internal transcribed spacer (ITS) region of rDNA was amplified using the primers ITS1/ITS4 and sequenced (GenBank Accession No. KC005724). BLASTn analysis (1) of the 657-bp showed a 99% similarity with the sequence of R. solani GU596491. For pathogenicity tests, inoculum of R. solani was prepared by growing the pathogen on wheat kernels autoclaved in 1-liter glass flasks for 8 days. One of the isolates assigned to the anastomosis group AG 1 IA was tested. Fifteen 90-day-old rosemary plants were grown in 15-liter pots in a steam disinfested peat:pomice:pine bark:clay mix (50:20:20:10) infested with 3 g/liter of infested wheat kernels, placed at the base of the stem. Fifteen plants inoculated with non-infested wheat kernels served as control treatments. Plants were covered with plastic bags and arranged in a growth chamber at 20 to 24°C with 12 h light/dark for 15 days. The first symptoms, similar to those observed in the farm, developed 10 days after inoculation. About 10 colonies of R. solani were reisolated from infected leaves and stems of each inoculated plant. Control plants remained healthy. The pathogenicity test was carried out twice with similar results. Symptoms caused by R. solani have been recently observed on R. officinalis in United States (3), India, and Brazil. This is, to our knowledge, the first report of blight of R. officinalis caused by R. solani in Italy. This disease could cause serious economic losses, because rosemary is one of the most cultivated aromatic plants in the Mediterranean region. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) D. E. Carling. Grouping in Rhizoctonia solani by hyphal anastomosis reactions. In: Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease control. Kluwer Academic Publishers, The Netherlands, 1996. (3) G. E. Holcomb. Plant Dis. 76:859, 1992. (4) R. T. Sherwood. Phytopathology 59:1924, 1969.

Download Full-text

First Report of Target Spot of Broadleaf Tobacco Caused by Rhizoctonia solani (AG-3) in Connecticut

Plant Disease ◽

10.1094/pdis-04-12-0335-pdn ◽

2012 ◽

Vol 96 (9) ◽

pp. 1378-1378 ◽

Cited By ~ 1

Author(s):

J. A. LaMondia ◽

C. R. Vossbrinck

Keyword(s):

Rhizoctonia Solani ◽

Sequence Data ◽

Its Region ◽

Anastomosis Group ◽

Growth Chamber ◽

First Report ◽

Potted Plants ◽

Plastic Bags ◽

Target Spot ◽

Half Strength

In June 2011, 15 transplant beds of broadleaf cigar wrapper tobacco (Nicotiana tabacum L., cv. C9) plants in Hartford County, Connecticut, were observed with almost every plant diseased. Leaf lesion symptoms ranged from small (2 to 3 mm) water-soaked spots to larger (2 to 3 cm) lesions. Disease was subsequently observed, also at nearly 100% incidence in a 10-hectare field on that farm and at additional broadleaf tobacco farms from two other towns in Hartford County and one town in Tolland County. Lesions exhibited a pattern of concentric rings, necrotic centers and tears in the centers, and margins that often resulted in a shot-hole appearance. Some lesions had chlorotic halos. Rhizoctonia solani Kuhn (Thanatephorus cucumeris A. B. Frank) was isolated from the margins of lesions that had been surface sterilized in 0.5% NaOCl for 30 s and then rinsed in sterile distilled water and placed on the surface of half-strength potato dextrose agar (PDA). Multiple isolations were made and the pathogen was identified on the basis of mycelial characteristics including multinucleate cells, septate hyphae wider than 7 μm, and hyphal branches occurring at approximately right angles, constricted at the base (4). Eight-week-old potted tobacco plants were each inoculated by spraying with a mycelial suspension (1 × 105 CFU) of an isolate of R. solani recovered from tobacco onto leaves, or with water alone (five plants each). The plants were placed in plastic bags in a 24°C growth chamber and misted. After 2 days, the bags were removed and the potted plants placed in trays filled to a depth of 1 cm with water in the growth chamber. After 8 days, the pathogen was reisolated from all inoculated plants exhibiting water-soaked spots as disease symptoms. Leaves inoculated with water or half-strength PDA plugs alone were asymptomatic. DNA was liberated from hyphae of the R. solani isolate by bead beating in STE buffer using 0.15 mm zirconium beads. Two microliters of the eluate was used to amplify the ITS region. Amplified DNA was purified in a Qiagen QIAquick PCR purification kit and submitted to the Yale science hill genomic facility for standard Sanger dideoxy sequencing. The sequence was exactly the same as an isolate from Massachusetts that we sequenced in 2010 (GenBank Accession No. HQ241274). The ITS sequence confirmed our identification of this new isolate as R. solani anastomosis group (AG) 3. This disease has been previously reported on tobacco from South America, South Africa, and the southern United States (1), Canada (3), and Massachusetts (2). Conditions were very conducive for disease because 2011 was a very wet year in Connecticut. To our knowledge, this is the first report of this disease in broadleaf cigar wrapper tobacco in Connecticut. The sequence data suggested that it may have been introduced to Connecticut from Massachusetts. We have found the target spot pathogen distributed across the tobacco producing area of Connecticut. This constitutes a serious threat as there are no systemic fungicides currently registered for control of this disease in broadleaf tobacco. References: (1) J. S. Johnk et al. Phytopathology 83:854, 1993. (2) J. A. LaMondia and C. R. Vossbrinck, Plant Dis. 95:496, 2010. (3) R. D. Reeleder et al., Plant Dis., 80:712. (4) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St. Paul, MN, 1991.

