Novel single nucleotide polymorphisms in the heat shock protein 70.1 gene in South African Nguni crossbred cattle

2019 ◽  
Vol 52 (2) ◽  
pp. 893-901 ◽  
Author(s):  
Lwamkelekile Sitshilelo Mkize ◽  
Oliver Tendayi Zishiri
Keyword(s):  
Heat Shock ◽  
Single Nucleotide Polymorphisms ◽  
Heat Shock Protein ◽  
South African ◽  
Nucleotide Polymorphisms ◽  
Crossbred Cattle ◽  
Single Nucleotide

247 ASSOCIATIONS BETWEEN HEAT SHOCK PROTEIN 70 GENETIC POLYMORPHISMS AND CALVING RATES OF BRAHMAN-INFLUENCED COWS

2010 ◽  
Vol 22 (1) ◽  
pp. 281
Author(s):  
C. Rosenkrans Jr ◽  
A. Banks ◽  
S. Reiter ◽  
L. Starkey ◽  
M. Looper
Keyword(s):  
Heat Shock ◽  
Single Nucleotide Polymorphisms ◽  
Heat Shock Protein ◽  
Genetic Polymorphisms ◽  
Heat Shock Protein 70 ◽  
Promoter Region ◽  
Hsp70 Gene ◽  
Nucleotide Polymorphisms ◽  
Hsp70 Promoter ◽  
Single Nucleotide

Stress proteins and their genetic polymorphisms have been associated with decreased male and female fertility. Our objectives were to 1) identify single nucleotide polymorphisms (SNP) located in the promoter region of the bovine heat shock protein 70 (Hsp70) gene and 2) evaluate associations between Hsp70 SNP and calving rates of multiparous Brahman-influenced cows (n = 99). Genomic DNA was extracted from the buffy coats of EDTA- treated whole blood. Primers HSP-Pro749F (GCCAGGAAACCAGAGACAGA) and HSP-Pro1268R (CCTACGCAGGAGTAGGTGGT) were used for PCR amplification of a 539-base segment of the bovine Hsp70 promoter (GenBank accession number M98823). Eleven single nucleotide polymorphisms were detected: 8 transitions (G1013A, n = 2; G1045A, n = 8; C1069T, n = 4; A1096G, n = 14; G1117A, n = 12; T1134C, n = 7; C1154G, n = 11; andT1204C, n = 56), 2 transversions (A1125C, n = 53; and G1128T, n = 51), and 1 deletion at base position 895 (n = 37). Within an SNP, calving percentages were compared by chi-square analysis. Concentrations of Hsp70 and Julian date were analyzed by ANOVA, with each SNP represented as the main effect in the model. Cows that were homozygous for the minor allele at both transversion (A1125C and G1128T) sites had lower (P < 0.05) calving rates when compared with cows that were homozygous for the primary allele (48 v. 75%). Homozygous and heterozygous deletion of cytosine at base 895 resulted in lower (P < 0.05) calving percentages than homozygous cytosine cows (8, 50, 82%; respectively). In addition, DD cows had the latest (P < 0.05) Julian calving date. Eighteen Hsp70 promoter haplotypes were deduced, and 7 of those haplotypes (n = 37) included the deletion at base 895. Thirty-two cows had the haplotype consistent with the sequence deposited at GenBank, and the remaining 30 cows had an SNP other than the deletion. Cows with the deletion haplotypes had greater (P < 0.05) serum Hsp70 concentrations and lower (P < 0.05) calving rates (5.1, 4.7, and 3.5 MSE 0.5 ng mL-1; and 35, 78, and 87%; respectively, for Deletion, No, and Yes). Furthermore, cows with the deletion haplotypes had the latest (P < 0.05) Julian calving date (85, 77, and 73 d, respectively, for Deletion, No, and Yes). Our results suggest that the promoter region of the bovine Hsp70 gene is polymorphic and might be useful in selecting cows with greater fertility.

scholarly journals Single nucleotide polymorphisms of the heat shock protein 90 gene in varicocele-associated infertility