Download Full-text

First Report of Target Spot of Tobacco Caused by Rhizoctonia solani (AG-3) in Massachusetts

Plant Disease ◽

10.1094/pdis-10-10-0751 ◽

2011 ◽

Vol 95 (4) ◽

pp. 496-496 ◽

Cited By ~ 1

Author(s):

J. A. LaMondia ◽

C. R. Vossbrinck

Keyword(s):

New England ◽

Rhizoctonia Solani ◽

Its Region ◽

Anastomosis Group ◽

Growth Chamber ◽

First Report ◽

Potted Plants ◽

Plastic Bags ◽

Target Spot ◽

Half Strength

In June 2010, shade-grown cigar wrapper tobacco (Nicotiana tabacum L.) plants in Hampshire County, Massachusetts were observed with leaf lesion symptoms that ranged from small (2 to 3 mm) water-soaked spots to larger (2 to 3 cm) lesions. Lesions had a pattern of concentric rings, necrotic centers and tears in the centers, and margins that often resulted in a shot-hole appearance. Some lesions had chlorotic halos. Rhizoctonia solani Kuhn (Thanatephorus cucumeris A.B. Frank) was isolated from lesions and identified on the basis of mycelial characteristics including multinucleate cells, septate hyphae wider than 7 μm and hyphal branches occurring at approximately right angles, and constricted at the base (3). Eight-week-old, potted tobacco plants were each inoculated either by spraying with a mycelial suspension (1 × 105 CFU) (five plants) or by placing colonized half-strength potato dextrose agar (PDA) plugs (0.2 cm) of an isolate of R. solani recovered from tobacco onto leaves (five plants) or with water or half-strength PDA plugs alone (five plants each). The plants were placed in plastic bags in a 24°C growth chamber and misted. After 2 days, the bags were removed and the potted plants were placed in trays filled with water to a depth of 1 cm in the growth chamber. After 8 days, the pathogen was reisolated from inoculated plants exhibiting water-soaked spots as disease symptoms. Leaves inoculated with water or half-strength PDA plugs alone were not diseased. DNA was extracted from the R. solani isolate and the nuclear ribosomal internal transcribed spacer (ITS) region was amplified and sequenced (GenBank Accession No. HQ241274). The ITS sequence confirmed our identification of this new isolate as R. solani anastomosis group (AG) 3. This disease had been previously reported on tobacco from South America, South Africa, the southern United States (1), and Canada (2). To our knowledge, this is the first report of this disease in cigar wrapper tobacco in New England. The humid environmental conditions under which shade tobacco is grown make this new disease a significant threat for the Massachusetts and Connecticut growing area. References: (1) J. S. Johnk et al. Phytopathology 83:854, 1993 (2) R. D. Reeleder et al. Plant Dis. 80:712, 1996. (3) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St. Paul, MN, 1991.

Download Full-text

First Report of Web Blight on Winter Savory (Satureja Montana “Repandens”) Caused by Rhizoctonia solani AG-1-IA in Italy

Plant Disease ◽

10.1094/pdis-12-11-1075-pdn ◽

2012 ◽

Vol 96 (4) ◽

pp. 585-585 ◽

Cited By ~ 1

Author(s):

A. Garibaldi ◽

D. Bertetti ◽

P. Pensa ◽

M. T. Amatulli ◽

M. L. Gullino

Keyword(s):

Rhizoctonia Solani ◽

Late Summer ◽

Its Region ◽

Morphological Characters ◽

Anastomosis Group ◽

Pathogenicity Test ◽

First Report ◽

Hyphal Diameter ◽

Wheat Kernels ◽

Satureja Montana

Satureja montana L. (winter savory “Repandens”) is an evergreen shrub. In late summer 2010, blight was observed on a farm near Albenga (northern Italy) on 3% of 500 potted 2-month-old plants. Semicircular, water-soaked lesions appeared first on stems then on leaves. As the disease progressed, blighted leaves turned brown, withered, clung to the shoots, and matted on the surrounding foliage within 5 to 6 days. Stem fragments taken from the margin of the diseased tissues of 10 plants were disinfected for 10 s in 1% NaOCl, rinsed with sterile water, and plated on potato dextrose agar (PDA) amended with 100 μg/liter streptomycin sulfate. A fungus with morphological characters of Rhizoctonia solani was consistently isolated. Three isolates of R. solani obtained from affected plants were successfully anastomosed with R. solani isolate AG 1 (ATCC 58946). Three pairings were made for each tested strain. Hyphal diameter at the point of anastomosis was reduced, the anastomosis point was obvious, and death of adjacent cells was observed. Results were consistent with other reports on anastomosis reactions (2). Isolates from winter savory were paired with R. solani isolates AG 2, 3, 4, 6, 7, or 11 and examined microscopically. Anastomosis was not observed in any of the pairings. Tests were repeated once. Mycelium of 10-day-old isolates from winter savory appeared light brown, compact, and radiate. Numerous, dark brown sclerotia, 1 to 4 mm in diameter (average 1.7), developed within 20 days after transfer of mycelia to PDA in 90-mm-diameter petri dishes and incubated (11-h daylight, 13-h dark) at 21 to 24°C. Descriptions of mycelium and sclerotia were typical for subgroup IA Type 2 (3). The internal transcribed spacer (ITS) region of rDNA was amplified with primers ITS1/ITS4 and sequenced. BLASTn analysis (1) of the 696 bp showed a 99% homology with the sequence of R. solani. The nucleotide sequence has been assigned GenBank No. JQ313811. For pathogenicity tests, inoculum of R. solani was prepared by growing the pathogen on wheat kernels autoclaved in 1-liter glass flasks (30 min at 121°C and 1 atm) for 15 days. One of the isolates assigned to the anastomosis group AG 1 IA was tested. Five 90-day-old plants of S. montana were inoculated. Each plant grown in 2-liter pots in a steam disinfested peat/pumice/pine bark/clay mix (50:20:20:20:10) was inoculated with 10 g of infested wheat kernels placed at the base of the stem. Five plants inoculated with noninfested wheat kernels served as the control. Plants covered with plastic bags were arranged randomly in a growth chamber at 20 ± 1°C with 12-h light/dark for 5 days. Symptoms, similar to those observed in the farm, developed 4 days after inoculation. Ten colonies of R. solani were reisolated from infected leaves and stems of each inoculated plant. Control plants remained healthy. The pathogenicity test was carried out twice. Symptoms caused by R. solani have been recently observed on S. hortensis in Poland (4). This is, to our knowledge, the first report of blight of S. montana caused by R. solani in Italy. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) D. E. Carling. Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease Control. Kluwer Academic Publishers, The Netherlands, 1996. (3) R. T. Sherwood. Phytopathology 59:1924, 1969. (4) B. Zimowska. Herba Polonica 56:29, 2010.