2005 ◽  
Vol 31 (3) ◽  
pp. 236-244 ◽  
Author(s):  
Pericles A. Hassun Filho ◽  
Agnaldo P. Cedenho ◽  
Samira B. Lima ◽  
Valdemar Ortiz ◽  
Miguel Srougi
Keyword(s):  
Heat Shock ◽  
Single Nucleotide Polymorphisms ◽  
Heat Shock Protein ◽  
Heat Shock Protein 90 ◽  
Nucleotide Polymorphisms ◽  
Single Nucleotide

scholarly journals The effect of single-nucleotide polymorphisms within heat shock protein beta 1 on beef quantity in Korean native steers

2020 ◽  
Vol 63 (2) ◽  
pp. 417-422
Author(s):  
Jung-Keun Suh ◽  
Jae-Sung Lee ◽  
Hongsik Kong ◽  
Yoonseok Lee ◽  
Hong-Gu Lee
Keyword(s):  
Heat Shock ◽  
Single Nucleotide Polymorphisms ◽  
Heat Shock Protein ◽  
Direct Sequencing ◽  
Muscle Growth ◽  
Least Square ◽  
Nucleotide Polymorphisms ◽  
Single Nucleotide ◽  
Fat Thickness ◽  
The Relationship

Abstract. Heat shock protein beta 1 (HSPB1), a member of the heat-shock family of protein, is a relatively small (27 kDa) molecular chaperone protein associated with cellular development. The relationship between HSPB1 expression and muscle growth in beef cattle has previously been reported, but there have been no reports of DNA markers related to meat quantity in Korean native steers. Therefore, the aim of this study was to evaluate the relationship of single-nucleotide polymorphisms (SNPs) within HSPB1 in terms of the carcass traits related to muscle growth in Korean native steers. Through direct sequencing, we discovered three SNPs: g.111 T > C SNP (rs208395876) and g.2548 C > G SNP (rs483014585) were respectively located in 5′ UTR (untranslated region) and 3′ UTR. Further, g.2352 T > C SNP (rs110832311) was located in the adjacent region of the RNA splicing site. The least square means of steers with a CC genotype of g.111 T > C SNP had a significantly higher meat ratio (P = 0.04), while the least square means of steers with a CC genotype of g.2352 T > C SNP had a significantly higher meat ratio (P = 0.002) and lower back-fat thickness (P = 0.004) than those of the other genotype. Moreover, although the least square means of steers with CC-CC, CT-CC, and TT-CC genotypes were significantly decreased for back-fat thickness, they were significantly increased for the meat ratio. Therefore, our results suggested that g.111 T > C SNP and g.2352 T > C SNP could be a causal mutation related to an adipose metabolism in Korean cattle steer.

Single nucleotide polymorphisms at heat shock protein 90 gene and their association with thermo-tolerance potential in selected indigenous Nigerian cattle

2020 ◽  
Vol 52 (4) ◽  
pp. 1961-1970
Author(s):  
Gbolabo O. Onasanya ◽  
George M. Msalya ◽  
Aranganoor K. Thiruvenkadan ◽  
Chirukandoth Sreekumar ◽  
Gopalan K. Tirumurugaan ◽  
...  
Keyword(s):  
Heat Shock ◽  
Single Nucleotide Polymorphisms ◽  
Heat Shock Protein ◽  
Heat Shock Protein 90 ◽  
Nucleotide Polymorphisms ◽  
Single Nucleotide

scholarly journals Single-nucleotide polymorphisms in Toll-like receptor (TLR)-2, TLR4 and heat shock protein 70 genes and susceptibility to scrub typhus

2013 ◽  
Vol 58 (11) ◽  
pp. 707-710 ◽  
Author(s):  
Jeshina Janardhanan ◽  
Sherry Joseph Martin ◽  
Elisabeth Astrup ◽  
R Veeramanikandan ◽  
Pål Aukrust ◽  
...  
Keyword(s):  
Heat Shock ◽  
Single Nucleotide Polymorphisms ◽  
Heat Shock Protein ◽  
Heat Shock Protein 70 ◽  
Scrub Typhus ◽  
Nucleotide Polymorphisms ◽  
Toll Like Receptor ◽  
Single Nucleotide