Download Full-text

First Report of Target Spot of Flue-cured Tobacco Caused by Rhizoctonia solani AG-3 in China

Plant Disease ◽

10.1094/pdis-06-12-0551-pdn ◽

2012 ◽

Vol 96 (12) ◽

pp. 1824-1824 ◽

Cited By ~ 6

Author(s):

Y.-H. Wu ◽

Y.-Q. Zhao ◽

Y. Fu ◽

X.-X. Zhao ◽

J.-G. Chen

Keyword(s):

Rhizoctonia Solani ◽

Morphological Characteristics ◽

Liaoning Province ◽

Universal Primers ◽

Its2 Region ◽

Distilled Water ◽

Leaf Section ◽

Tobacco Leaves ◽

First Report ◽

Target Spot

In early August 2006, a disease caused severe losses in a 1,400-ha field of 5-month-old tobacco plants in Kuandian and Fengcheng Counties, Dandong City of Liaoning in northeast China. Symptoms were observed on almost every plant. Disease symptoms were subsequently observed at nearly 100% incidence in 2,000 ha of fields from three towns in Kaiyuan County and two towns in Xifeng County, Tieling City, Liaoning Province in the second half of August 2006. Symptoms first appeared on leaves as small (2 mm) water soaked spots, and developed into expanded, dark brown lesions (2 cm) on the middle to lower leaves. Each lesion exhibited concentric rings, a necrotic center, and a tear in the center and margin that often resulted in a shot-hole appearance. Fungal isolates were obtained from the margins of lesions that were surface-sterilized by dipping each leaf section into 75% ethyl alcohol for 3 sec, then in 0.1% HgCl2 for 15 sec, rinsing in sterilized distilled water three times, and plating the leaf section onto half-strength potato dextrose agar (PDA). Six isolates were identified as Rhizoctonia solani Kühn on the basis of mycelial characteristics: multinucleate cells, septate hyphae constricted at the junction of hyphae, and hyphal branching at approximately right angles (3). The sequence of the internal transcribed spacer (ITS) 1-5.8S-ITS2 region of rDNA from each of six isolates was amplified by PCR assay using universal primers ITS1 and ITS4. The sequences (GenBank Accession Nos. JQ219152 to JQ219157) matched 100% with the ITS sequence of an isolate of R. solani AG-3 (GQ885147). Koch's postulates were conducted for each of the six isolates by wound-inoculating six tobacco leaves (cv. NC89) detached from a total of three 8-week-old plants. Each tobacco leaf was first surface-sterilized in 0.5% NaOCl for 30 sec, rinsed in sterilized distilled water, and wounded at each of four locations by inserting a needle into the leaf. Each leaf was inoculated by depositing a PDA plug (0.5 cm diameter) colonized with R. solani onto each of the four wounds; wounded control leaves (six tobacco leaves from a total of three plants) were inoculated similarly with non-colonized PDA plugs. Inoculated leaves were incubated at 28°C in natural light within a plastic container covered with a hyaline cap to maintain high relative humidity. Symptoms similar to those observed on the original plants developed on inoculated leaves within 3 days, but not on the control leaves. The pathogen was reisolated from symptomatic leaves but not from control leaves and showed morphological characteristics consistent with those of R. solani. Tobacco target spot has been recorded in South America (1), South Africa (4), Argentina, and the USA (2). However, to our knowledge, this is the first report of target spot caused by R. solani AG-3 on flue-cured tobacco in China. References: (2) J. S. Johnk et al. Phytopathology 83:854, 1993. (4) H. D. Shew et al. Plant Dis. 69:901, 1985. (1) B. Sneh et al. Identification of Rhizoctonia Species. The American Phytopathological Society, St. Paul, MN, 1991. (3) E. Vargas. Turrialba 23:357, 1973.

Download Full-text

First Report of Damping-Off of Rhodiola sachalinensis Caused by Rhizoctonia solani AG-4 HG-II in China

Plant Disease ◽

10.1094/pdis-07-11-0559 ◽

2012 ◽

Vol 96 (1) ◽

pp. 142-142 ◽

Cited By ~ 1

Author(s):

Q. Bai ◽

Y. Xie ◽

X. Wang ◽

Y. Li ◽

J. Gao ◽

...

Keyword(s):

Rhizoctonia Solani ◽

Morphological Characteristics ◽

Its Region ◽

Herbaceous Plant ◽

Protective Effects ◽

Damping Off ◽

First Report ◽

Rhodiola Sachalinensis ◽

Perennial Herbaceous Plant ◽

Safranin O

Rhodiola sachalinensis A. Bor (family Crassulaceae), a perennial herbaceous plant, is distributed mainly in the mountainous areas of China, Japan, Korea, and Russia. It is widely used as a traditional Chinese medicine with adaptogenic properties, cardiopulmonary protective effects, and central nervous system activities (3). Currently, it is extensively cultivated in northeastern China. In August 2010, widespread (>60% of plants were symptomatic) damping-off was observed in a seedling field in Linjiang, China. Leaves and stems near the ground were affected first, with dark lesions forming on the stem and the lowest leaves exhibiting wilt. The wilt spread rapidly over the entire plant with leaves becoming grayish brown and water soaked and then turned black and died. Root rot, defoliation, and damping-off were also observed. Six isolates with morphological characteristics of Rhizoctonia solani Kühn were isolated from symptomatic stems when plated on potato dextrose agar (PDA). Mycelium was branched at right angles with a septum near the branch and a slight constriction at the branch base. Fungal colonies were initially white, turned brown with age, and produced irregularly shaped, brown sclerotia after 8 days on PDA. Hyphal cells removed from cultures grown at 25°C on 2% water agar were determined to be multinucleate when stained with 1% safranin O and 3% KOH solution (1) and examined at ×400 magnification. The internal transcribed spacer (ITS) region of the nuclear rDNA was amplified by using the primers ITS4/ITS5 (2). The ITS sequences (715 bp) were identical in these six isolates (GenBank Accession No. FR878087) and had 100% sequence identity with R. solani AG-4 HG-II (GenBank Accession No. HQ629873) along with numerous other accessions from this AG subgroup. Pathogenicity tests were performed on healthy, potted seedlings of R. sachalinensis. Twenty plants were inoculated near the base of the stem with a 0.6-cm-diameter mycelial plug from 3-day-old PDA cultures for each isolate. Twenty plants inoculated with only PDA plugs served as controls. The plants were covered with plastic bags and kept in a greenhouse at 20 to 25°C for 72 h. All inoculated plants showed characteristic symptoms as previously observed in the seedling field 13 days after inoculation, while control plants remained healthy. R. solani AG-4 HG-II was reisolated from symptomatic tissues on inoculated plants. To our knowledge, this is the first report of R. solani AG-4 HG-II causing damping-off on R. sachalinensis in China. References: (1) R. J. Bandoni. Mycologia 71:873, 1979. (2) D. E. L. Cooke et al. Mycol. Res. 101:667, 1997. (3) T. F. Yan et al. Conserv. Genet. 4:213, 2003.

Download Full-text

First Report of Rhizoctonia solani AG-4 on Epipremnum aureum in Buenos Aires, Argentina

Plant Disease ◽

10.1094/pdis.2001.85.1.96c ◽

2001 ◽

Vol 85 (1) ◽

pp. 96-96 ◽

Cited By ~ 1

Author(s):

E. R. Wright ◽

P. E. Grijalba ◽

L. Gasoni

Keyword(s):