246 ASSOCIATION OF SINGLE NUCLEOTIDE POLYMORPHISMS WITHIN THE BOVINE HEAT SHOCK PROTEIN 70 GENE AND CALVING RATES

2010 ◽  
Vol 22 (1) ◽  
pp. 280
Author(s):  
C. Rosenkrans Jr ◽  
M. Roe ◽  
M. Brown ◽  
Z. Johnson ◽  
H. Brown ◽  
...  
Keyword(s):  
Heat Shock ◽  
Single Nucleotide Polymorphisms ◽  
Plasma Concentrations ◽  
Pcr Amplification ◽  
Hsp70 Gene ◽  
Nucleotide Polymorphisms ◽  
Single Nucleotide ◽  
Julian Date ◽  
Forage System ◽  
Calving Rate

Heat shock proteins (Hsp) are induced by various stressors such as heat, cold, toxins, and oxygen deprivation. Our objective was to determine the relationship among polymorphisms in the Hsp70 gene, forage system, and calving rates. Genomic DNA for 77 cows was purified from the buffy coats of EDTA-treated whole blood. The cows were Angus (n = 20), Brahman (n = 26), and reciprocal crosses (n = 31). Cows were assigned to and remained on their respective forage system for the duration of the experiment (8 years). Forage systems were endophyte-infected toxic tall fescue (E+) or common bermudagrass (CB). Specific primers for bovine Hsp70 (HSP1778F: CGCTGGAGTCGTACGCCTTC; HSP2326R: CTTGGAAGTAAACAGAAACGGG) were used for PCR amplification of a 523-base segment (based on GenBank accession number U09861). The PCR product was sequenced in both directions. Seven single nucleotide polymorphisms (SNP) were identified, and they were located at base positions 1851 (n = 6), 1902 (n = 4), 1917 (n = 4), 1926 (n =4), 2033 (n = 20), 2087 (n = 6), and 2098 (n =4). Concentrations of Hsp70, Julian date, and lifetime calving rate were analyzed by ANOVA, with each SNP represented as the main effect in the model. Two SNP resulted in altered peptide sequences, also known as mis-sense mutations (1926, aspartic acid to glutamic acid, and 2033, glycine to alanine). Five unique haplotypes were deduced based on the SNP profile (GCGCGCT, GCGCCCT, ACGCGCT, GCGCGGT, GTTGGCA, respectively, for haplotype 1, 2, 3, 4, and 5). Plasma concentrations of Hsp70 were affected by an interaction (P < 0.05) between Hsp70 haplotype and forage system. Cows with haplotypes 4 and 5 consuming fescue had higher plasma Hsp70 concentrations than other cows (5.4, 5.1, 3.8, 5.1, 5.2, 5.1, 5.7, 4.2, 22.4, and 9 MSE 1.5 ng mL-1, respectively, for 1-5 CB and 1-5 E+). That same interaction tended (P < 0.09) to be associated with lifetime calving percentage. Cows with haplotype 4 consuming bermudagrass had the lowest calving rate (58%). These results suggest that the Hsp70 gene in cattle is polymorphic, and those polymorphisms are related to cattle fertility.

scholarly journals PXR and CAR single nucleotide polymorphisms influence plasma efavirenz levels in South African HIV/AIDS patients

2012 ◽  
Vol 13 (1) ◽  
Author(s):  
Marelize Swart ◽  
Heather Whitehorn ◽  
Yuan Ren ◽  
Peter Smith ◽  
Rajkumar S Ramesar ◽  
...  
Keyword(s):  
Single Nucleotide Polymorphisms ◽  
South African ◽  
Nucleotide Polymorphisms ◽  
Aids Patients ◽  
Single Nucleotide ◽  
Hiv Aids
Sign in / Sign up

Export Citation Format

Share Document