Rhizoctonia Solani ◽

Buenos Aires ◽

Its Region ◽

Anastomosis Group ◽

Causal Agent ◽

Basal Stem Rot ◽

First Report ◽

Brown Discoloration ◽

Epipremnum Aureum ◽

Petri Plate

Root and basal stem rot, blighting, and wilting have been observed on Epipremnum aureum (Linden ex André) plants in many nurseries in and near Buenos Aires since 1997. Infected stem tissues show an intense dark brown discoloration and water soaking near the stem base that eventually leads to plant death. To determine the causal agent of the disease, small pieces of diseased tissue were surface-sterilized for 2 min in 2% sodium hypochlorite and plated on potato-dextrose agar (PDA). Whitish colonies that eventually turned brown developed in 2 to 3 days at 22 to 24°C. Irregularly shaped sclerotia were observed. Isolates typical of Rhizoctonia solani Kuhn exhibited mycelia with branches inclined in the direction of growth, constricted at the point of union with the main hyphae, with a septum in the branch near the constriction. No telemorph was observed. Nuclei in living hyphal mats were stained directly on a microscope slide coated with water agar according to the method of Tu and Kimbrough (4) and were examined at 400× magnification. The cells were multinucleate. Anastomosis group was determined by using known tester isolates of Rhizoctonia spp. (3). Positive anastomosis was observed with tester strains of AG-4 HG-II. The polymerase chain reaction was performed according to the protocol of Boysen et al (1) in order to confirm the anastomosis group. Primers used for the amplification of the ITS region were ITSI and LROR. Amplification of the ITS region indicated lack of variation with AG-4 tester strain. The pathogenicity of the isolate was determined with the inoculum-layer technique (2), consisting of a 7-day-old petri plate culture of the pathogen in PDA that is removed from the dish and placed intact on the soil, 2 to 4 cm under the roots of 10 healthy plants. Some leaves of the plants were placed in contact with the inoculated substratum. For a control, PDA was placed under the roots of other plants. Plants were maintained at 22 to 24°C, with close-to-saturation humidity. After 6 to 10 days, symptoms were similar to those previously observed. Initially leaves that had been placed in contact with the substratum showed dark areas with a watersoaked area 2 to 3 cm in diameter. These lesions expanded over the entire leaf blade moving into the petioles and stems killing the plant. One hundred percent of inoculated plants were infected. Koch's postulates were satisfied after reisolating the fungus. The characteristics of the causal agent are those of multinucleate isolates of R. solani belonging to the anastomosis group AG-4 HG-II (3). This is the first report of R. solani causing disease on E. aureum in Argentina. References: (1) M. Boysen, M. Borja, C. Del Corral, O. Salazar, and V. Rubio. Curr. Genet. 29:174–181, 1996. (2) A. F. Schmitthenner and J. W. Hilty. Phytopathology 52:177–178, 1962. (3) B. Sneh, L. Burpee, and A. Ogoshi. 1991. Identification of Rhizoctonia Species. The American Phytopathological Society, St. Paul, MN. (4) C. C. Tu and J. W. Kimbrough. Mycologia 65:941–944, 1973.

Download Full-text

First Report of Rhizoctonia solani AG2-1 on roots of wheat in Kazakhstan

Plant Disease ◽

10.1094/pdis-04-21-0786-pdn ◽

2021 ◽

Author(s):

Göksel Özer ◽

İmren Mustafa ◽

Tugba Bozoglu ◽

Abdelfattah A. Dababat

Keyword(s):

Rhizoctonia Solani ◽

Its Region ◽

Triticum Aestivum L ◽

Anastomosis Group ◽

Universal Primers ◽

Sodium Hypochlorite Solution ◽

First Report ◽

Pure Cultures ◽

The Impact ◽

Wheat Kernels

In June 2019, approximately 20 tillers of wheat (Triticum aestivum L.) were sampled at the ripening stage (Feekes scale 11) from four different fields in Almaty, Kazakhstan. Brown lesions (3-5 mm in length) were present on the roots of sampled plants, with 20% incidence. To determine the causal agent, diseased roots were surface disinfected in sodium hypochlorite solution (1%) for 3 min, rinsed triple with sterile distilled water, air-dried in a laminar flow hood, and plated onto one-fifth strength potato dextrose agar (PDA) supplemented with 50 ppm chloramphenicol. After three days, the hyphal fragments that developed from the sections were transferred to fresh PDA and incubated at 23°C with 12-h photoperiod for 7 days to obtain pure cultures. Brown pigmented fungal colonies with a constriction at the base of hyphal branches, septa near the branching point, and right-angled branching resembling Rhizoctonia solani were observed. The identification anastomosis group (AG) of a representative isolate for each field was conducted by sequencing the internal transcribed spacer (ITS) region of rDNA with the universal primers ITS4 and ITS5 (White et al. 1990). The resulting sequences of 693 bp length were deposited in GenBank (accession nos. MW898143:MW898146). These sequences were 100% identical to the isolate 8Rs of R. solani AG2-1 (accession no. AF354063). To confirm the pathogenicity of the four isolates, the colonized wheat kernels method described by Demirci (1998) was used to inoculate a sterile potting mix containing peat, vermiculite, and soil (1:1:1 by v/v/v) into which wheat (cv. Seri) was planted. Control pots were inoculated with sterile wheat kernels using the same procedure. Wheat plants were left to grow for four weeks under controlled environmental conditions with a 23°C temperature regime. During the period that the plants remained in the glasshouse, the typical light regime was 16 h. Brown lesions were observed on the roots of plants in the inoculated pots whereas no symptoms were observed on plants grown in the control pots. R. solani was consistently reisolated from symptomatic plants, thereby confirming Koch’s postulates. To our knowledge, this is the first report of R. solani AG2-1 on roots of wheat in Kazakhstan. R. solani AG2-1 isolates have been previously reported to be a weak pathogen to wheat (Roberts and Sivasithamparam 1986; Sturrock et al. 2015; Jaaffar et al. 2016; Özer et al. 2019). We suggest further studies are required to characterize the impact of R. solani AG2-1 in wheat. Considering crop rotation, the selection of non-host crops to this AG group is important to pathogen management, by reducing the amount of inoculum in the soil.

Download Full-text

First Report of Damping-off on Sedum plumbizincicola Caused by Rhizoctonia solani AG 2-1 in China

Plant Disease ◽

10.1094/pdis-08-20-1849-pdn ◽

2020 ◽

Author(s):

Ai Guo He ◽

Jin Chen ◽

Zhi Xin Hu ◽

Jie Zhong ◽

Jun Zi Zhu

Keyword(s):

Rhizoctonia Solani ◽

Management Strategies ◽

Morphological Characteristics ◽

Its Region ◽

Hunan Province ◽

Disease Spread ◽

Damping Off ◽

First Report ◽

Sedum Plumbizincicola

Sedum plumbizincicola X.H. Guo et S.B. Zhou sp. nov. is a plant species of the family Crassulaceae that has the ability to hyperaccumulate cadmium and zinc in high concentrations (Liu et al. 2017). In April of 2018 and 2019, a disease of damping-off was observed on S. plumbizincicola seedlings in a nursery in Changsha (28°13’N; 112°56’E), the Hunan Province of China, in which nearly 1 million seedlings were planted. Approximately 40% of the surveyed plants were infected. The affected plants displayed water-soaking on the shoots and stems, and chlorosis on the leaves. As the disease spread upward, leaf stalks or the whole plants became wilted and collapsed. Five diseased stem and leaf samples were collected. Symptomatic tissues were excised and surface sterilized with 70% ethanol for 10 s, and 0.1% HgCl2 for 2 min, washed with sterile distilled water for three times, and then cultured on potato dextrose agar (PDA) at 26°C in darkness. Fungal colonies were similar in morphology: white, light gray to brown, with hyphae branched at nearly right angles, septa near the branching point and constrictions at the base of hyphal branches. After 10 days, white-gray to brown sclerotia were produced. The morphological characteristics were consistent with those of Rhizoctonia solani J.G. Kühn (Sneh et al. 1991). Genomic DNA of a representative isolate was extracted using the cetyltrimethylammonium bromide method. The internal transcribed spacer (ITS) region of rDNA was amplified and sequenced with the primer pairs ITS4/ITS5 (White et al. 1990). When analyzed by the BLASTn program, the ITS sequence (GenBank Accession No. MN961664) had 100% identity to the corresponding gene sequence of R. solani anastomosis group (AG) 2-1(Accession Nos: LC202869.1 and MH862641.1). In addition, primers Rhsp1/ITS4B and Rhsp2/ITS1F specific for R. solani, and AG21sp/ITS4B specific for R. solani AG 2-1 were also used (Salazar et al. 2000). Results revealed that our isolate was R. solani AG 2-1. Pathogenicity was confirmed via in vivo inoculation of one-month-old S. plumbizincicola seedlings in sterilized nursery soil with four representative isolates. For each pot, five 5-mm-diameter mycelial plugs from 7-days old colonies on PDA were placed in the soil near the base of the stems. Plants inoculated with agar plugs without mycelium served as controls. The inoculated plants were kept in a growth chamber at 25°C with a 12/12 h light/dark cycle. Pathogenicity tests were performed twice, with three replicative potted plants for each isolate in each test. Approximately 25 days after inoculation, the damping-off symptoms resembling those observed in the field were displayed on the inoculated plants, while no obvious symptoms were observed on the control plants. R. solani was re-isolated from all infected plants and molecularly characterized, thus confirming Koch’s postulates. R. solani has been previously reported as the pathogen of damping-off disease in many plants, such as canola (Paulitz et al. 2006) and oat (Zhang et al. 2016). However, to the best of our knowledge, this is the first report of R. solani causing damping-off of S. plumbizincicola in China. S. plumbizincicola is widely planted for heavy metal pollution treatment in China. The occurrence of this disease could seriously affect the production of the seedlings, and management strategies should be developed.

Download Full-text